Porcine reproductive and respiratory syndrome vaccine virus

Abstract

The invention relates to a porcine reproductive and respiratory syndrome vaccine virus. The present invention relates to modified live porcine reproductive and respiratory syndrome viruses. Viruses are genetically analyzed and selected based on phylogenetic groupings for modification by repeated passage in tissue culture. The ability of modified live viruses to provide protective immunity to heterologous viruses has been assessed. The modified live viruses are useful in vaccines, in particular vaccines that can treat infections of pigs caused by a variety of heterologous viruses.

Description

Technical Field

[0001] The present invention relates to modified live porcine reproductive and respiratory syndrome virus. The modified live virus can be used in vaccines, especially vaccines that provide protection against heterologous viruses. Background Art

[0002] Porcine reproductive and respiratory syndrome (PRRS), originally known as the mystery pig disease, was first described in Europe but has now spread throughout the world. PRRS causes late abortion, stillbirth and infertility in breeding sows, as well as respiratory disease, reduced growth performance and even mortality in multiplier and grower / finisher pigs. PRRS can cause significant economic losses.

[0003] Symptoms of PRRS virus infection in adult porcine animals include, but are not limited to, loss of appetite, lethargy, and fever. Pregnant sows may prematurely give birth to piglets, abort the fetus, or give birth to mummified or stillborn piglets, and up to 10% of pregnant sows may die from PRRS virus infection. Infected piglets have a high pre-weaning mortality rate, are often weak, and may have edema around the eyes. PRRS virus infection in weaned breeding farm pigs or growing / finishing pigs can cause (but is not limited to) growth retardation, respiratory distress, difficulty or rapid breathing, blotchy redness of the skin, and rough hair.

[0004] PRRS virus is an enveloped virus with a linear positive-strand RNA genome of about 15 kb, and the virus has been classified as an Arteriviridae family. To date, at least eleven open reading frames have been identified in the genome. PRRS virus is divided into two genotypes. The European genotype, type 1 PRRS virus (PRRSV-1), is exemplified by the Lelystad strain, while type 2 North American PRRS virus (PRRSV-2) is exemplified by strain VR-2332.

[0005] The two genotypes may have as little as about 60% sequence identity in their genomes, and even within a genotype, individual strains may vary up to about 20% in their genomic identity. This variability complicates the development of vaccines that effectively treat and / or prevent PRRS. Modified live virus (MLV) variants of PRRS virus can produce immunity against PRRS virus attack, but the vaccine is most effective when the attack is a PRRS virus that is genetically homologous to MLV. MLV vaccines are less effective against attacks from heterologous viruses. In addition, MLV has shown some reversion to virulence, causing the vaccine virus to cause disease in vaccinated animals. Vaccines containing inactivated (i.e., killed) PRRS viruses have a better safety profile, but are limited in effectiveness against heterologous attacks.

[0006] Because current PRRS vaccines do not show enough safety and effectiveness to reduce the economic impact of PRRS virus infection, new and improved vaccines are needed. Preferably, these vaccines will be both safe and effective. If the vaccine comprises weakened MLV, these weakened MLV should not show the response to virulence, so as to be considered as safe for use in the field. For example, by adapting the PRRS strain to grow in tissue culture cells for at least 60 generations, at least 70 generations, at least 80 generations, or preferably at least 85 generations, MLV should not show the response to virulence. In order to be effective, the vaccine virus strain should be able to induce protective immunity against a series of phylogenetic diversity wild-type PRRS strains in porcine animals. Preferably, the new PRRS vaccine virus strain will be able to induce protective immunity against at least three phylogenetic different wild-type PRRS strains in porcine animals. Summary of the invention

[0007] The present invention provides a modified live porcine reproductive and respiratory syndrome vaccine virus strain, wherein the common complementary DNA sequence of the PRRS strain is at least 90% identical to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4. Preferably, the modified live strain may have a common complementary DNA sequence that is at least 95% identical to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4. More preferably, the modified live strain may also have a common complementary DNA sequence that is at least 98% identical to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4. As will be appreciated by those of ordinary skill, due to the high mutation rate of the PRRS virus, the modified live PRRS strain may contain multiple subpopulations, each with a homologous but non-identical genome.

[0008] The present invention provides a modified live porcine reproductive and respiratory syndrome (PRRS) virus strain, wherein the PRRS virus strain is a DE 14-3073, ES13-49, IT 14-32 or PL 14-02 strain. The PRRS virus strain should preferably be passaged at least 60 times in tissue culture cells, or more preferably 70 times, or even more preferably 80 times. Most preferably, the PRRS virus strain should be passaged 85 times in tissue culture cells. This passage in tissue culture cells can be used to weaken the modified live PRRS virus strain. When the weakened PRRS virus strain is administered to pig animals, these strains may cause subclinical but non-clinical disease. The modified live PRRS virus strain passaged at least 80 times has a lower probability of returning to wild-type virulence. Most preferably, the modified live PRRS virus strain passaged 85 times has a lower probability of returning to wild-type virulence.

[0009] The present invention provides an immunogenic composition comprising a modified live PRRS virus strain having a common complementary DNA sequence that is at least 90% identical to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4. Preferably, the modified live strain may have a common complementary DNA sequence that is at least 95% identical to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4. More preferably, the modified live strain may also have a common complementary DNA sequence that is at least 98% identical to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4. As will be appreciated by a person of ordinary skill, due to the high mutation rate of PRRS virus, the modified live PRRS strain may contain multiple subpopulations, each subpopulation having a homologous but non-identical genome.

[0010] The present invention provides an immunogenic composition comprising a modified live PRRS virus strain, wherein the PRRS virus strain is a DE 14-3073 strain, an ES 13-49 strain, an IT 14-32 strain or a PL 14-02 strain. The DE 14-3073 strain or the ES 13-49 strain or the IT 14-32 strain or the PL 14-02 strain can be passaged at least 80 times, or preferably even 85 times, in tissue culture cells. Most preferably, the immunogenic composition comprises at least one pharmaceutically acceptable excipient. The immunogenic composition may also comprise additional antigens from different viruses or from bacterial strains or from parasites.

[0011] The present invention provides an immunogenic composition comprising a modified live PRRS virus strain, wherein the common complementary DNA sequence of the PRRS strain is at least 90% identical to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4. Preferably, the modified live strain may have a common complementary DNA sequence that is at least 95% identical to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4. Most preferably, the modified live strain may also have a common complementary DNA sequence that is at least 98% identical to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4. The vaccine may further comprise an adjuvant. The vaccine may further comprise a pharmaceutically acceptable excipient, stabilizer, solubilizer or diluent. The vaccine may comprise additional antigens from different viruses or from bacterial strains or from parasites.

[0012] The present invention provides a vaccine for preventing porcine reproductive and respiratory syndrome in pig animals. Since PRRS is caused by PRRS virus, the present invention provides a vaccine for preventing PRRS virus infection. The present invention also provides a vaccine for use in pig animals to alleviate the symptoms caused by PRRS virus infection. The infection may come from a wild-type lethal strain of PRRS virus. Symptoms may be, but are not limited to, loss of appetite, lethargy, fever, premature birth, abortion, stillbirth, edema, growth retardation, coughing, respiratory distress, difficulty or rapid breathing, skin spots and redness, rough hair, lung lesions, virus shedding and death. The present invention provides a vaccine for preventing PRRS in pig animals. Preferably, the vaccine comprises a modified live PRRS strain having a common complementary DNA sequence that is at least 90%, at least 95% or at least 98% identical to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4. Most preferably, the vaccine comprises a modified live PRRS strain which is a DE 14-3073 strain, an ES 13-49 strain, an IT 14-32 strain or a PL 14-02 strain. The vaccine may further comprise a pharmaceutically acceptable excipient. The vaccine may further comprise an adjuvant. The vaccine may comprise additional antigens from different viruses or from bacterial strains or from parasites.

[0013] The present invention provides a method for preventing symptoms of porcine reproductive and respiratory syndrome in a porcine animal, comprising administering to the porcine animal an immunogenic composition comprising a modified live PRRS virus strain. The present invention also provides a method for preventing porcine reproductive and respiratory syndrome in a porcine animal, comprising administering to the porcine animal an immunogenic composition comprising a modified live PRRS virus strain. Preferably, the modified live PRRS virus strain used in the method will have a common complementary DNA sequence that is at least 90% identical to a sequence selected from the group consisting of SEQID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4. More preferably, the modified live PRRS virus strain used in the method will have a common complementary DNA sequence that is at least 95% identical to a sequence selected from the group consisting of SEQID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4. Most preferably, the modified live PRRS virus strain used in the method will have a common complementary DNA sequence that is at least 98% identical to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4. The immunogenic composition may further comprise a pharmaceutically acceptable excipient. The immunogenic composition may comprise additional antigens from different viruses or from bacteria or from parasites.

[0014] The present invention provides a method for preventing porcine reproductive and respiratory syndrome in a porcine animal, comprising administering to the porcine animal an immunogenic composition comprising a modified live porcine reproductive and respiratory syndrome (PRRS) virus strain, wherein the PRRS virus strain is a DE 14-3073 strain, an ES 13-49 strain, an IT 14-32 strain or a PL 14-02 strain, which can be passaged at least 80 times, or preferably even 85 times, in tissue culture cells for use in the method. The immunogenic composition may further comprise a pharmaceutically acceptable excipient. The immunogenic composition may comprise additional antigens from different viruses or from bacterial strains or from parasites.

[0015] The present invention provides a method for preventing symptoms caused by PRRS virus infection in porcine animals, the method comprising administering an immunogenic composition to the porcine animal, the immunogenic composition comprising a modified live porcine reproductive and respiratory syndrome (PRRS) virus strain, wherein the common complementary DNA sequence of the PRRS strain is preferably at least 90% identical to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4. More preferably, the modified live strain used in the method may also have a common complementary DNA sequence that is at least 95% identical to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4. Most preferably, the modified live strain used in the method may also have a common complementary DNA sequence that is at least 98% identical to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4. The immunogenic composition may further comprise a pharmaceutically acceptable excipient. The immunogenic composition may also comprise additional antigens from different viruses or from bacterial strains or from parasites.

[0016] The present invention provides a method for alleviating symptoms caused by PRRS virus infection in porcine animals, the method comprising administering an immunogenic composition to the porcine animal, the immunogenic composition comprising a modified live porcine reproductive and respiratory syndrome (PRRS) virus strain, wherein the PRRS virus strain is a DE 14-3073 strain, an ES13-49 strain, an IT 14-32 strain or a PL 14-02 strain, which can be passaged at least 80 times, or preferably even 85 times, in tissue culture cells for the method. The immunogenic composition may further comprise a pharmaceutically acceptable excipient. The immunogenic composition may also comprise additional antigens from different viruses or from bacterial strains or from parasites. PRRS virus infection may be an infection caused by a virulent PRRS virus that is heterologous to the live PRRS virus strain modified in the immunogenic composition. If the genomic consensus sequence of each virus strain is mapped to a different phylogenetic group, then the two PRRS virus strains are considered to be heterologous. Two PRRS virus strains were considered heterologous if the complementary DNA consensus sequence of each virus strain mapped to different phylogenetic groups.

[0017] The present invention provides a modified live PRRS virus strain for use in the preparation of a medicament for preventing or alleviating PRRS symptoms, wherein the modified live PRRS virus comprises a common complementary DNA sequence that is at least 90% identical to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4. Preferably, the modified live strain may also have a common complementary DNA sequence that is at least 95% identical to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4. More preferably, the modified live strain may also have a common complementary DNA sequence that is at least 98% identical to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4.

[0018] The present invention provides the purposes of the modified live PRRS virus strains comprising DE 14-3073 strain, ES13-49 strain, IT 14-32 strain or PL 14-02 strain in the preparation of a medicine for preventing or alleviating PRRS symptoms. The modified live PRRS virus strain should be passaged at least 80 times in tissue culture cells, or preferably even 85 times. This passage in tissue culture cells can be used to appropriately weaken the modified live PRRS virus strain. When the weakened PRRS virus strain is applied to pig animals, these strains may cause subclinical but non-clinical diseases. The modified live PRRS virus strains passaged at least 80 times have a lower probability of returning to wild-type virulence.

[0019] The present invention provides the use of an immunogenic composition comprising a modified live PRRS virus strain in the preparation of a medicament for preventing PRRS virus infection, wherein the modified live PRRS virus strain comprises a common complementary DNA sequence that is at least 90% identical to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4. The modified live strain for this use may also have a common complementary DNA sequence that is at least 95% identical to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4. The modified live strain for this use may also have a common complementary DNA sequence that is at least 98% identical to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4.

[0020] The present invention provides the use of an immunogenic composition comprising a modified live PRRS virus strain in the preparation of a medicament for preventing PRRS virus infection, wherein the modified live PRRS virus strain comprises a DE 14-3073 strain, an ES13-49 strain, an IT 14-32 strain or a PL 14-02 strain. The PRRS virus strain should be passaged at least 80 times in tissue culture cells, or preferably even 85 times. This passage in tissue culture cells can be used to appropriately weaken the modified live PRRS virus strain. When the weakened PRRS virus strain is applied to pig animals, these strains may cause subclinical but non-clinical disease. The modified live PRRS virus strain passaged at least 80 times has a lower probability of returning to wild-type virulence. The modified live PRRS virus strain passaged 85 times has a lower probability of returning to wild-type virulence.

[0021] The present invention provides the use of an immunogenic composition comprising a modified live PRRS virus strain in the preparation of a medicament for protecting porcine animals from PRRS virus infection, wherein the modified live PRRS virus strain comprises a common complementary DNA sequence that is at least 90% identical to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4. The modified live strain for this use may also have a common complementary DNA sequence that is at least 95% identical to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4. The modified live strain for this use may also have a common complementary DNA sequence that is at least 98% identical to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4.

[0022] The present invention provides the use of an immunogenic composition comprising a modified live PRRS virus strain in the preparation of a medicament for protecting porcine animals from PRRS virus infection, wherein the modified live PRRS virus strain comprises a DE 14-3073 strain, an ES13-49 strain, an IT 14-32 strain or a PL 14-02 strain. The PRRS virus strain should be passaged at least 80 times in tissue culture cells, or preferably even 85 times. This passage in tissue culture cells can be used to appropriately weaken the modified live PRRS virus strain. When the weakened PRRS virus strain is applied to porcine animals, these strains may cause subclinical but non-clinical disease. The modified live PRRS virus strain passaged at least 80 times has a lower probability of returning to wild-type virulence. The modified live PRRS virus strain passaged 85 times has a lower probability of returning to wild-type virulence. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Phylogenetic analysis of PRRSV-1 DE 14-3073 strain, ES 13-49 strain, IT 14-32 strain or PL 14-02 strain, as well as commercially available vaccines and isolates selected based on ORF5 nucleotide sequences constructed by proximity ligation. DETAILED DESCRIPTION

[0024] Unless otherwise stated, as used in the following discussion, the terms "a" or "an" should be understood to cover one or more.

[0025] As used herein, the term "virus" may refer to a species of virus, or, interchangeably, to an individual infectious unit that may contain nucleic acid and protein. An individual infectious unit is also referred to as a "virus particle" or "virion," the latter two terms being synonymous.

[0026] As used herein, a "strain" or "isolate" of a virus refers to a collection of genetically homologous virions. If two viruses are mapped to the same phylogenetic branch, the two viruses are considered to be "homologous". If the two viruses are mapped to different phylogenetic branches, the two viruses are considered to be "heterologous". Since the PRRS virus has a high mutation rate, it should be understood that a single PRRS strain contains separate virions with related but variable genetic sequences. Therefore, a subgroup of strains is present in each PRRS strain, and the genetic sequence of the PRRS strain is a consensus sequence, so that the genetic sequence of a single member of the PRRS strain may not be identical to the consensus sequence of the strain. A "shared" sequence is a nucleic acid sequence in which each nucleic acid residue at a given position is present in a PRRS virus strain or isolate>51% of the polynucleotides.

[0027] "Percent identity" can be determined by calculating the number of identical nucleotides or amino acids in the same position in a nucleic acid or protein. The calculation of percent identity includes determining the best alignment between two or more sequences. Alignment can take into account insertions and deletions (i.e., "gaps") in each of the sequences to be tested (such as, but not limited to, the non-coding regions of the nucleic acid), as well as truncations or extensions of polypeptide sequences. Computer programs and algorithms such as the Basic Local Alignment Search Tool (BLAST) can be used to determine percent identity. BLAST is one of the many resources provided by the National Center for Biotechnology Information. Because the genetic code is degenerate, and more than one codon can encode a given amino acid, if the nucleic acid encodes the same polypeptide, the coding region of the nucleic acid is considered to be the same. Therefore, percent identity can also be calculated based on the polypeptide encoded by the nucleic acid. Percent identity can be calculated based on a portion of a full-length shared genomic sequence or a genomic sequence, such as, for example, but not limited to, a single open reading frame (ORF).

[0028] As used herein, the term "modified live virus" applies to any individual virus particle (i.e., "virion") or a variety of virus particles whose genetic sequence has been changed from the genetic sequence of a naturally occurring wild-type virus but still induces protective immunity against the wild-type virus. Changes include, but are not limited to, genetic mutations, such as insertions and deletions of nucleotides and conversions and transversions of one nucleotide to another. Changes can be achieved by adapting the wild-type virus to replication in a tissue culture system and continuing to passage the virus in the tissue culture system, whereby the virus accumulates genetic mutations. Changes can also be accomplished using molecular techniques. Attenuated viruses form a subset of modified live viruses.

[0029] As used herein, the term "attenuated" or "attenuated" means that the ability of a virus to cause or exacerbate clinical disease has been reduced or eliminated. An attenuated virus can still infect a host cell in vitro or in vivo, and the infection can result in a subclinical effect in the host organism, but the infection does not result in one or more clinical disease symptoms.

[0030] In contrast, as used herein, "inactivated" viruses refer to viruses that can no longer replicate in a host cell. Inactivated viruses are considered to be killed or dead viruses. Inactivation can be accomplished by a variety of methods, including but not limited to chemical alterations of viral proteins, chemical or physical alterations of the structure of the virion, or chemical or physical alterations of viral nucleic acids.

[0031] "Antigen" is any molecule that can be specifically detected by the immune system of an organism. Typically, a viral antigen is a viral protein encoded by the viral genome or derived from a product of the viral genome. The presence of viral antigens can be specifically detected by surface antigen receptors of host T lymphocytes and host B lymphocytes and by antibody molecules synthesized by host cells.

[0032] "Immunogenicity" refers to the ability of an antigen to elicit an immune response, including an antigen-specific response and a non-antigen-specific response or an innate immune response. "Protective immunity" is an immune response that can alleviate or prevent clinical symptoms when an immunized animal is attacked or exposed to a pathogenic viral strain. As will be appreciated by those skilled in the art, protective immunity can decrease with the increase in the age of the immunized animal over time or. Protective immunity as used herein should be effective for at least four months from the date of the most recent immunization, but preferably for at least six months. Protective immunity can be elicited in the case of a single-dose vaccine. A second dose or additional dose can be used to increase or prolong a protective immune response. For example, improving the protective immune response of a breeding sow may result in an increase in the level of maternal antibodies in a piglet.

[0033] In contrast to antigens, "adjuvants" are nonspecific stimulators of immune responses. Adjuvants can stimulate innate immune responses by binding to and activating pattern recognition receptors (PRRs). Such stimulators of PRRs can be, for example, viral or bacterial nucleic acids, lipids from bacteria or parasites, or bacterial proteins or toxins, or any artificially constructed mimics of such molecules. Adjuvants also include, but are not limited to, inorganic compounds that aggregate antigens to promote recognition by B lymphocytes or uptake by phagocytes, such as alum, aluminum hydroxide, aluminum phosphate, hydroxyapatite, or ammonium sulfate; oils; and detergents. Adjuvants can also be host mediators of immune signaling, such as, but not limited to, cytokines, lymphokines, chemokines, interferons, anaphylatoxins, growth factors, differentiation factors, and adhesion molecules.

[0034] As used herein, an "immunogenic composition" is a composition that elicits an immune response when administered to an animal. An immunogenic composition comprises at least one antigen and at least one pharmaceutically acceptable excipient. The antigen may be a live or inactivated whole virus, bacterium or other pathogen. The antigen may also be an antigen molecule isolated, purified or partially purified from a virus, bacterium or other pathogen. The antigen may be a polypeptide, polysaccharide, nucleic acid or lipid.

[0035] As used herein, a "vaccine" is an immunogenic composition that, when administered to an animal, confers protection, resistance, prevention, or alleviation of disease symptoms caused by a pathogenic organism, such as a virus. A PRRS vaccine may include, but is not limited to, live or inactivated viral antigens or whole virions in combination with at least one pharmaceutically acceptable excipient.

[0036] As used herein, the terms "treating," "treat," or "treatment" include, but are not limited to, inhibiting, slowing, stopping, alleviating, improving, or reversing the progression or severity of an existing symptom, disorder, condition, or disease. Treatment can be applied or administered therapeutically.

[0037] As used herein, the terms "preventing," "prevent," or "prevention" include, but are not limited to, reducing, decreasing, or ameliorating the risk of a symptom, disorder, condition, or disease, as well as protecting an animal from a symptom, disorder, condition, or disease. Prevention can be applied or administered prophylactically.

[0038] As used herein, "administering to an animal" includes, but is not limited to, dermal, subcutaneous, intramuscular, mucosal, submucosal, transdermal, oral or intranasal administration. Administration may include injection or topical administration.

[0039] The term "pharmaceutically acceptable excipient" refers to those excipients commonly used in the preparation of veterinary and pharmaceutical compositions and should be pure and non-toxic in the amounts used. In certain embodiments, the pharmaceutical composition may contain excipients for modifying, maintaining or preserving, for example, the pH, osmotic pressure, viscosity, clarity, isotonicity, sterility, stability, adsorption or penetration of the composition. Some examples of acceptable excipients can be found in, for example, Remington's Pharmaceutical Sciences and the Handbook of Pharmaceutical Excipients, 18th edition, (AR Genrmo ed.), 1990, Mack Publishing Company and later editions and Remington: The Science and Practice of Pharmacy, Lloyd V. Allen ed., Pharmaceutical Press, London, England, 22nd edition, 2012, and include diluents, vehicles, carriers, stabilizers, preservatives, solvents, suspending agents, emulsifiers, antimicrobial agents, antioxidants, buffers, chelating agents, complexing agents, carbohydrates, proteins, diluents and / or pharmaceutical adjuvants. In certain embodiments, the primary vehicle or carrier in the pharmaceutical composition can be aqueous or non-aqueous in nature. For example, suitable vehicles or carriers can be water for injection, physiological saline solution, and other materials commonly found in compositions for parenteral administration.

[0040] As used herein, the term "porcine animal" refers to a pig, any animal belonging to the genus Sus in the family Suidae, an even-toed ungulate.

[0041] The following experimental examples illustrate modified live PRRS viruses. The following experimental examples also illustrate immunogenic compositions comprising modified live PRRS viruses. The following experimental examples also illustrate the use of modified live PRRS viruses to prevent or alleviate PRRS symptoms in porcine animals. It should be understood that other embodiments and uses will be apparent to those skilled in the art, and the present invention is not limited to these specific illustrative examples or preferred embodiments.

[0042] Example 1

[0043] The aim of this study was to identify potential strains for vaccine development. A total of 36 PRRS1 field isolates were evaluated for their potential as vaccines. The following were the preparations of pre-master seed viruses (Pre-MSV) of four type 1 (European) PRRS virus (PRRSV-1) strains: DE 14-3073, ES13-49, IT 14-32, and PL 14-02.

[0044] Initial isolation of PRRSV-1 strains was performed using serum and lung tissue from pig herds diagnosed by positive PRRSV test results in Europe between 2013 and 2014. The herds were not vaccinated against PRRSV but had clinical signs characteristic of PRRSV infection, including reproductive failure in pregnant gilts and sows (i.e., late abortions, early farrowing, weak births and stillborn piglets and / or increased pre-weaning mortality) and / or growth retardation and respiratory problems in young pigs.

[0045] Virus isolation was performed in primary culture of porcine alveolar macrophages (PAM). To obtain PAM cultures, 3-week-old piglets were used as donors. Briefly, lungs were obtained under sterile conditions after humane euthanasia of the piglets and then rinsed with phosphate-buffered saline to recover PAM cells. The obtained cell suspension was centrifuged at 800 × g for 15 minutes at 4 ° C, and the supernatant was discarded. The precipitated cells were resuspended in Dulbecco's modified Eagle medium (DMEM) and washed twice using DMEM as a diluent after the above centrifugation conditions.

[0046] The cells were cultured at 3 × 10 cells / mL in DMEM supplemented with 10% fetal bovine serum (FBS) and antibiotic-antimycotic solution (100 units / mL penicillin, 100 μg / mL streptomycin, and 0.25 μg / mL amphotericin B). 6 The final concentration of cells / mL was counted and seeded in different supports (i.e., cell culture flasks or plates of different sizes). The cells were cultured at 37°C in an atmosphere containing 5% CO2.

[0047] Clinical samples were processed according to different procedures depending on their nature. Therefore, serum samples were filtered through a 0.22 μm sterile syringe filter and kept at -80 °C until used for virus isolation. On the other hand, tissue samples including tonsils and lungs were homogenized at 1:10 using DMEM as a diluent. The homogenate was clarified by centrifugation at 2500 × g for 15 minutes, and the supernatant was filtered through a 0.22 μm sterile syringe filter and kept at -80 °C until used for virus isolation.

[0048] To infect PAM cultures, the culture medium is removed and clinical samples (i.e., treated serum samples or treated tissue samples) are added in different amounts depending on the support used. After adsorption at 37°C for 1.5 hours, the culture is washed and fresh DMEM supplemented for cell maintenance is added. The cytopathic effect (CPE) of the culture is observed every day. When CPE is observed, the culture is harvested. After 3 cycles of freezing and thawing, cell debris is removed by centrifugation at 2500 × g for 15 minutes at 4°C, and the supernatant is frozen and stored at -80°C. The presence of porcine reproductive and respiratory syndrome virus (PRRSV) in the culture was confirmed by reverse transcription and polymerase chain reaction (RT-PCR).

[0049] When CPE was not observed, the culture was considered negative, and the original clinical sample (i.e. serum sample or tissue sample) was used for bioassay and inoculated into 3-week-old piglets raised in isolation. For this reason, the clinical sample was filtered and injected into the pig by intramuscular route. After one week, blood samples were drawn from the exposed pigs to confirm viremia by RT-PCR. The pigs confirmed as viremia were euthanized, and blood, tonsil and lung samples were collected at the time of autopsy and used as inoculum, for the second virus isolation attempt in PAM culture according to the above method.

[0050] Growth of PRRSV isolates in the MARC-145 cell line was attempted only for isolates that grew well in PAM and could generate seed stocks. To this end, MARC-145 cells were plated at 5 x 10 5 The concentration of cells / flask was inoculated in 25cm 2 Cell culture flasks were placed in the culture flasks and maintained at 37°C in an atmosphere containing 5% CO2 in DMEM supplemented with 10% FBS and antibiotic-antimycotic solution (100 units / mL penicillin, 100 μg / mL streptomycin and 0.25 μg / mL amphotericin B). The pre-confluent cultures were infected with the supernatant of the positive PAM cultures following the same protocol as described for infection of PAM cultures. After adsorption, the cells were washed and cultured in DMEM medium supplemented with 5% FBS and the aforementioned antibiotic-antimycotic solution.

[0051] After the initial isolation, the viruses were amplified and primary virus stocks (with a volume of at least 100 mL) were generated for each isolate in PAM culture. To this end, the virus was cultured in DMEM supplemented with 10% FBS and the aforementioned antibiotic-antimycotic solution at 75 cm 2 3x 10 in a bottle 6PAM cells were cultured at 37°C in an atmosphere containing 5% CO2 for 24 hours at a concentration of 10 cells / mL. The culture medium was then discarded, the cells were washed with fresh DMEM, and the viral inoculum was added. After adsorption for 1.5 hours at 37°C, the culture was washed and supplemented with fresh DMEM for cell maintenance. The culture was observed for CPE every day. The culture was harvested when most of the cells in the culture were killed. After 3 cycles of freezing and thawing, cell debris was removed by centrifugation at 2500xg for 15 minutes at 4°C, and the supernatant containing the virus was frozen and stored at -80°C. Viral titers were calculated according to the method of Reed and Muench (1938) and expressed as log TCID 50 The virus stocks were stored at -80°C and used for different purposes in this study.

[0052] The same procedure is used for MARC-145 cell culture.MARC-145 cell culture was inoculated as previously described for initial separation and stored at 37°C in an atmosphere containing 5% CO2.When CPE was evident (i.e. affecting about 70-80% of the monolayer), or after 5 days of cultivation (if CPE was not observed), the culture was subjected to three cycles of freezing and thawing, clarified by centrifugation for 15 minutes at 2500x g, and the supernatant was used to inoculate fresh MARC-145 cell culture.The remaining supernatant of each passage was stored at -80°C.A total of 60 passages were carried out in the MARC-145 cell line for each PRRSV isolate.

[0053] At passages 30 and 50, virus stocks were cloned by plaque purification according to standard methods. 1 Up to 10 6 When each virus stock solution of serial dilutions of 1% was pre-converged, a 6-well plate previously inoculated with MARC-145 was inoculated. After adsorption for 1.5 hours, the inoculum was taken out from each well and the cells were covered with fresh DMEM culture medium supplemented with 5% FBS, the above-mentioned antibiotic-antimycotic solution and 1% low melting point agarose. After 2-4 days of cultivation, individual plaques were selected and picked up under a phase contrast microscope according to the isolate. Based on its complete separation in the monolayer, at least five plaques were selected for each virus in each round of purification to ensure the clonal nature of the selected virus. The selected plaques were used as inoculum for the next round of purification. The procedure was repeated three times to ensure that the obtained viral progeny originated from a single virus.

[0054] Example 2

[0055] The aim of this study was to further characterize the PRRS-1 isolates. A set of previously designed primers was used to amplify the portion of ORF1 encoding nsp2 and ORFs 2 to 7 by RT-PCR. To this end, the PCR product was used following the manufacturer's instructions. Total RNA was obtained from all viral stocks using the Viral RNA Mini Kit (Qiagen, USA). For reverse transcription and polymerase chain reaction (RT-PCR), 15 μL of total RNA was used as a template. A commercial one-step RT-PCR kit (SuperScript III One-Step RT-PCR PLATINUM The RT-PCR products were prepared using a commercial kit ( Purification gel kit, Qiagen, USA) was purified according to the manufacturer's instructions. The samples were amplified by asymmetric PCR with fluorescent terminators using the same primer pairs used for RT-PCR, and the products were analyzed by electrophoresis on an ABI prism 310 genetic analyzer (Applied Biosystems, USA) to determine the individual sequences of the two DNA chains of each PCR product. At least two different RT-PCR products were sequenced to verify that no errors occurred during DNA amplification and that the obtained sequences were correct. ClustalOmega software was used to manually correct, clear errors and align sequences. The obtained sequences were compared with the genotype 1 PRRSV prototype Lelystad virus and the vaccine strain that constitutes the basis of the vaccine. PRRS (Merck Animal Health) (DV strain), PRRS (Laboratorios Hipra) (VP-046BIS strain) and INGELVAC EU (Boehringer Ingelheim) (strain 94881). In addition, they have been compared with the genotype 2 prototype strain VR-2332, which is a INGELVAC The strain of MLV vaccine (Boehringer Ingelheim) is also commercially available in Europe.

[0056] Nucleotide similarities between the PRRSV isolates obtained, as well as the similarities between each field isolate and the vaccine strains available at the time of isolation, were calculated with the aim of confirming that the isolates were unrelated to each other and that they were not derivatives of commercially available vaccines at the time of clinical sample collection. In addition, a phylogenetic tree was constructed using the neighbor-joining method, and the American genotype prototype VR-2332 was included as an outgroup to determine the subtype to which the European isolates belonged. To assess the statistical reliability of the phylogenetic diagram, bootstrap values ​​(random number seed: 123; 1,000 replicates) were calculated. All phylogenetic analyses were performed using MEGA5.0 software.

[0057] PRRSV-1 was grown by incubation in growth medium supplemented with 2% fetal bovine serum (FBS; catalog numbers 12003C and 12007C from Sigma and catalog number 04-4000DJ from Gibco) and 50 μg of gentamicin / mL (catalog number 15750, Life Technologies). I (Catalog No. 31985, Life Technologies Corporation) in MARC-145 cells were passaged 10 times (to P70) and further attenuated by additional passages in the same growth medium supplemented with 2% FBS without gentamicin for more than 15 times (to P85). The identity of the 85th passage (P85) PRRSV-1 was confirmed by indirect immunofluorescence assay (IFA) using a PRRSV-specific monoclonal antibody, and the P85 PRRSV-1 was considered to be the former master seed virus (Pre-MSV).

[0058] The following procedure was used to determine the titer of PRRSV-1. MARC-145 cells were cultured in 100 μL of growth medium (supplemented with 5% FBS and 50 μg / mL gentamicin). I culture medium) 0.75 to 1.5 x 10 4 Inoculate the cells into a 96-well plate at a density of 100 μL of cells. Incubate the cells in a 37 ± 2 °C and 5 ± 1% CO2 incubator for 48-72 hours until the cells are more than 95% confluent. On the day of titration, remove all the medium from the 96-well plate and replace with 100 μL of fresh growth medium.

[0059] Use diluent ( I medium, 50μg / mL gentamicin) were prepared with ten-fold serial dilutions of PRRSV-1 and transferred to the corresponding wells on the plate prepared as above together with a negative control consisting of a separate diluent and a positive control with a known titer. The titer plate was incubated in a 37±2°C and 5±1% CO2 incubator for 4 days. At the end of the incubation period, each sample well of each plate was observed using an inverted microscope for the presence of virus-induced cytopathic effect (CPE). The 50% tissue culture infectious dose (TCID) was calculated using the Reed-Muench method. 50 ), and record the titer as log 10 TCID 50 / mL. The titer range of P85 PRRSV-1 is 8.1-8.5log 10 TCID 50 / mL.

[0060] Example 3

[0061] The aim of this study was to determine the sequence of Pre-MSV. To determine the genomic sequence of each viral isolate, virus grown in MARC-145 cells was concentrated and purified by ultracentrifugation on a sucrose cushion, and RNA was extracted using the MINELUTE Virus Spin Kit (Qiagen) or TRIZOLLS (Invitrogen). The whole genome sequence was determined by multiple runs of next generation sequencing (NGS) using the NEXTSEQ500 system at Bioreliance (Rockville, MD) and ACGT (Wheeling, IL). Variable and uncertain sequences and gaps were fixed and confirmed by Sanger dideoxy sequencing, and a consensus whole genome sequence was generated. The nucleotide sequences were aligned and compared with selected known PRRSV-1 and commercial vaccine viruses using the neighbor-joining tree nucleotide alignment tool using Geneious 10.1.3. software. Figure 1 ).

[0062] The PRRSV-1 MLV strain designated Pre-MSV is deposited under conditions that will ensure that access to the culture during the pendency of this patent application is limited to those who have access to the culture as determined by the Commissioner of Patents and Trademarks pursuant to 37 CFR § 1.14 and 35 U.S.C. § 122. The deposit will be available as required by the patent laws of the countries in which the subject application has been filed, or its descendants. However, it should be understood that the availability of the deposit does not constitute a license to practice the subject invention in derogation of patent rights granted by governmental action. The subject culture deposit will be stored and made available to the public in accordance with the provisions of the Budapest Treaty for the Deposit of Microorganisms, i.e., the deposit will be maintained with the necessary care to keep it viable and free from contamination for at least five years after the last request for samples of the deposit, and in any case for at least 30 (thirty) years after the date of deposit, or for the enforcement period of any patent that may issue disclosing the deposited culture. The depositor acknowledges that if, due to the conditions of the deposit, the depositor is unable to provide a sample when requested, the depositor is obliged to replace the deposit. Upon the grant of a patent disclosing the subject culture deposit, all restrictions on public access to the subject culture deposit will be irrevocably lifted. On March 7, 2019, under the terms of the Budapest Treaty, the deposit of PRRSV-1 Pre-MSV was admitted into the permanent depository of the American Type Culture Laboratory Patent Collection at 10801 University Avenue, Manassas, Virginia, USA (20110-2209) through the Repository, where the strains were assigned the deposit numbers PTA-125490 (DE 14-3073); PTA-125489 (ES13-49); PTA-125488 (IT 14-32); PTA-125487 (PL 14-02).

[0063] The safety and efficacy of modified live porcine reproductive and respiratory syndrome virus immunogenic compositions and vaccines can be determined by methods well known in the art, including dose response, onset of immunity, duration of immunity, and shedding and transmission of porcine reproductive and respiratory syndrome virus. The lack of reversion to virulence of any Pre-MSV can also be easily determined.

[0064] The cDNA consensus sequence of the four PRRS virus isolates of passage 85 (P85) was deposited in the GenBank genetic sequence database, an annotated collection of all publicly available nucleic acid sequences. The GenBank database is maintained by the National Center for Biotechnology Information (NCBI) of the National Institutes of Health (NIH). GenBank is part of the International Nucleotide Sequence Database Collaboration.

[0065] The cDNA consensus sequence of the PRRS strain DE14-3073 of P85 has been designated as GenBank accession number MK024324 (SEQ.ID.NO:1). The cDNA consensus sequence designated as SEQ.ID.NO:1 is:

[0066] atgatgtgta gggtattttc cctacgtgcg caacactttt tgtgtttgtg tgcctcggag60gcgtgggtat agccccgccc cacctcttgg ccctgttcta gcccaacagg tatccttctc120tctcggggcg agtgcgccgc ctgctgcttc cttgcagcgg gaaggacctc ccgagtactt 180

[0067] ccggagagcg cctgctttac gggatctcca ccctttaacc atgtctggga cgttctcccg240gtgcatgtgc accccggcgg ctcgggtgtt ttggaacgcc ggccaagtct tttgcacacg300gtgtctcagt gcacggtctc ttctctctcc agagcttcaggacctcagttttggtgcact 360

[0068] cggcttgttt tacaagccta aagataagct tcattggaaa gttcctgttg gtatacctca420ggtagagtgc actccatccg ggtgctgttg gctttcagct attttccctc tggcacgtat480gacctccggc aaccacaact ttctccagag acttgtgaag gttgctgacg tttgtaccg540tgatggttgc ttggcgcccc gacatcttcg tgaacttcaa gtttacgagc gcggctgcag600ttggtacccg attacgggac ccgtgcccgg gatgggtctg tttgcgaatt ccatgcacgt660atccgaccag cctttccctg gtgccaccca tgtgctgact aactcgcctc tgcctcaaca720ggcttgtcgg cagcctttt gcccatttga ggaggctcat tctggtttgt tcaagtggaa780taaattcgtg atttttatag acccccccct taacggtaga cgccgcatga tgtgggcacc840tgaatccgac gattcagcca acttggaggt gttgccgcct gaattagaac gtcaagttga900gattctcact cggagtttcc ctgctcacca ccctgtcaac ctcagcgact gggagctttc 960

[0069] cgactcccct gaacacggtt tttccttcag cacttatcat tcttctggtt acgttgccaa1020aaaccctgac gtgtttgata gcaagtgctg gctttcctgt tttctgagct tgtcgcctga1080ggtgtggcat cgtgaggagc tcttggctag cgcattgctag tatcaggt agtggggcgt1140gcatggcaaa tacctccaac gcaggcttca aattaatggc atccgtgctg tggttgatcc1200agacggcccc attcacgttg aagcgctgtc ttgcccccag tcttggatca ggcatttgac1260tctggacgat gaagttaacccccgtcgtcgcg tctcttcgca tcgtaccgaa 1320

[0070] cacagaacct accaccttc gcgtctttcg ttttggggcg cataagtggt atggtgccgc1380

[0071] cggtaaacga gctcgcgcaa agcgtgctgc caagagcgag aaggactcgg ttactgcatc1440

[0072] caaggctgtc caaccaactc ttgcctgtaa aaacaccacc tattccccac caacggacgg1500gtcttgtggt tggcatgttc tcgccgccat aatgaaccgg atgttaaatg gtgacttcac1560gtccccttta accccgtaca acagaccaga agatgattgg gcatcggatt atgatcttgc1620tcaggcgatt caatgtctac aattacctgc taccatagtc cggaatcgcg cctgtcctaa1680tgctaaatac ctcataaaac tcaacggagt tcactgggag gtagaggcaa ggtctgggtt1740tgcccctcgc tcccttcccc gcgagtgtgt ggtcggtgtt tgctccgaag gctgtgtcgc1800aacaccctac ccagagaatg ggctgcctaa gcgggcactt gaggccttag cgtctgctta 1860

[0073] cagattgcct tccgattgcg tcagttctgg cattgctgac tttcttgctg acccccctcg1920ggagttttgg actcttgaca aaatgctgac ttccccatca ccggagcaat ccggcttttc1980tagtctgtac agattgctat tagaggttgt cccgcaaaaa tgcggtgcca cggagggggc2040tttcatctat gccgttgaaa ggatgttgaa ggattgtcca agttccaagc aggccatggc 2100

[0074]

[0075]

[0076]

[0077]

[0078] The cDNA consensus sequence of the PRRS strain ES13-49 of P85 has been designated as GenBank accession number MK024325 (SEQ.ID.NO:2). The cDNA consensus sequence designated as SEQ.ID.NO:2 is:

[0079]

[0080]

[0081]

[0082]

[0083]

[0084] The cDNA consensus sequence of the PRRS strain IT 14-32 of P85 has been designated as GenBank accession number MK024326 (SEQ.ID.NO:3). The cDNA consensus sequence designated as SEQ.ID.NO:3 is:

[0085]

[0086]

[0087]

[0088] tatgagtgac ggcagagatt acaccgacta caactggact tgtgttcgag aacgcccgca11460cgctatctac gggcgcgctc gtgaccacac gtatcatttc gcccctggca cagaattgca11520ggtagaactg ggcaaacccc ggctgccgct tgagtgagta ctgcggctcg aaagccatgc11580aatggggtca ctgtggagta agatcactca gctgtttgtg gatgccttca ctgaattcct11640tgttagtgtg gttgacattg ttatcttcct tgccatacta ttcgggttca cagtcgcagg11700atggttactg gtctttctac tcagagtggt ttgctccgcg attctccgtt cgcgcactgc11760cattcactct cccgaattat cgaaggtcct atgaaggcct gctgcccaat tgcagaccgg11820atgttccaca attcgcaatc aagcatccat tgggcatcct ttggcacatg cgagtttccc11880atctaattga tgaaatggtc tctcgtcgtg tctaccaaac catggaacat tcaggccaag11940cggcctggaa gcaggcagtt gctgaagcca cacttacaaa gctatcgcag cttgacatgg12000tcacccactt ccagcatctt gccgcagtgg aagcggattc ttgtcgcttc ctcagttcgc12060gactcgtgat gctaaaaaac cttgctgtcg gcaatgtaag tctgctgtac aataccacat12120tggaccgtgt tgaactcatt ttccccacgc caggtgcgag gcccaaattg accgatttca12180gacaatggct catcagtgtt catgcttcta ttttctcttc tgtagcttcg tcagtcactt12240tgtttgtagtgctttggctt cgaattccag tgctacgcta tgtttttggt ttccattggc12300ccacggcaac acgtcgttcg aactgaccat caattacacc gtatgcaagc cttgcattac12360tagacaagct gctgcccaac gactcgagcc tggtcgtaac atgtggtgca aaattgggta12420cgatcactgt gaagagcgtg atcacgatga gttgtcaatg gccatcccgt ccgggtacga12480caacactaaa cttgaaggct attatgcttg gcttgccttc ttgtcttttt cttatgcggc12540ccagtttcat ccagagctgt ttggaatagg gaatgtgtca cacgttttcg tggacaagca12600gcatcaattc atctgtgccg agcatgatgg gcaaaattca accataccca acccacacaa12660catctctgca ttgtatgcgg tgtattatca ccaccaagtg gacgggggca actggttcca12720tctagaatgg ctgcggccat tcttctcctc ctggttggtg ctcaatattt catggtttct12780gaggcgttcg cctgcaagcc ctgtttctcg acgcatctat cagatattaa aaccaacaca12840accgcggctg ccggtttcat ggtccttcaa gacattagct gttcccaacc ccatgagaga12900tcgggcacgc ggtcgtccgt tcgcgggaag ccatcccaat gtcgtacagc catcggcacc12960cccctgtaca tcacgctaac ggcgaatgtg actgatgaat cttatttgta caatgctgat13020ttattgatgc tttctgcttg cctgttttac gcctcggaaa tgagtgagaa gggcttcaaa13080gtcatttttg gaaacgtctctggtgttgtt tccgcgtgcg tcaatttcac agactatgtt13140acccatgtga ctcagcatac ccaacagcat catctggtag tcaacdata ccggttgctg13200cactttatga caccgtcaac gatgaggtgg gccacaacca tcgcttgttt gctcgccatt13260ttattggcga tatgagatgt tttcccagat tggggcgttt tttgactcct cactcttact13320tctggtggct ttctttgttg tgtaccggtt tatcctggtc ctttgccgat ggcgacggca13380acagcccgac ataccaatac atatataact tgacgatatg tgagctgaat gggaccacct13440ggctgtccaa caatttttac tgggcagtcg aaacttttgt gctttacccg gtggtgaccc13500acatcgtctc actgggtttc ctcacaacta gccatttctt tgacgcgctc ggcctcggag13560ctgtgtccgc tgtgggattt gctggcgggc ggtatgtcct cagcagcata tacggcgttt13620gtgcattcgc agcgctcgtg tgtttcatca tccgtgttgt taaaaattgc atggcgtgcc13680gctatgcccg tactcggttc accaacttca ttgttgacga ccgaggaaga attcacagat13740ggaagtcccc aatagtggtg gaaaaaatgg gtaaggccga agttggcagc agtctcgtca13800ccatcaagca tgttgttctc gaaggggtta aagctcaacc cttgacgagg actccggctg13860agcaatggga agcctagatg acttttgcta tgattccgcc gctacacaaa agcttctact13920agctttcagt atcacataca cacctgttatgatatacgcc cttaaggtat cacgcggccg13980acttttgggg cttttgcaca tcttgatttt cctgaattgt tccttcacat tcggatacat14040gacccatgag cgtttccatt ccaccaatcg tgtggcgctt actatgggag ctgttgtcgc14100tctcctgtgg ggcatctata gcctcacaga atcatggaag tttattactt ccaggtgcag14160attgtgttgc ctaggccggc aatacatcct ggcccctgcc caccacgtag aaagtgccgc14220aggactccat tcaatcccgg cgtctggcaa ccgagcatac gccgtgagaa agcccggatt14280aacatcagtg aacggcactt tagtaccagg gcttcggagc ctcgtgttgg gcggcaagcg14340agctgttaaa cgaggagtgg ttaacctcgt caaatatggc cggtaaaaac cagagccaga14400agaagaagaa aaatacagct ccaatgggga atggccagtc agtcaatcaa ctgtgtcagt14460tgctgggcac gatgatgaga tcccagcgcc agcgatccaa ggggggacag gccaaaaaga14520aaaagcttga gaagccgcat ttccccctgg ccgctgaaga tgatgtccgg caccacctca14580cccaaaccga acgttccctt tgtctgcaat cgatccagac agcctttaat caaggtgcgg14640gaactgcgtc gctttcatcc agtgggaagg tcggttttca ggttgagttt atgctgccgg14700ttcctcatac ggtgcgcctg attcgcgtga cttccacatc cgccagtcag ggtgcaaatt14760aatttgatag tcaggtgaat ggccacgatt ggcgtgtggcctctgagtca cctattcaat14820tagggcgatc acatgggggc tagacttaat caggcgagaa ccatgtgacc gaaatt 14876

[0089] The cDNA consensus sequence of the PRRS strain PL 14-02 of P85 has been designated as GenBank accession number MK024327 (SEQ.ID.NO:4). The cDNA consensus sequence designated as SEQ.ID.NO:4 is:

[0090] atgatgtgta ggggagatac cctacacaca caacactcct agtgtttgtg taccttggag60gcgagggtac agccccgccc cactccttgg cccctgtttc agcccaacag ggacccttct120ccctcggggc gagtgtgccg cctgctgctc tctcgcagcg ggaaggacct cccgagtatt180tccggagagc acctgcttca cgggatctcc accctttaac catgtctggg atgttctccc240ggtgcatgtg caccccggct gcccgggtat tttggaacgc cggccaagtc ttttgcacac 300

[0091]

[0092]

[0093]

[0094] gcaatggctt atcagcgtgc atgcttccat tttctcctct gtggcttcat cggttacctt12420gttcatggtg ctttggcttc gggttccaac tctacgctat gtttttggtt tccattggcc 12480

[0095] cacggcaaca cgtcattcga gctgaccatc aactacacca tatgtatgcc ctgtcccacc12540agccaagcgg ctcaacaaag gctcgaaccc ggtcgtaata tgtggtgcaa gattggatac12600tctacgtgcg aggagcatga tcacgatgaa ctgtcgatgg ctataccacc tgggtatgac12660aatctcaaac ttgaaggcta ttatgcatgg ttggctttct tgtccttttc ttacgcggct 12720

[0096] caattccatc cggagttatt cggaataggg aatgtgtcgc gcgttttcgt ggacaagcag12780

[0097] catcagttca tttgcgccga gcatgatgga cccaattcaa ccgtaaccac tggacataac12840atttccgcat tgtatgcggt gtactaccat caccaagttg acgggggcaa ctggtttcat12900ttagaatggc tgcggccgtt cttctcctcc tggctggtgc tcaatatctc atggtttctg12960aggcgttcgc ctgcaagccc tgtttctcga cgcatctatc agatattaag accaacacga 13020

[0098] ccgcggctgc cggtttcatg gtccttcaga acatcgactg cctctcagca gcgcagagga13080gtgctcccgt cataaagtca tctcaatgcc gtgaagccat tggtacccca cagtacatta 13140

[0099] cgataacagc aaatgtgacc gatgaagcgt atttgtacaa tgcagactta ctgatgcttt13200

[0100] ctgcatgcct tttctatgcc tcagaactga gcgagaaagg ctttaaagtt atctttggga13260atatctccgg tgtcgtctct gcatgcgtca atttcacgga ttatgtgact catgtgactc13320aacacacaca acagcatcat ttggtgatcg atcacgttcg gttgctgcat ttcctgacac 13380

[0101] cgtcagtgat gaggtgggct acaaccatcg cttgcttact tgccatcctt ctggcgatat13440gagatgttct cacaaattgg ggtgtttttc gactctgtat tcctgctcct ggtggctttc13500tttgctgtgt accggcttgt cctggtcctt tgtcgatggc aacggcgaca gctcgacata 13560

[0102] Popular cttagcgctg tatccattgt13740aggatttgct gatgagcggt acgtacttag tggtgtgtac ggtgcttgtg cttttgccgc13800gctcgtgtgt tttgtcatcc gtgctgctaa gaactgtatg gcttgtcgct atgcccgtac 13860

[0103] ccggttcacc aatttcattg tggacgaccg gggggaaatc caccgctgga agtcaccgat13920agtggtggaa aagttgggca aagctgaagt cggtgatgct cttgtcacca tcaagcatgt 13980

[0104] cgtcattgaa ggggttaaag ctcaaccctt gacgagaact tcggccgagc aatggcaaac14040

[0105] ctagatgact tctgcaatga tccactgcc gcgcaaaagc ttgtgctagc cttcagtatt14100acatacacac ctataatgat atatgccctc aaagtgtcac gcggccggct cctggggctg14160ttgcacatcc tgatatttct gaactgttct ttcacgtttg ggtacatgac gtatgtgcat14220tttcaatcca ccaatcgtgt cgcgcttact atggggctg ttgttgccct tttgtggggc14280atctatagtt ttacagaatc atggaggttt gtcacctcca ggtgcagact gtgttgccta14340ggccggcgat acattctggc ccctgcccat caggtggaaa gtgccgcagg tctccattca14400atcccagcgt ctggcaaccg agcatacgct gtgagaaagc ccggactaac atcagtgaac14460ggcactctag taccaggact tcggagcctc gtgctgggcg gcaaacgagc tgttaaacgg14520ggagtggtta acctcgtcaa gtatggccgg taagaaccag agccagaaga aaaagcaaaa14580tacagctcct atgggaatg gccagtcagt caatcaactg tgccagctgc tgggtgtaat14640gatgaaatcc cagcgccaac ggcctagggg aggacaggca aaaaagaaaa agcctgagaa14700gccacatttc cccctggctg ctgaggatga cattcggcac cacctcaccc aaactgaacg14760ttctctctgc ttgcaatcga tccaaacggc tttcaaccaa ggcgcaggaa ttgcgtcgct14820ttcacccagc gggaaggtca gtttcaggt tgagtttatg ttgccggttt ctcatacagt14880gcgcttgattcgcgtgactt ctacacccgt cagtcagggt gctagttaat ttgacagtca14940ggtgaatggc cgcgattgac gtgtggcctc taagtcacct attcaattag ggcgatcaca15000tgggggttac acttaattag gcgagaacca tgtgaccgaa att 15043

[0106] Those skilled in the art will recognize that the length of the polyadenosine tail (if any) of each genomic consensus sequence may vary from the sequences reported above.

[0107]

[0108]

Claims

1. A modified live porcine reproductive and respiratory syndrome (PRRS) virus strain, wherein the common complementary DNA sequence of the PRRS strain is at least 95% identical to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3 and SEQ ID NO:

4.

2. The modified live PRRS virus strain of claim 1, wherein the common complementary DNA sequence of the PRRS strain is at least 98% identical to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, and SEQ ID NO:

4.

3. The modified live PRRS virus strain according to claim 1, wherein the PRRS strain is the DE 14-3073 strain designated as PTA-125490; the IT 14-32 strain designated as PTA-125488 or the PL 14-02 strain designated as PTA-125487.

4. A PRRS strain according to any one of claims 1 to 3, wherein the PRRS virus strain is passaged at least 85 times in tissue culture cells.

5. Use of the modified live porcine reproductive and respiratory syndrome (PRRS) virus strain according to any one of claims 1 to 4 in the preparation of a medicament for treating PRRS.

6. An immunogenic composition comprising a modified live PRRS virus strain and a pharmaceutically acceptable excipient, stabilizer, solubilizer or diluent, wherein the modified live PRRS virus strain has a common complementary DNA sequence that is at least 90% identical to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3 and SEQ ID NO:

4.

7. An immunogenic composition comprising a modified live PRRS virus strain and a pharmaceutically acceptable excipient, stabilizer, solubilizer or diluent, wherein the modified live PRRS virus strain has a common complementary DNA sequence that is at least 95% identical to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3 and SEQ ID NO:

4.

8. An immunogenic composition comprising a modified live PRRS virus strain and a pharmaceutically acceptable excipient, stabilizer, solubilizer or diluent, wherein the modified live PRRS virus strain has a common complementary DNA sequence that is at least 98% identical to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3 and SEQ ID NO:

4.

9. The immunogenic composition according to any one of claims 6 to 8, wherein the modified live PRRS virus strain is the DE 14-3073 strain designated as PTA-125490; the IT 14-32 strain designated as PTA-125488 or the PL 14-02 strain designated as PTA-125487.

10. The immunogenic composition according to any one of claims 6 to 9, further comprising an adjuvant.

11. A vaccine comprising a modified live PRRS virus strain, wherein the PRRS virus strain is DE 14-3073 strain designated as PTA-125490; IT 14-32 strain designated as PTA-125488 or PL 14-02 strain designated as PTA-125487.

12. A vaccine comprising the modified live PRRS virus strain of any one of claims 1 to 6 for use in treating or preventing symptoms of porcine reproductive and respiratory syndrome in porcine animals.

13. Use of an immunogenic composition in the preparation of a medicament for treating or preventing symptoms of porcine reproductive and respiratory syndrome (PRRS) in porcine animals, the immunogenic composition comprising a modified live PRRS virus strain having a common complementary DNA sequence that is at least 98% identical to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3 and SEQ ID NO:

4.

14. The use according to claim 13, wherein the symptoms of PRRS are caused by PRRS virus infection of porcine animals.

15. Use of a modified live PRRS virus strain in the preparation of a vaccine for treating or preventing symptoms of porcine reproductive and respiratory syndrome (PRRS) in porcine animals, wherein the PRRS virus strain is the DE 14-3073 strain designated as PTA-125490; the IT 14-32 strain designated as PTA-125488 or the PL 14-02 strain designated as PTA-125487.

16. The use according to claim 15, wherein the symptoms of PRRS are caused by PRRS virus infection of porcine animals.

Images