Lysine cyclization deaminase, mutant, recombinant genetically engineered bacterium and application of lysine cyclization deaminase

Abstract

The invention discloses lysine cyclization deaminase, a mutant, a recombinant genetically engineered bacterium and application of the lysine cyclization deaminase. The amino acid sequence of the lysine cyclization deaminase is as shown in SEQ ID NO. 1. The lysine cyclization deaminase mutants comprise mutants I61V, I94V, I233V and A235S which are obtained by mutating the 61th site, the 94th site, the 233th site and the 235th site respectively, mutants I233V / A235S which are obtained by performing iteration saturation mutation on the 233th site and the 235th site, and mutants I94V / I233V / A235S and I61V / I94V / I233V / A235S which are obtained by performing hot spot combination mutation on the lysine cyclization deaminase mutants. The lysine cyclization deaminase and the mutant thereof obtained according to the invention have high enantiomer selectivity and activity, and can catalyze L-lysine to generate optically pure L-piperidinecarboxylic acid.

Description

Technical Field

[0001] The present invention relates to the field of enzyme engineering, and in particular to a lysine cyclodeaminase, a mutant, a coding gene, a recombinant plasmid containing the coding gene and a recombinant genetic engineering bacterium, and their application in catalyzing L-lysine to synthesize L-piperidinic acid. Background Art

[0002] L-Piperidinic acid (L-PA) is a key chiral intermediate in the synthesis of many important drugs. High optical purity L-PA is widely used as a precursor of the local anesthetic ropivacaine, the immunosuppressant rapamycin, FK-506 and FK-520. The biological activity of the above drugs depends on the stereochemical structure of the piperidine part, so it is particularly important to synthesize high-purity L-piperidinic acid. In addition, L-piperidinic acid can also derive compounds with important application value in industry.

[0003] The synthesis methods of L-piperidinic acid can be roughly divided into the following three methods. The chemical method requires amino protection and deprotection operations, and the yield is only 45%. The photocatalytic method has strict requirements on catalytic conditions and reactors, and the reaction process is difficult to control. The multi-enzyme cascade process is complex and the reaction system is uncertain. In contrast, the enzyme catalytic process has many advantages at the same time, such as low catalyst loading, high specificity, high enantiomeric selectivity, and the ability to reduce or eliminate reaction by-products, which is more suitable for the production of L-PA. In 2015, Tani et al. used purified rAIP / DpkA enzyme to catalyze the racemization production of 45.1g L -1 Picolinic acid. In 2018, Cheng et al. used the same enzyme and applied a fed-batch fermentation system of a recombinant somatic decarboxylase (CADA) gene knockout strain containing lysine permease (LysP) and glucose dehydrogenase (GDH), and reported picolinic acid with a titer of 46.7 g / L from L-lysine hydrochloride solution. In 2015, Ying et al. used Escherichia coli with lysine cyclodeaminase as a whole-cell biocatalyst to produce 17.25 g L -1 L-PA was shown to have sustained enzymatic activity and to self-regenerate NAD via cyclization. +, providing a better choice for the two-step enzymatic method of rAIP and DpkA. In 2018, Ying et al. manipulated the enzyme structure related to the substrate and product transport channels through saturation mutagenesis to overcome substrate inhibition, and produced 73.4 g / L L-PA through a whole-cell reaction. In 2020, Han et al. selected LCD and used an enhanced whole-cell system by introducing multiple copies of pipA to improve the overall conversion rate without any complex manipulation of the LCD itself. After optimizing the enhanced whole-cell reaction, a conversion rate of 72.4% was obtained under 1000 mM L-lysine loading conditions for 5 days. In 2024, Gao et al. used a new type of ornithine cyclodeaminase to catalyze the synthesis of L-PA. Through a multi-region synergistic strategy consisting of pocket remodeling, dynamic cross-correlation matrix-guided co-evolution design and surface modification, a quadruple mutant was obtained that can catalyze 1000 mM L-lysine with a 10-hour conversion rate of 91%, 282.1 g L -1 d -1 The space-time yield is the highest reported so far.

[0004] Lysine cyclodeaminase can catalyze the synthesis of L-PA from L-lysine, and has the following advantages: 1. The substrate L-lysine is cheap, readily available and renewable. 2. High-purity L-PA can be synthesized in one step, and the reaction system is simple and easy to control. 3. Lysine cyclodeaminase can achieve coenzyme self-circulation, and only a small amount of coenzyme needs to be added to start the reaction.

[0005] So far, the enzyme-catalyzed synthesis of L-PA still faces problems such as insufficient activity and long reaction time, which limits its industrial application. There is only one lysine cyclodeaminase used to study the synthesis of L-PA, which has low catalytic activity and low substrate conversion rate in the asymmetric catalysis of L-lysine. Therefore, it is urgent to find a new lysine cyclodeaminase with high substrate tolerance and catalytic efficiency. Summary of the invention

[0006] The purpose of the present invention is to provide a novel lysine cyclodeaminase capable of synthesizing L-PA, a mutant, a coding gene, a recombinant plasmid, a recombinant genetic engineering bacterium and the use thereof in catalyzing the synthesis of L-PA from L-lysine, thereby solving the problems of insufficient enzyme activity and long reaction time in the current enzyme-catalyzed synthesis of L-PA.

[0007] In order to solve the above problems, the present invention adopts the following technical solutions:

[0008] According to a first aspect of the present invention, a lysine cyclodeaminase is provided, wherein the amino acid sequence of the lysine cyclodeaminase is shown as SEQ ID No.1.

[0009] The wild-type lysine cyclodeaminase is a lysine cyclodeaminase from Streptomyces sp. NRRL B-1568 strain, and its NCBI accession number is KJY42626.1. It should be understood that, although the gene sequence of the wild-type lysine cyclodeaminase has been published on NCBI before, its annotated function is lysinedecarboxylase, which is a dehydrogenase, and the inventors first discovered that it can catalyze the synthesis of pipecolic acid, and the present invention specifically named it lysine cyclodeaminase. In fact, the present invention discloses such a lysine cyclodeaminase for the first time.

[0010] According to a second aspect of the present invention, a lysine cyclodeaminase mutant is provided, comprising a lysine cyclodeaminase mutant formed by the following mutations using a wild-type lysine cyclodeaminase having an amino acid sequence as shown in SEQ ID NO.1 as a template, including: a mutant I61V obtained by mutation of isoleucine at position 61, with an amino acid sequence as shown in SEQ ID NO.2; a mutant I94V obtained by mutation of isoleucine at position 94, with an amino acid sequence as shown in SEQ ID NO.3; a mutant I233V obtained by mutation of isoleucine at position 233, with an amino acid sequence as shown in SEQ ID NO.4; a mutant A235S obtained by mutation of alanine at position 235, with an amino acid sequence as shown in SEQ ID NO.5; a mutant I233V / A235S obtained by iterative saturation mutation of isoleucine at position 233 and alanine at position 235, with an amino acid sequence as shown in SEQ ID NO.6; and I94V / I233V / A235S obtained by combining the above-obtained double-point mutation with position 94, with an amino acid sequence as shown in SEQ ID NO. NO.7; the mutant I61V / I94V / I233V / A235S obtained by combined mutation of the above four amino acid sites has an amino acid sequence as shown in SEQ ID NO.8.

[0011] According to the third aspect of the present invention, there is provided a gene encoding the wild-type lysine cyclodeaminase as described above or the lysine cyclodeaminase mutant as described above.

[0012] According to a fourth aspect of the present invention, there is provided a recombinant expression vector comprising a gene encoding the lysine cyclodeaminase mutant as described above.

[0013] According to a fifth aspect of the present invention, a recombinant expression transformant comprising a gene encoding a lysine cyclodeaminase mutant as described above is provided. The recombinant expression transformant can be prepared by transforming the constructed recombinant expression vector into a host cell. The host cell is any conventional host cell in the art, as long as the recombinant expression vector can stably replicate itself and can effectively express the target protein after being induced by an inducer. The present invention preferably uses Escherichia coli as a host cell, preferably Escherichia coli BL21 (DE3) for efficiently expressing the lysine cyclodeaminase mutant described in the present invention.

[0014] According to a sixth aspect of the present invention, a lysine cyclodeaminase mutant catalyst is provided, wherein the recombinant lysine cyclodeaminase mutant catalyst is in any one of the following forms: 1) culturing the recombinant expression transformant as described above, and isolating transformant cells containing the lysine cyclodeaminase mutant; 2) culturing the recombinant expression transformant as described above, and isolating a crude enzyme solution containing the lysine cyclodeaminase mutant; 3) culturing the recombinant expression transformant as described above, isolating a crude enzyme solution containing the lysine cyclodeaminase mutant, and drying the prepared crude enzyme powder or purifying the prepared pure enzyme; 4) culturing the recombinant expression transformant as described above, isolating transformant cells containing the lysine cyclodeaminase mutant, and then freeze-drying the obtained freeze-dried bacterial powder.

[0015] According to a seventh aspect of the present invention, there is provided a use of the aforementioned lysine cyclodeaminase mutant or the aforementioned lysine cyclodeaminase mutant catalyst in catalyzing the production of L-PA from L-lysine.

[0016] The lysine cyclodeaminase mutant or the lysine cyclodeaminase mutant catalyst is used to catalyze the deamination cyclization reaction of L-lysine to obtain L-PA.

[0017] Preferably, the lysine cyclodeaminase mutant catalyzes the deamination cyclization reaction of L-lysine in the presence of coenzyme NAD + in the presence of .

[0018] The lysine cyclodeaminase mutant catalyst can catalyze L-lysine to produce L-PA. In the application, the concentration of the substrate L-lysine is 10 to 1000 mM, and the coenzyme NAD + The amount of lysine cyclodeaminase added is 0.2-0.4 mM, and the amount of lysine cyclodeaminase used is 5-30 g L of freeze-dried bacterial powder. -1 The disodium hydrogen phosphate / sodium dihydrogen phosphate buffer (but not limited to the disodium hydrogen phosphate / sodium dihydrogen phosphate buffer) required in the reaction process is a conventional buffer in the art, and its concentration is 50-200 mM.

[0019] The reaction is carried out at pH 6 to 10, preferably pH 7.5, under shaking or stirring conditions. The reaction temperature is 20 to 50° C., preferably 37° C. The reaction time is based on the time when the substrate is completely converted or the reaction terminates on its own, and the reaction time is preferably less than 24 hours.

[0020] The key inventive point of the present invention is that, by rationally designing the enzyme, a lysine cyclodeaminase mutant with excellent catalytic efficiency at a higher substrate concentration is provided, which solves the problems of incomplete conversion and long reaction time at high substrate concentrations, and lays a foundation for the industrial application of lysine cyclodeaminase to synthesize L-piperidin PA.

[0021] Specifically, the present invention relates to a lysine cyclodeaminase, a mutant and a gene thereof, a recombinant expression vector and a recombinant expression transformant containing the gene, and the use of the recombinant lysine cyclodeaminase or the recombinant expression transformant to catalyze the deamination cyclization reaction of L-lysine to produce L-PA. The biocatalyst can exhibit excellent catalytic performance under high-concentration substrate conditions and shows good application prospects in the synthesis of L-PA.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] The present invention has excavated a novel lysine cyclodeaminase with high enantiomeric selectivity and catalytic activity, which can catalyze the synthesis of L-PA from L-lysine. Through rational design, multiple mutants with significantly improved catalytic efficiency are obtained. The multiple lysine cyclodeaminase mutants provided by the present invention have the advantages of high substrate concentration tolerance, high catalytic efficiency, short reaction time, etc. Among them, the quadruple mutant I61V / I94V / I233V / A235S achieves a 1000mM substrate conversion rate of 99% in 3h, an ee value of >99.9%, and a space-time yield of 1033.28g L -1 d -1 , which is the highest level reported so far.

[0024] At the same time, compared with other preparation methods, the method of lysine cyclodeaminase catalyzing L-lysine to produce L-PA has simple and mild catalytic conditions, is environmentally friendly, and is easy to separate and purify the product. The one-step synthesis has the advantages of high atom economy and high product optical purity, and shows good application prospects in the green industrial catalytic synthesis of L-PA. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The reaction formula for producing L-PA from L-lysine catalyzed by lysine cyclodeaminase is shown. DETAILED DESCRIPTION

[0026] The present invention is further described below in conjunction with specific examples. It should be understood that the following examples are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0027] Materials and methods

[0028] L-lysine and L-PA standards were purchased from Aladdin, USA. All chemical reagents used in the experiment were purchased from McLean (China). Taq DNA polymerase was purchased from Yesen (China). Restriction endonucleases and T4 DNA ligase were purchased from Thermo Fisher Scientific (USA). Expression vector [pET28a(+)] and Escherichia coli BL21 (DE3) were purchased from Novagen, Germany.

[0029] Primer synthesis and sequencing were completed by Beijing Qingke Biotechnology Co., Ltd. (Shanghai).

[0030] Example 1: Strain construction

[0031] The sequence of lysine cyclodeaminase Ssp from Streptomyces sp.NRRL B-1568 was cloned. According to the target sequence, primers with restriction enzyme sites were designed using the Agilent Primer Design Program (https: / / www.agilent.com / store / primerDesignProgram.jsp). The target enzyme gene was obtained using polymerase chain reaction (PCR) using metagenomic DNA as a template, and then digested and ligated into the pET28a(+) vector and transformed into Escherichia coli BL21(DE3) to screen positive clones. After sequencing verification, pET28 a(+)-Ssp was transferred into the expression host E. coli BL21(DE3) for subsequent expression of the recombinant enzyme.

[0032] Example 2: Mutant construction

[0033] Using the recombinant plasmid pET28 a(+)-Ssp as a template, primers were designed for the intended mutation sites, and the upstream and downstream primer sequences are shown in Table 1. PCR system: 10 μL of DNA polymerase P515, 1 μL of forward and reverse primers, 1 μL of template, 7 μL of double distilled water, and a total system of 20 μL. PCR program: First, pre-deformation at 95°C for 5 minutes; then, the following program was cycled 30 times: denaturation at 95°C for 30 seconds, annealing at Tm+5°C for 30 seconds, extension at 72°C for 5.5 minutes; final extension at 72°C for 3 minutes, and maintenance at 4°C.

[0034] Table 1 Primers used for the construction of Ssp mutants (SEQ ID NO.9-16) Primer Name Primer Sequence (5’-3’) I61V-F GCATCCATTCCCAAACACCCGGAACCGGCTC I61V-R GAGCCGGTTCCGGGTGTTTGGGAATGGATGC I94V-F GCAACAGTCCCAATAACGGTCGGCAGACCAAAG I94V-R CTTTGGTCTGCCGACCGTTATTGGGACTGTTGC I233V-F TCCGCATTTACATATTAATGCAGTTGGTGCCGATTTAGTTGG I233V-R CCAACTAAATCGGCACCAACTGCATTAATATGTAAATGCGGA A235S-F GTCCGCATTTACATATTAATGCAATTGGTAGCGATTTAGTTGGTAAAACC A235S-R GGTTTTACCAACTAAATCGCTACCAATTGCATTAATATGTAAATGCGGAC

[0035] A series of mutants of L-lysine cyclodeaminase Ssp were obtained by mutation, including:

[0036] 1) A recombinant protein formed by replacing the isoleucine at position 61 of the amino acid sequence shown in SEQ ID NO.1 with valine, whose amino acid sequence is shown in SEQ ID NO.2 and is named I61V;

[0037] 2) a recombinant protein formed by replacing the isoleucine at position 94 of the amino acid sequence shown in SEQ ID NO.1 with valine, the amino acid sequence of which is shown in SEQ ID NO.3 and is named I94V;

[0038] 3) A recombinant protein formed by replacing the isoleucine at position 233 of the amino acid sequence shown in SEQ ID NO.1 with valine, whose amino acid sequence is shown in SEQ ID NO.4 and is named I233V;

[0039] 4) A recombinant protein formed by replacing position 235 of the amino acid sequence shown in SEQ ID NO.1 with serine has an amino acid sequence shown in SEQ ID NO.5 and is named A235S;

[0040] 5) The recombinant protein formed by iterative saturation mutation of isoleucine at position 233 and alanine at position 235 of the amino acid sequence shown in SEQ ID NO.1 has an amino acid sequence shown in SEQ ID NO.6 and is named I233V / A235S;

[0041] 6) The optimal mutant obtained by iterative saturation mutation of isoleucine at position 233 and alanine at position 235 of the amino acid sequence shown in SEQ ID NO.1 is combined with position 94 to form a recombinant protein, whose amino acid sequence is shown in SEQ ID NO.7 and is named I94V / I233V / A235S;

[0042] 7) The above four amino acid sites of the amino acid sequence shown in SEQ ID NO.1 were combined and mutated to obtain a recombinant protein, whose amino acid sequence is shown in SEQ ID NO.7 and is named I61V / I94V / I233V / A235S.

[0043] Example 3: Strain culture

[0044] The recombinant plasmid was introduced into E. coli strain BL21 (DE3) for gene expression. -1The cells were cultured in Luria-Bertani broth containing kanamycin until the optical density at 600 nm reached 0.6-0.8. Isopropyl-β-d-thiogalactopyranoside was added to a final concentration of 0.1 mM to induce overexpression at 20°C for 20 h. The culture medium was removed by centrifugation at 8000 g for 10 min and the cells were washed with 0.85 g L -1 The wet cells were washed with saline and then centrifuged at 8000 g for 10 min. The cells were collected and stored at −20 °C for further experiments.

[0045] Example 4: Lysine cyclodeaminase Ssp mutant catalyzes the reaction of L-lysine to produce L-PA

[0046] Schematic diagram of the principle of recombinant lysine cyclodeaminase Ssp mutant catalyzing the reaction of L-lysine to produce L-PA Figure 1 shown.

[0047] The reaction was carried out in 100 mM phosphate buffer (pH 7.5) containing a defined concentration of L-lysine, 10 mg mL -1 Whole cell catalyst and 0.4 mM NAD + ; The pH was adjusted to 7.5 with phosphoric acid; The reaction mixture was diluted to 1 mL. The reaction was carried out at 37°C and 220 rpm and then terminated by heating at 95°C for 5 minutes. The supernatant was collected by centrifugation and the conversion rate was detected by high performance liquid chromatography (HPLC). All experiments were performed in triplicate.

[0048] Table 2 Conversion rate and ee value of wild-type lysine cyclodeaminase Ssp and mutants

[0048] The above is only a preferred embodiment of the present invention, and is not intended to limit the scope of the present invention. The above embodiments of the present invention can also be modified in various ways. All simple, equivalent changes and modifications made according to the claims and the contents of the specification of the present invention fall within the scope of protection of the claims of the present invention. The contents not described in detail in the present invention are all conventional technical contents.

Claims

1. A lysine cyclodeaminase, characterized in that The amino acid sequence of the lysine cyclodeaminase is shown in SEQ ID NO.

1.

2. A lysine cyclodeaminase mutant with improved L-piperidinic acid production ability, characterized in that: The invention comprises a lysine cyclodeaminase mutant formed by using the lysine cyclodeaminase of the amino acid sequence shown in SEQ ID NO.1 as a template and undergoing the following mutations: The mutant I61V obtained by mutation of isoleucine at position 61 has an amino acid sequence as shown in SEQ ID NO.2; The mutant I94V obtained by mutation of isoleucine at position 94 has an amino acid sequence as shown in SEQ ID NO.3; The mutant I233V obtained by mutation of isoleucine at position 233 has an amino acid sequence as shown in SEQ ID NO.4; The mutant A235S obtained by alanine mutation at position 235 has an amino acid sequence as shown in SEQ ID NO.5; The mutant I233V / A235S obtained by iterative saturation mutation of isoleucine at position 233 and alanine at position 235 has an amino acid sequence as shown in SEQ ID NO.6; I94V / I233V / A235S obtained by combining the double point mutation with the 94 site, the amino acid sequence is shown in SEQ ID NO.7; The mutant I61V / I94V / I233V / A235S obtained by combined mutation of the above four amino acid sites has an amino acid sequence as shown in SEQ ID NO.

8.

3. A gene encoding the lysine cyclodeaminase according to claim 1 or the lysine cyclodeaminase mutant according to claim 2.

4. A recombinant plasmid comprising the coding gene as claimed in claim 3.

5. A recombinant genetically engineered bacterium containing the recombinant plasmid according to claim 4.

6. The recombinant genetically engineered bacterium according to claim 5, characterized in that: The host cell used was Escherichia coli BL21 (DE3).

7. A method for preparing a lysine cyclodeaminase mutant, characterized in that: The following steps are involved: 1) culturing the recombinant genetically engineered bacteria according to claim 5, and inducing the expression of the lysine cyclodeaminase mutant; 2) isolating the lysine cyclodeaminase mutant according to claim 2 from the culture obtained in 1).

8. Use of the lysine cyclodeaminase according to claim 1 or the lysine cyclodeaminase mutant according to claim 2 in catalyzing the synthesis of L-piperidinic acid from L-lysine.

9. The use according to claim 8, characterized in that: The application The following steps are involved: S1: culturing the recombinant genetically engineered bacteria according to claim 5, inducing expression, and obtaining crude enzyme solution or wet bacteria or freeze-dried bacteria powder; S2: Add phosphate buffer to the crude enzyme solution, wet bacteria or freeze-dried bacterial powder, and add L-lysine, NAD + After all the components are added into the mother liquor and mixed thoroughly, the mixture is placed in a shaker at 37°C for reaction, thereby realizing the efficient synthesis of L-piperidinic acid.

Images