Engineered yeast, establishment method thereof and application of engineered yeast in synthesis of bisabolol

Abstract

The invention provides a yeast engineering bacterium, an establishment method thereof and application of the yeast engineering bacterium in synthesis of bisabolol. A series of exogenous genes are introduced into the yeast engineering strain through a gene recombination technology, so that the bisabolol production of the yeast engineering strain is effectively improved. The engineering bacterium for producing the bisabolol, which is obtained by the invention, provides a new way for industrial production of the bisabolol.

Description

Technical Field

[0001] The present invention belongs to the field of bioengineering technology, and more specifically, the present invention relates to a yeast engineering bacterium, a method for establishing the yeast and an application of the yeast in the synthesis of bisabolol. Background Art

[0002] (-)-α-bisabolol 15 H 26 (-)-α-Bisabolol is a monocyclic unsaturated sesquiterpene alcohol, which is an important component of German chamomile volatile oil, with a content of up to 17%. (-)-α-Bisabolol is a viscous liquid with a colorless or light yellow appearance and a slight aromatic smell. It is soluble in organic solvents such as lower alcohols, as well as in fatty alcohols, glycerides and vinegar, but insoluble in water and glycerin. Due to its good stability and skin compatibility, (-)-α-Bisabolol is often added to cosmetics as an active ingredient for protecting and caring for allergic skin. The U.S. Food and Drug Administration (FDA) has granted it the Generally Recognized Safety (GRAS) status, which has promoted its use as an active ingredient in various commercial products.

[0003] Currently, (-)-α-bisabolol on the market is mainly prepared from essential oil extracted from Brazilian Kantiana wood by steam distillation. However, this production method has raised sustainability issues for native Brazilian plants and environmental issues. Although (-)-α-bisabolol can be chemically synthesized, the synthesized bisabolol often contains other isomers, such as (+)-α-bisabolol, (±)-epi-α-bisabolol and other by-products. Therefore, the cost of producing high optical purity (-)-α-bisabolol by chemical synthesis is relatively high. It is of great significance to develop a new economical and efficient method for producing (-)-α-bisabolol.

[0004] In recent studies, more and more research focuses on the microbial synthesis of (-)-α-bisabolol. Han et al. introduced the heterologous MVA pathway and the bisabolol synthase (MrBBS) from Matricaria recutita into Escherichia coli, achieving efficient synthesis of (-)-α-bisabolol with a yield of up to 9.1 g / L (Microb. Cell Fact., 2016, 15, 185). These studies provide valuable experience and strategies for the microbial synthesis of (-)-α-bisabolol, demonstrate the feasibility of improving the biosynthesis efficiency of target compounds through host microbial engineering, and lay the foundation for future biosynthesis research and industrial applications.

[0005] However, prokaryotic expression carries the risk of phage infection, and a more stable biosynthesis process needs to be achieved. However, the yield of (-)-α-bisabolol produced in fungal chassis is still significantly lower than that of Escherichia coli.

[0006] In summary, there is an urgent need in the art to develop eukaryotic engineered strains that can efficiently produce (-)-α-bisabolol. Summary of the invention

[0007] The purpose of the present invention is to provide a yeast engineering bacterium, an establishment method thereof and an application thereof in the synthesis of bisabolol.

[0008] In a first aspect of the present invention, a method for producing bisabolol is provided, comprising: a. providing a yeast engineered bacterium, introducing a pro-synthesis module into the yeast engineered bacterium, wherein the module comprises genes encoding the following group of proteins: (1) bisabolol synthase; (2) MVA pathway enzyme; (3) a protein selected from group a of pro-synthesis proteins, wherein the group of proteins comprises NADH kinase; b. fermenting the yeast engineered bacterium prepared in step a to produce bisabolol.

[0009] In one or more embodiments, the module further comprises genes encoding the following group of proteins: (4) proteins selected from group b of anabolic proteins, which include transcription factors or molecular chaperones.

[0010] In one or more embodiments, the NADH kinase comprises: POS5.

[0011] In one or more embodiments, the transcription factor or molecular chaperone includes one selected from: ERO1, PDI1, YAP1, ERO1, MXR1, HAC1; preferably includes one selected from: ScERO1, ScPDI1, KpYAP1, ScERO1, ScMXR1, ScHAC1; more preferably includes one selected from: ERO1, PDI1, YAP1; more preferably includes one selected from: ScERO1, ScPDI1, KpYAP1.

[0012] In one or more embodiments, the bisabolol synthase comprises BBS (bisabolol synthase); preferably comprises CcBBS derived from artichoke (Cynara cardunculus var. scolymus).

[0013] In one or more embodiments, the MVA pathway enzymes include: ERG20, tHMG1, and IDI.

[0014] In one or more embodiments, the tHMG1 is expressed in fusion with IDI; preferably, the two are fused via a self-cleaving peptide T2A linker to form tHMG1-T2A-IDI.

[0015] In one or more embodiments, the ERG20 is expressed in fusion with BBS; preferably, the two are expressed via a polypeptide (GS) 4 Linker fusion to form ERG20-(GS) 4 -BBS.

[0016] In one or more embodiments, in the engineered yeast, the BBS is expressed in two or three copies; the ERG20 is expressed in two copies; and the tHMG1, IDI, POS5, ERO1 or PDI1 is expressed in a single copy.

[0017] In one or more embodiments, in the yeast engineered bacteria, the coding genes of tHMG1 and IDI are introduced into the Int21 site; the coding genes of ERG20 and BBS are introduced into the Int12 and / or Int6 sites, preferably the Int12 and Int6 sites; the coding genes of the transcription factors or molecular chaperones are introduced into the Int18 site; or the coding gene of the NADH kinase is introduced into the Int10 site; more preferably, the protein coding gene introduced (integrated into) the genome is driven by a methanol-induced promoter P AOX1 As a promoter.

[0018] In one or more embodiments, the introduction is exogenous introduction or heterologous introduction.

[0019] In one or more embodiments, the protein comprises a heterologous protein relative to the engineered yeast.

[0020] In one or more embodiments, the engineered yeast bacteria are cultured using a yeast culture medium, and preferably a carbon source is added during the culture period; preferably, the carbon source is glycerol and / or methanol.

[0021] In one or more embodiments, the bisabolol is (-)-α-bisabolol.

[0022] In one or more embodiments, no other functional proteins are exogenously introduced into the engineered yeast.

[0023] In one or more embodiments, step b includes the following fermentation process steps: (1) inoculating the yeast engineered bacteria into a seed liquid culture medium for culturing to prepare a seed liquid; (2) inoculating the seed liquid of (1) into a fermentation medium for fermentation culturing to obtain a fermentation liquid containing bisabolol; (3) separating and obtaining bisabolol from the fermentation liquid of (2).

[0024] In one or more embodiments, shake flask culture is used: the yeast engineering bacteria are activated to prepare seed liquid, which is inoculated into a conical flask containing fermentation medium at an inoculation rate of 5-10%, and shaken at 25-30°C. After culturing for 12-24 hours, 10-20% (v / v) dodecane is added, and 1% (v / v) methanol is added intermittently to induce the synthesis of related enzymes; more preferably, the fermentation medium comprises: peptone 10-20 g / L, yeast extract powder 10-20 g / L, pyruvic acid 0-5 g / L, citric acid 0-5 g / L, KH 2 PO 4 10-15 g / L; more preferably, the pH is adjusted to 6.0-6.5.

[0025] In one or more embodiments, fermentation tank culture is used: the yeast engineering bacteria are activated to prepare seed liquid, which is inoculated into a fermentation tank filled with an initial fermentation medium at an inoculation rate of 5-10%, and fermentation culture is started; during the fermentation process, ammonia water is added to control pH stability, and the stirring speed is adjusted to maintain the dissolved oxygen between 20-30%; after the glycerol in the fermentation medium is exhausted, a glycerol solution is added until the expected OD is reached. 600 value; then adding 10-20% (v / v) dodecane, and adding methanol to induce the synthesis of related enzymes to achieve the accumulation of bisabolol; more preferably, the initial fermentation medium comprises: 1-5g / L calcium sulfate dihydrate, 10-20g / L potassium sulfate, 10-20g / L magnesium sulfate heptahydrate, 1-5g / L potassium hydroxide, 20-40g / L glycerol, 0-10g / L pyruvic acid, and 0-10g / L citric acid; more preferably, the fermentation pH is 6.0-6.5, and the fermentation temperature is 25-30°C.

[0026] In another aspect of the present invention, a yeast engineered bacterium is provided, which includes a synthesis-promoting module, wherein the module includes genes encoding the following group of proteins: (1) bisabolol synthase; (2) MVA pathway enzymes; and (3) proteins selected from the group a of synthesis-promoting proteins, which include NADH kinase.

[0027] In one or more embodiments, the module further comprises genes encoding the following group of proteins: (4) proteins selected from group b of anabolic proteins, which include transcription factors or molecular chaperones.

[0028] In one or more embodiments, the NADH kinase comprises: POS5; preferably, POS5 is derived from Pichia pastoris GS115 or Saccharomyces cerevisiae S288C.

[0029] In one or more embodiments, the transcription factor or molecular chaperone includes one selected from: ERO1, PDI1, YAP1, ERO1, MXR1, HAC1; preferably includes one selected from: ScERO1, ScPDI1, KpYAP1, ScERO1, ScMXR1, ScHAC1; more preferably includes one selected from: ERO1, PDI1, YAP1; more preferably includes one selected from: ScERO1, ScPDI1, KpYAP1.

[0030] In one or more embodiments, the bisabolol synthase comprises BBS (bisabolol synthase); preferably comprises CcBBS derived from artichoke (Cynara cardunculus var. scolymus).

[0031] In one or more embodiments, the MVA pathway enzymes include: ERG20, tHMG1, and IDI.

[0032] In one or more embodiments, the tHMG1 is expressed in fusion with IDI; preferably, the two are fused via a self-cleaving peptide T2A linker to form tHMG1-T2A-IDI.

[0033] In one or more embodiments, the ERG20 is expressed in fusion with BBS; preferably, the two are expressed via a polypeptide (GS) 4 Linker fusion to form ERG20-(GS) 4 -BBS.

[0034] In one or more embodiments, in the engineered yeast, the BBS is expressed in two or three copies; the ERG20 is expressed in two copies; and the tHMG1, IDI, POS5, ERO1 or PDI1 is expressed in a single copy.

[0035] In one or more embodiments, in the yeast engineered bacteria, the coding genes of tHMG1 and IDI are introduced into the Int21 site; the coding genes of ERG20 and BBS are introduced into the Int12 and / or Int6 sites, preferably the Int12 and Int6 sites; the coding genes of the transcription factors or molecular chaperones are introduced into the Int18 site; or the coding gene of the NADH kinase is introduced into the Int10 site; more preferably, the coding gene of the protein introduced (integrated into) the genome is driven by a methanol-induced promoter P AOX1 As a promoter.

[0036] In one or more embodiments, the engineered yeast bacteria include Pichia pastoris.

[0037] In one or more embodiments, the engineered yeast bacteria includes Pichia pastoris GS115.

[0038] In one or more embodiments, the POS5 encoding gene has the nucleotide sequence shown in SEQ ID NO:4, or a degenerate sequence thereof, or a nucleotide sequence encoding a protein with the same function that is more than 70% (preferably more than 80%; more preferably more than 90%; more preferably more than 93%; more preferably more than 95%; more preferably more than 97%) identical to the SEQ ID NO:4 sequence.

[0039] In one or more embodiments, the coding gene of the CcBBS has the nucleotide sequence shown in SEQ ID NO:1, or a degenerate sequence thereof, or a nucleotide sequence encoding a protein with the same function that is more than 70% (preferably more than 80%; more preferably more than 90%; more preferably more than 93%; more preferably more than 95%; more preferably more than 97%) identical to the sequence of SEQ ID NO:1.

[0040] In one or more embodiments, the coding gene of tHMG1 has the nucleotide sequence shown at positions 1-1455 of SEQ ID NO:2, or a degenerate sequence thereof, or a nucleotide sequence encoding a protein with the same function that is more than 70% (preferably more than 80%; more preferably more than 90%; more preferably more than 93%; more preferably more than 95%; more preferably more than 97%) identical to the sequence at positions 1-1455 of SEQ ID NO:2.

[0041] In one or more embodiments, the coding gene of T2A has the nucleotide sequence shown at positions 1456-1509 in SEQ ID NO:2, or a degenerate sequence thereof, or a nucleotide sequence encoding a protein with the same function that is more than 70% (preferably more than 80%; more preferably more than 90%; more preferably more than 93%; more preferably more than 95%; more preferably more than 97%) identical to the sequence at positions 1456-1509 in SEQ ID NO:2.

[0042] In one or more embodiments, the IDI encoding gene has the nucleotide sequence shown in positions 1510-2358 of SEQ ID NO:2, or a degenerate sequence thereof, or a nucleotide sequence encoding a protein with the same function that is more than 70% (preferably more than 80%; more preferably more than 90%; more preferably more than 93%; more preferably more than 95%; more preferably more than 97%) identical to the sequence at positions 1510-2358 of SEQ ID NO:2.

[0043] In one or more embodiments, the ERG20 encoding gene has the nucleotide sequence shown in SEQ ID NO:3, or a degenerate sequence thereof, or a nucleotide sequence encoding a protein with the same function that is more than 70% (preferably more than 80%; more preferably more than 90%; more preferably more than 93%; more preferably more than 95%; more preferably more than 97%) identical to the SEQ ID NO:3 sequence.

[0044] In one or more embodiments, the coding gene of ScERO1 has the nucleotide sequence shown in SEQ ID NO:5, or a degenerate sequence thereof, or a nucleotide sequence encoding a protein with the same function that is more than 70% (preferably more than 80%; more preferably more than 90%; more preferably more than 93%; more preferably more than 95%; more preferably more than 97%) identical to the sequence of SEQ ID NO:5.

[0045] In one or more embodiments, the coding gene of ScPDI1 has the nucleotide sequence shown in SEQ ID NO:6, or a degenerate sequence thereof, or a nucleotide sequence encoding a protein with the same function that is more than 70% (preferably more than 80%; more preferably more than 90%; more preferably more than 93%; more preferably more than 95%; more preferably more than 97%) identical to the sequence of SEQ ID NO:6.

[0046] In another aspect of the present invention, the use of a synthetic module (gene combination) is provided for promoting the production / yield of bisabolol; the module includes genes encoding the following group of proteins: (1) bisabolol synthase; (2) MVA pathway enzymes; (3) proteins selected from the synthetic protein group a, which includes NADH kinase.

[0047] In one or more embodiments, the module further comprises genes encoding the following group of proteins: (4) proteins selected from group b of anabolic proteins, which include transcription factors or molecular chaperones.

[0048] In another aspect of the present invention, a kit for producing bisabolol is provided, comprising: any of the above-mentioned engineered yeasts; or the above-mentioned synthesis-promoting module (gene combination).

[0049] In one or more embodiments, the gene combination is contained in an expression cassette or expression construct (such as an expression vector).

[0050] In one or more embodiments, the kit further comprises: yeast culture medium, glycerol and / or methanol.

[0051] Other aspects of the present invention will be apparent to those skilled in the art in view of the disclosure herein. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] Figure 1 , schematic diagram of the construction of plasmid pPICZA-IntX.

[0053] Figure 2 , schematic diagram of the construction of plasmid pPICZA-IntX-Y.

[0054] Figure 3 , analysis of multiple proteins that promote the expression of bisabolol.

[0055] Figure 4 The fermentation titer of a series of Pichia pastoris engineered strains with ScMXR1, ScPDI1, ScERO1, KрHAC1, ScHAC1, KpYAP1, and ScYAP1 integrated into KB-05, KB-06 or KB-07 strains, and Int18 sites was compared.

[0056] Figure 5 , fed-batch fermentation curve of KB-06 strain in a 5-L fermenter.

[0057] Figure 6 , fed-batch fermentation curve of KB-07 strain in a 5-L fermenter. DETAILED DESCRIPTION

[0058] After in-depth research, the inventors introduced a series of exogenous genes into yeast engineering strains through gene recombination technology, effectively improving the production of bisabolol by yeast engineering bacteria. The bisabolol-producing engineering bacteria obtained by the present invention provide a new way for the industrial production of bisabolol.

[0059] the term

[0060] As used herein, the "expression cassette" or "gene expression cassette" refers to a gene expression system that contains all the necessary elements required to express the target polypeptide, which generally includes the following elements: a promoter, a gene sequence encoding a polypeptide, and a terminator; in addition, it may optionally include a signal peptide coding sequence, etc.; these elements are operably linked.

[0061] As used herein, the term "operably linked" or "operably linked" refers to the functional spatial arrangement of two or more nucleic acid regions or nucleic acid sequences. For example, a promoter region is placed at a specific position relative to the target gene nucleic acid sequence, so that transcription of the nucleic acid sequence is guided by the promoter region, and thus the promoter region is "operably linked" to the nucleic acid sequence.

[0062] As used herein, the "(expression) construct" or "(expression) construct" refers to a recombinant DNA molecule, which comprises a desired nucleic acid coding sequence, which may comprise one or more gene expression cassettes. The "construct" is usually contained in an expression vector.

[0063] As used herein, the term "exogenous" or "heterologous" refers to the relationship between two or more nucleic acid or protein sequences from different sources, or the relationship between a protein (or nucleic acid) and a host cell from different sources. For example, a nucleic acid is exogenous to a host cell if the combination of nucleic acid and host cell does not normally occur in nature. A particular sequence is "exogenous" to a cell or organism into which it is inserted.

[0064] As used herein, the "bisabolol" also includes variations based on the compounds disclosed in the present invention, for example, the core structure of the compound remains unchanged, but a group (such as an aliphatic hydrocarbon group containing 1-4 carbon atoms (preferably 1-2 carbon atoms)) is substituted at individual (such as 1-3, 1-2) positions.

[0065] Production system overview

[0066] In view of the deficiencies in the prior art, the present invention provides a recombinant Pichia pastoris strain with high yield of (-)-α-bisabolol, a construction method thereof, and application of the strain in the biosynthesis of (-)-α-bisabolol.

[0067] Although there have been some studies in the field on the synthesis of bisabolol by prokaryotic strains such as Escherichia coli, it is difficult to meet the requirements of safety or stability in actual production. Although the expression of eukaryotic yeast has been studied and applied in the field, the research on the synthesis of bisabolol is not satisfactory. As for Pichia pastoris, it is often used in protein expression and some production in the field, but there is no precedent in the field for successfully applying it to the efficient production of bisabolol.

[0068] The present invention changes the status of the art and provides a genetically engineered yeast for producing bisabolol. By heterologously expressing a series of proteins in the yeast engineered bacteria, efficient de novo synthesis of bisabolol in yeast cells can be achieved.

[0069] The recombinant yeast engineered bacteria constructed in the present invention has good compatibility with the preferred protein of the present invention and has unique advantages over the prokaryotic organism Escherichia coli in heterologous expression.

[0070] Based on repeated exploration and optimization, the present invention optimizes and adjusts the expression intensity of different proteins. By changing the copy number, different proteins are expressed with different intensities, which is more conducive to the coordination between proteins and between proteins and cells, and is expressed in the most matching and appropriate manner.

[0071] Genes and their expression systems

[0072] The present invention provides a yeast engineered bacterium with high yield of (-)-α-bisabolol, a construction method thereof and an application thereof in the synthesis of (-)-α-bisabolol. Specifically, the present invention utilizes genetic engineering means to integrate an optimized and selected bisabolol synthase into the genome of Pichia pastoris, and recombinantly expresses MVA pathway enzymes; preferably, ERG20 and CcBBS are fused and expressed at the genome level; preferably, NADH kinase is also recombinantly expressed; preferably, transcription factors or molecular chaperones are also recombinantly expressed. The recombinant Pichia pastoris strain obtained by construction can efficiently match with exogenously introduced proteins, thereby obtaining a high yield of bisabolol, and the significant advantages of simple product extraction and separation, etc., have a good prospect for industrial application.

[0073] Specifically, in the present invention, Pichia pastoris is used as a base cell, and a pro-synthesis module is introduced into the yeast engineering bacteria, wherein the module includes the following group protein coding genes: (1) bisabolol synthase; (2) MVA pathway enzyme; (3) a protein selected from the pro-synthesis protein group a, which includes NADH kinase. Preferably, it also includes a protein selected from the pro-synthesis protein group b, which includes a transcription factor or a molecular chaperone. In a preferred embodiment, the coding gene of the protein integrated into the genome is driven by a methanol-induced promoter P AOX1 As a promoter.

[0074] Through the strategy of the present invention, the expression of bisabolol synthase, MVA pathway enzyme, and NADPH kinase is enhanced, and the yield of bisabolol is increased; at the same time, the expression of transcription factors and molecular chaperones is enhanced, cell homeostasis is maintained, and cell stress resistance is enhanced.

[0075] The molecular chaperones or transcription factors described in the present invention have been used to increase the secretion and expression of exogenous proteins, but are still rarely used in metabolic engineering, such as for increasing the synthesis of terpenoid compounds. The present invention is the first to screen some molecular chaperones and transcription factors in a bisabolol-synthesizing strain, screen factors that work efficiently, and then obtain a bisabolol-synthesizing strain with higher and more stable production capacity.

[0076] In the present invention, the gene encoding the protein may be naturally occurring, such as being isolated or purified from plants, animals or microorganisms. In addition, the gene may also be artificially prepared, such as being obtained by conventional genetic engineering recombination techniques, or being obtained by artificial synthesis.

[0077] In the present invention, the nucleotide sequence of the gene encoding the protein may be the same as the sequence provided in the embodiment, or may be a degenerate variant thereof. As used herein, "degenerate variant" refers to a nucleic acid sequence encoding a protein having the same function but different from the sequence described in the embodiment in the present invention. The present invention includes the native sequence of the above-mentioned gene, and also includes the sequence after codon optimization. In the present invention, natural gene sequences are currently used for recombinant expression, and it is expected that the yield can be further improved by optimizing and establishing optimized yeast engineering bacteria using some codon optimization methods known in the art. These further optimization techniques based on the scheme of the present invention should also be included in the technical scheme of the present invention.

[0078] The gene may include: a coding sequence encoding only a mature polypeptide; a coding sequence of a mature polypeptide and various additional coding sequences; a coding sequence of a mature polypeptide (and optional additional coding sequences) and non-coding sequences.

[0079] The present invention also relates to variants of the gene, wherein the polypeptide encoded by the gene is different from the corresponding wild-type polypeptide in amino acid sequence and is a fragment, analog or derivative of the wild-type polypeptide. The variant of the polynucleotide may be a naturally occurring allelic variant or a non-naturally occurring variant. These nucleotide variants include substitution variants, deletion variants and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide, which may be a substitution, deletion or insertion of one or more nucleotides, but will not substantially change the function of the polypeptide encoded by it.

[0080] The present invention also relates to polynucleotides that hybridize with the above-mentioned sequences and have at least 50%, preferably at least 70%, and more preferably at least 80% identity between the two sequences. The present invention particularly relates to polynucleotides that can hybridize with the polynucleotides of the present invention under stringent conditions. In the present invention, "stringent conditions" refer to: (1) hybridization and elution at relatively low ionic strength and relatively high temperature, such as 0.2×SSC, 0.1% SDS, 60°C; or (2) the addition of denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42°C, etc.; or (3) hybridization occurs only when the identity between the two sequences is at least 90%, and more preferably 95%. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the corresponding wild-type polypeptide.

[0081] The full-length sequence of each gene of the present invention or its fragments can usually be obtained by PCR amplification, recombination or artificial synthesis. For PCR amplification, primers can be designed based on the relevant nucleotide sequence disclosed in the present invention, especially the open reading frame sequence, and the relevant sequence can be amplified. When the sequence is long, PCR amplification can be performed twice or more, and then the fragments amplified in each time are spliced ​​together in the correct order.

[0082] The present invention also relates to a vector comprising the polynucleotide, and a host cell produced by genetic engineering using the vector.

[0083] In the present invention, the sequence of each gene can be inserted into a recombinant expression vector. The term "recombinant expression vector" refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses or other vectors well known in the art. In short, any plasmid and vector can be used as long as they can replicate and be stable in the host. An important feature of an expression vector is that it usually contains a replication origin, a promoter, a marker gene and a translation control element.

[0084] The sequence of each gene can be inserted into a recombinant expression vector respectively, and multiple recombinant expression vectors can be co-transfected into a host cell; the expression cassettes of multiple genes can also be inserted into the same recombinant expression vector in a tandem manner and transferred into a host cell. The recombinant expression vector may also contain an expression control sequence operably connected to the sequence of the gene to facilitate the expression of the protein. It should be understood that after those skilled in the art understand the technical content of the present invention, they can conveniently construct a recombinant expression vector. The obtained recombinant expression vector is also included in the present invention.

[0085] In the expression regulatory sequence or expression cassette, an inducible or constitutive promoter can be used according to different needs. The inducible promoter can achieve more controllable protein expression and compound production, which is conducive to industrial application.

[0086] The recombinant Pichia yeast strain obtained by the gene recombination technology of the present invention has the characteristics of low metabolic background, strong heterologous expression ability, no need to add other precursors, whole-cell synthesis of the final product, and easy separation of the final product. It can solve the problems existing in the synthesis of traditional biological and chemical methods to a large extent and provide a new way for the industrial production of bisabolol.

[0087] Preferred strains for synthesizing bisabolol and preferred synthesis method

[0088] The preferred technical solutions of the present invention can be realized by the following preferred technical solutions:

[0089] As a preferred method, a yeast engineered bacterium for producing (-)-α-bisabolol (hereinafter referred to as bisabolol) is provided, wherein the yeast engineered bacterium uses GS115 as a chassis cell, and the genome is integrated with the coding gene of the bisabolol synthase CcBBS from artichoke to achieve the de novo biosynthesis of bisabolol. Preferably, the coding gene of the bisabolol synthase CcBBS is integrated into the Int1 site of the genome in a single copy form to construct a recombinant Pichia pastoris strain KB-01. Preferably, the coding nucleotide sequence of the bisabolol synthase CcBBS is shown in SEQ ID NO: 1.

[0090] As a preferred method, on the basis of obtaining the bisabolol synthesis strain KB-01, the MVA pathway enzymes tHMG1 and IDI are integrated into the genome. Preferably, tHMG1 and IDI are fused and expressed in the same open reading frame through the self-cleaving peptide T2A, and the coding gene of the fusion-expressed tHMG1-T2A-IDI protein is integrated into the Int21 site of the strain KB-01 genome to construct a recombinant yeast engineered strain KB-02. Preferably, the coding nucleotide sequence of the tHMG1-T2A-IDI is shown in SEQ ID NO: 2.

[0091] As a preferred method, based on the yeast engineering bacteria KB-02, the genome is integrated with the gene sequence of the MVA pathway enzyme ERG20 and the bisabolol synthase fusion expression protein to enhance the expression of the bisabolol synthase and enhance the transport of FPP. The two enzymes are connected by a linker (GS). 4 Preferably, the fusion expression protein ERG20-(GS) 4 -CcBBS encoding gene, integrated into the site Int12 of the genome of strain KB-02 in a single copy form, to construct a recombinant Pichia pastoris strain KB-03. Preferably, the fusion expression protein ERG20-(GS) 4 -CcBBS encoding gene, and then integrated into the site Int6 of the genome of strain KB-03 in a single copy form to construct the recombinant Pichia pastoris strain KB-04. Preferably, the encoding nucleotide sequence of ERG20 is as shown in SEQ ID NO:3.

[0092] As a preferred method, based on the yeast engineering strain KB-04, NADPH kinase is integrated into the genome. Preferably, the NADPH kinase is Pichia pastoris NADH kinase POS5; the NADPH kinase gene is integrated into the genome Int10 site in a single copy form to obtain the recombinant Pichia pastoris strain KB-05. Preferably, the encoding nucleotide sequence of the NADH kinase POS5 is shown in SEQ ID NO:4.

[0093] As a preferred method, on the basis of the yeast engineering bacteria KB-05, the molecular chaperones ERO1 and PDI1 are integrated into the genome to mitigate the stress response of the cell itself and achieve high production of bisabolol; the coding gene of the molecular chaperone is integrated into the Int18 site of the genome in a single copy. Preferably, the coding nucleotide sequence of the molecular chaperone ERO1 is shown in SEQ ID NO:5. Preferably, the coding nucleotide sequence of the molecular chaperone PDI1 is shown in SEQ ID NO:6. Preferably, on the basis of the yeast engineering bacteria KB-05, the molecular chaperone ERO1 is integrated into the Int18 site of the genome to construct the bisabolol high-yielding strain KB-06. Preferably, on the basis of the yeast engineering bacteria KB-05, the molecular chaperone PDI1 is integrated into the Int18 site of the genome to construct the bisabolol high-yielding strain KB-07.

[0094] As a preferred embodiment, the method for producing bisabolol by fermentation with the aforementioned yeast engineered bacteria comprises the following steps: (1) inoculating the yeast engineered bacteria into a seed culture medium for culturing to prepare a seed solution; (2) inoculating the seed solution of (1) into a fermentation culture medium for fermentation to obtain a fermentation solution containing bisabolol; (3) separating and obtaining bisabolol from the fermentation solution of (2).

[0095] In the present invention, the seed culture medium and the fermentation culture medium can be selected from conventional culture medium in the art, as long as the strain can grow and efficiently produce bisabolol. The specific operation of strain culture can be carried out according to conventional operations in the art.

[0096] As an example, in the shake flask culture scheme, the yeast engineering bacteria are inoculated into the BMMY medium, cultured at 28°C and 200rpm for 24 hours to prepare the seed solution. Then the seed solution is inoculated into the BMMY medium at a ratio of 1% (v / v), cultured at 28°C and 200rpm for 24 hours, and then 1% (v / v) methanol is added for induction, and 1% (v / v) methanol is added every 24 hours, and intermittent sampling is performed to detect the content of bisabolol in the culture solution.

[0097] As an example, in the fermentation tank scale production scheme, take the glycerol strain and streak it, place it in a 30℃ incubator for 48h, pick a single colony and inoculate it into a 4mL test tube culture medium for 24h, inoculate it into 250mL BMMY initial shake flask culture medium with a 1% inoculation amount, and culture it overnight at 28℃ and 200rpm to prepare the seed liquid. The seed liquid prepared by the above method is inoculated into a 5L fermenter containing 2.5L BSM basal salt culture medium at a 10% inoculation amount. Set the DO-stirring linkage mode, and when the glycerol in the initial culture medium is exhausted and the DO rises sharply, automatically add glycerol; at the same time, add ammonia water to maintain a constant pH. When the cell density of the recombinant Pichia pastoris is cultivated to the predetermined value, stop the glycerol feeding, maintain it for 30-60min, and perform starvation culture. Then add methanol, set the DO-STAT mode, and automatically add methanol in the forward direction, and keep the dissolved oxygen DO value higher than 20% during the process. Wherein, the formula of the BMMY medium is: peptone 20g / L, yeast extract powder 10g / L, 100mM potassium phosphate buffer, pH 6.5. The formula of the BSM basal salt medium is: calcium sulfate dihydrate (1.14g / L), potassium sulfate (14.3g / L), magnesium sulfate heptahydrate (12.2g / L), potassium hydroxide (3.3g / L), orthophosphoric acid (21mL / L) and glycerol (40g / L). Preferably, pyruvic acid and citric acid are added to the culture medium at a concentration of 0-10g / L to promote the formation of acetyl CoA and increase the yield of bisabolol. Preferably, dodecane is added to the culture medium for two-phase fermentation culture, wherein the amount of dodecane added is 10-20% (v / v) to remove the bisabolol accumulated in the cells, reduce its toxicity to the cells, and increase the yield of bisabolol.

[0098] After the cultivation is completed, the fermentation broth is extracted using a conventional solvent, such as dodecane, ethyl acetate, butyl acetate, toluene, petroleum ether, etc., the organic phase is separated, and the solvent is removed by evaporation and concentration to obtain the target product, bisabolol.

[0099] As a preferred manner, the (-)-α-bisabolol is detected by gas chromatography (GC) detection method. Preferably, gas chromatography is used to analyze the yield of (-)-α-bisabolol. The chromatographic column is an HP-5 column (30m×0.320mm×0.25μm), the injection volume is set to 1.0μL, and the split ratio is 15:1. The chromatographic conditions are: initial temperature 80°C, increased to 150°C at a rate of 10°C / min and maintained for 5 minutes, then increased to 230°C at the same rate and maintained for 3 minutes. The peak time of (-)-α-bisabolol is 19.70min. The standard curve is constructed using the standard products provided by Sigma-Aldrich, and the yield of (-)-α-bisabolol is calculated by the standard curve.

[0100] In a preferred embodiment of the present invention, Pichia pastoris is used as a host, and the bisabolol synthase CcBBS from artichoke is screened and introduced, and is overexpressed to enhance the synthesis capacity of bisabolol. The MVA pathway enzyme is introduced, and the ERG20-CcBBS fusion protein is constructed through a linker on this basis. NADH kinase is overexpressed to enhance the expression of molecular chaperones ERO1 and PDI1, thereby maintaining cell homeostasis and enhancing cell stress resistance. The bisabolol yield of the preferred strain reaches 46.8 g / L, and the extraction and separation of the product is relatively simple, which has a good prospect for industrial application.

[0101] Reagent test kit

[0102] The present invention also provides a kit comprising an engineered strain for producing the bisabolol. In addition, it may also include a culture medium for yeast cells and a reagent for separating or detecting the bisabolol. More preferably, the kit may also include instructions for use for describing a method for biosynthesizing the bisabolol.

[0103] The present invention also provides a kit for constructing the engineered strain producing bisabolol, and the kit may include a series of constructs, for example, the constructs provided in the embodiments of the present invention may be referred to, or other constructs containing the gene but with different gene arrangements or tandems. The establishment of expression vectors (expression constructs) may adopt techniques familiar to those skilled in the art. After knowing the enzymes to be selected and the cell systems to be expressed, those skilled in the art may establish expression constructs. Gene sequences may be inserted into different expression constructs (such as expression vectors) or into the same expression construct, as long as the polypeptides encoded by them can be effectively expressed and active after being transferred into cells. The kit may also include yeast cells, culture medium of yeast cells, and separation or detection reagents for the bisabolol. More preferably, the kit may also include instructions for use of the method for biosynthesizing bisabolol.

[0104] The present invention is further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually carried out according to conventional conditions such as those described in J. Sambrook et al., Molecular Cloning Experiment Guide, Science Press, or according to the conditions recommended by the manufacturer.

[0105] In the subsequent examples, the primer sequences used are shown in Table 1.

[0106] Table 1. Primers for constructing Pichia pastoris engineered strain KB-06

[0107]

[0108] Example 1: Method for genome gene integration editing

[0109] The gene editing method was performed according to the literature (ACS Synth. Biol., 2022, 11(2): 547). The plasmid map used in this method can be found in Figure 1 The plasmid carries the sgRNA expression system, Cas9 protein expression system, target gene expression cassette, bleomycin resistance (BleoR; working concentration: 100 mg / L), and is cultured at 30°C. After the recombinant strain is successfully constructed, it is streaked and subcultured on YPD solid medium without antibiotic selection pressure to eliminate free plasmids.

[0110] The specific steps of this method are as follows:

[0111] 1.1 Construction of gene editing plasmid pPICZA-IntX

[0112] The universal plasmid vector pPICZA of Pichia purchased from Invitrogen was modified to carry the CRISPR-Cas system, and the subsequent strain genome editing operation was carried out on this basis. The specific operation is as follows:

[0113] The plasmid pPICZA was used to construct a genomic DNA sequence expressing the endogenous GAP promoter (P GAP )、human Cas9 protein encoding gene (Cas9), CYC1 terminator (T CYC1 ) composed of an expression cassette PCT, and the coding gene of Cas9 protein was artificially synthesized after codon optimization. SER )、small guide RNA (sgRNA), sgRNA scaffold, CYC1 terminator (T CYC1 ) is used to guide the Cas9 protein to achieve directional cutting of the target gene. AOX1 The 5' end of the promoter and T AOX1 At the 3' end of the terminator, about 500bp of upstream homology arm sequence (Up-Arm) and downstream homology arm sequence (Down-Arm) of the integration site were added, respectively, for the target gene to undergo "exchange-recombination" with the yeast genome sequence at a specific site. The plasmid was constructed using the Nanjing Novozymes ClonExpress II One Step Cloning Kit to obtain the positive recombinant plasmid pPICZA-IntX. The restriction site was retained on the multiple cloning site (MCS) for the insertion of the target gene.

[0114] Table 2. sgRNA sequences in constructing gene editing plasmid pPICZA-IntX

[0115] Location sgRNA sequence (5'-3') Int1 TATCTGAAGTATTTACTGGG Int21 GCACCATCTGGATAGCATTG Int12 GGGGTTTGAATAACAGACAC Int6 CAACTCGAATTATAGTGGCG Int10 AATTACTTCGGGAATAATGG Int18 TACATGGAATAGGGTCACGT

[0116] The nucleic acid sequence of the expression cassette PCT is shown in SEQ ID NO: 7; the nucleic acid sequence of the expression cassette PSST is shown in SEQ ID NO: 8. The upstream and downstream homology arm sequences of the integration site are designed according to the specific site to be integrated and inserted into the target gene.

[0117] The schematic diagram of the construction of the plasmid pPICZA-IntX is shown in Figure 1 .

[0118] 1.2 Construction of recombinant integration plasmid

[0119] The target gene nucleic acid fragment to be integrated was amplified by PCR technology, purified and recovered by agarose gel electrophoresis. The target gene nucleic acid fragment and plasmid pPICZA-IntX were digested by restriction endonucleases EcoRⅠ and XhoⅠ, purified and recovered by agarose gel electrophoresis. The recovered exogenous gene DNA fragment and pPICZA-IntX fragment were connected by T4 DNA ligase. The circularized recombinant plasmid was transformed into Escherichia coli JM109 competent cells, screened by bleomycin resistance (25 mg / L) plate, verified by colony PCR and sequencing, and the positive recombinant plasmid pPICZA-IntX-Y was obtained.

[0120] As an example Figure 2 As shown, in the naming of the positive recombinant plasmid pPICZA-IntX-Y, IntX represents the site to be integrated on the genome, and Y represents the name of the enzyme or protein to be integrated.

[0121] The schematic diagram of the construction of the plasmid pPICZA-IntX-Y is shown in Figure 2 .

[0122] Wherein, the method of amplifying the target gene nucleic acid fragment to be integrated by using PCR technology is:

[0123] (1) For the exogenous gene of Pichia pastoris, synthesize the target gene sequence, design the corresponding upstream and downstream primers, and use PCR technology to amplify the synthesized gene sequence to obtain the target nucleic acid fragment;

[0124] or (2) for endogenous genes of Pichia pastoris, extract the genome of Pichia pastoris GS115, design corresponding upstream and downstream primers according to the gene sequence provided by NCBI, and use PCR technology to amplify the genome of Pichia pastoris GS115 to obtain the target nucleic acid fragment;

[0125] Or (3) For protein fusion expression genes, conventional molecular biological techniques are used to prepare DNA fragments of the corresponding protein fusion expression genes, corresponding upstream and downstream primers are designed, and PCR technology is used to amplify the synthesized gene sequence to obtain the target nucleic acid fragment.

[0126] Among them, the system of PCR amplification reaction is: Max DNA Polymerase (TAKARA, Dalian) 25 μL, upstream primer (10 μM) 2.5 μL, downstream primer (10 μM) 2.5 μL, template DNA 1 μL, sterile water was added to a total volume of 50 μL. The PCR reaction conditions were: 98°C 3 min, 35 cycles (98°C 10 s, annealing temperature 15 s, 72°C extension, about 10 s / kb), 72°C 10 min, 4°C maintenance.

[0127] 1.3 Construction of genome-integrated recombinant Pichia pastoris engineered strains

[0128] The recombinant plasmid pPICZA-IntX-Y was introduced into the pre-prepared Pichia pastoris competent strain for genome fragment integration by electroporation, and spread on a YPD screening plate containing 100 (mg / L) bleomycin, cultured at 30°C for 2-3 days, and single colonies were picked and identified by colony PCR to determine the positive clones with correct integration of the target protein, which were stored for later use.

[0129] The method for preparing the competent strain of Pichia pastoris includes: (1) inoculating the competent Pichia pastoris cells to be prepared into a YPD liquid medium and culturing the cells until the OD 600 is 0.8-1.0; (2) take 10 mL of culture medium, centrifuge at 4000 rpm for 5 min at room temperature, discard the supernatant, and resuspend the bacterial sludge in a mixture of 9 mL BEDS solution and 1 mL threitol solution (1 M); (3) incubate on ice for 5 min; (4) centrifuge at 4000 rpm for 5 min at room temperature, discard the supernatant, and resuspend the bacterial sludge in 1 mL BEDS solution; (5) divide into 1.5 mL Eppendorf tubes and store at -80°C.

[0130] The formula of YPD liquid culture medium is: 2% peptone, 1% yeast extract, and 2% glucose.

[0131] The formulation of BEDS solution is: 10 mM bicine-NaOH, pH 8.3, containing 3% (v / v) ethylene glycol and 1 M sorbitol.

[0132] Example 2: Construction of Pichia pastoris engineered strains KB-01 to KB-05

[0133] Using Pichia pastoris GS115 as the starting strain, according to the method described in Example 1, the gene sequence of bisabolol synthase CcBBS from artichoke was integrated into the Int1 site of the Pichia pastoris GS115 genome (CcBBS comes from artichoke, GeneID: 112527994, the nucleotide sequence after Pichia pastoris codon optimization is shown in the sequence information), and the Pichia pastoris engineering strain KB-01 was constructed;

[0134] Then, using the Pichia pastoris engineering strain KB-01 as the starting strain, according to the method described in Example 1, the gene sequence of the fusion expression protein tHMG1-T2A-IDI was integrated into the Int21 site of the genome of the Pichia pastoris engineering strain KB-01 (tHMG1 comes from the endogenous gene of Pichia pastoris GS115, Gene ID: 8198637, positions 1501-2961; IDI comes from the endogenous gene of Pichia pastoris GS115, Gene ID: 8197017), to construct the Pichia pastoris engineering strain KB-02;

[0135] Then, using the Pichia pastoris engineered strain KB-02 as the starting strain, the fusion expression protein ERG20-(GS) was expressed according to the method described in Example 1. 4 -The gene sequence of CcBBS was integrated into the Int12 site of the genome of the Pichia pastoris engineering strain KB-02 (ERG20 comes from the endogenous gene of Pichia pastoris GS115, Gene ID: 8197764; CcBBS comes from artichoke, Gene ID: 112527994, the nucleotide sequence after Pichia pastoris codon optimization is shown in the sequence information), and the Pichia pastoris engineering strain KB-03 was constructed;

[0136] Then, using the Pichia pastoris engineered strain KB-03 as the starting strain, the protein ERG20-(GS) was fused again according to the method described in Example 1. 4 -CcBBS gene sequence was integrated into the Int6 site of the genome of Pichia pastoris engineering strain KB-03 (amplified using Pichia pastoris GS115 and CcBBS sequence synthesized by GenScript as template, nucleotide sequence see sequence information), to construct Pichia pastoris engineering strain KB-04.

[0137] Example 3: Analysis of proteins that promote the expression of bisabolol

[0138] In the previous work, the inventor screened various types of proteins to find proteins that are beneficial to promoting the expression of bisabolol. After in-depth analysis and research, the POS5 protein was selected, which is a NADH kinase and belongs to a NADPH kinase. This example presents the promoting effect of different proteins by comparison, and among them, the POS5 protein has an excellent effect, especially the effect of KpPOS5 is unexpectedly excellent.

[0139] Using Pichia pastoris engineering strain KB-04 as the starting strain, according to the method described in Example 1, the gene sequence of NADH kinase POS5 (KpPOS5, NADH kinase encoding gene from Pichia pastoris GS115) (obtained by amplification using Pichia pastoris GS115 as a template) was integrated into the Int10 site of the genome of Pichia pastoris engineering strain KB-04 to construct Pichia pastoris engineering strain KB-05.

[0140] Furthermore, based on the strain, KpPOS5 was replaced with the following gene to prepare the strain:

[0141] KpZWF1: Pichia pastoris GS115-derived glucose-6-phosphate dehydrogenase encoding gene (Gene ID: 8197340);

[0142] KptPOS5: truncation of the gene encoding NADH kinase from Pichia pastoris GS115 (Gene ID: 31-1293 in 8197340);

[0143] ScPOS5: Saccharomyces cerevisiae S288C-derived NADH kinase encoding gene (Gene ID: 855913);

[0144] SctPOS5: a truncated version of the NADH kinase encoding gene from Saccharomyces cerevisiae S288C (Gene ID: 43-1245 in 855913).

[0145] Wherein, the primer sequences are shown in Table 3.

[0146] Table 3. Primers used to construct related Pichia engineering strains

[0147]

[0148] Shake flask culture was used. The above-mentioned Pichia yeast engineered strain was inoculated into a 250mL Erlenmeyer flask containing 50mL BMMY medium, and cultured at 28°C and 200rpm for 24h to prepare seed solution. Then the seed solution was inoculated into a 250mL Erlenmeyer flask containing 50mL BMMY medium at a ratio of 1% (v / v), and cultured at 28°C and 200rpm for 24h, and then 5mL of dodecane was added, and 1% (v / v) methanol was added for induction, and 1% (v / v) methanol was added every 24h, and intermittent sampling was performed to detect the content of bisabolol.

[0149] like Figure 3 As shown, overexpression of the NADH kinase gene (KpPOS5) from Pichia pastoris GS115 unexpectedly increased the yield from 660 mg / L to 1272 mg / L.

[0150] Example 4. Construction of Pichia pastoris engineered strains KB-06 and KB-07

[0151] Using Pichia engineering strain KB-05 as the starting strain, according to the method described in Example 1, the gene sequence of KpERO1 (amplified using Pichia GS115 as a template) was integrated into the Int18 site of the genome of Pichia engineering strain KB-05 to construct Pichia engineering strain KB-06.

[0152] Using Pichia pastoris engineering strain KB-05 as the starting strain, the gene sequence of KpPDI1 was integrated into the Int18 site of the genome of Pichia pastoris engineering strain KB-05 according to the method described in Example 1 to construct Pichia pastoris engineering strain KB-07.

[0153] Wherein, the primer sequences are shown in Table 4.

[0154] Table 4. Primers used to construct Pichia pastoris engineered strain KB-07

[0155]

[0156] In the same way, the inventors also constructed a series of Pichia pastoris engineered strains with ScMXR1 (Gene ID: 856765 derived from Saccharomyces cerevisiae S288C), ScPDI1 (Gene ID: 850314, derived from Saccharomyces cerevisiae S288C), ScERO1 (Gene ID: 854909, derived from Saccharomyces cerevisiae S288C), KрHAC1 (Gene ID: 8196642, derived from Pichia pastoris GS115), ScHAC1 (Gene ID: 850513, derived from Saccharomyces cerevisiae S288C), KpYAP1 (Gene ID: 8200866, derived from Pichia pastoris GS115), and ScYAP1 (Gene ID: 855005, derived from Saccharomyces cerevisiae S288C) integrated at the Int18 site.

[0157] Example 5: Fermentation of Bisabolol by Pichia pastoris engineered strain KB-06

[0158] Shake flask culture was used. The Pichia yeast engineered strain KB-06 described in Example 4 was inoculated into a 250mL conical flask containing 50mL BMMY culture medium, and cultured at 28°C and 200rpm for 24h to prepare a seed solution. The seed solution was then inoculated into a 250mL conical flask containing 50mL BMMY culture medium at a ratio of 1% (v / v), and cultured at 28°C and 200rpm for 24h, and then 5mL of dodecane was added, and 1% (v / v) methanol was added for induction, and 1% (v / v) methanol was added every 24h, and intermittent sampling was performed to detect the content of bisabolol. After 120h of culture, the yield of bisabolol reached 2277mg / L.

[0159] Example 6: Fermentation of Bisabolol by Pichia pastoris engineered strain KB-07

[0160] Shake flask culture was used. The Pichia yeast engineered strain KB-07 described in Example 4 was inoculated into a 250mL conical flask containing 50mL BMMY culture medium, and cultured at 28°C and 200rpm for 24h to prepare a seed solution. The seed solution was then inoculated into a 250mL conical flask containing 50mL BMMY culture medium at a ratio of 1% (v / v), and cultured at 28°C and 200rpm for 24h, and then 5mL of dodecane was added, and 1% (v / v) methanol was added for induction, and 1% (v / v) methanol was added every 24h, and intermittent sampling was performed to detect the content of bisabolol. After 120h of culture, the yield of bisabolol reached 2043mg / L.

[0161] The KB-06 or KB-07 strains were compared with KB-05 and a series of Pichia engineered strains with ScMXR1, ScPDI1, ScERO1, KрHAC1, ScHAC1, KpYAP1, and ScYAP1 integrated at the Int18 site. The KB-06 or KB-07 strains had significantly higher titers, such as Figure 4 .

[0162] Example 7: Fermentation of Bisabolol by Pichia pastoris engineered strain KB-06

[0163] Use a fermentation tank for culture. Prepare 2.5L fermentation medium: 2g / L calcium sulfate dihydrate, 15g / L potassium sulfate, 15g / L magnesium sulfate heptahydrate, 5g / L potassium hydroxide, 40g / L glycerol, 5g / L pyruvic acid, 5g / L citric acid, and use orthophosphoric acid to adjust the pH to 6.5. Place the fermentation medium in a 5L fermentation tank and sterilize at 121℃ for 20min.

[0164] The Pichia yeast engineered strain KB-06 described in Example 4 was inoculated into a 1L Erlenmeyer flask filled with 250mL BMMY medium and cultured at 28°C and 200rpm for 24h to prepare a seed solution. The seed solution prepared by the above method was inoculated into a 5L fermentation tank, the temperature was controlled at 28°C, ammonia water was added to control the pH to be stable at 6.5, and the stirring speed was adjusted to maintain the dissolved oxygen between 20-30%. When the glycerol in the initial culture medium was exhausted and the DO rose sharply, 80% (v / v) glycerol was added to the cell density OD 600 When the concentration reached 100, the glycerol feeding was stopped and maintained for 60 min for starvation culture. Then 500 mL of dodecane was added, methanol was fed, and DO-STAT was set to automatically add methanol in the positive direction to keep the dissolved oxygen DO at 20-30%.

[0165] The fermentation process curve is as follows Figure 5 As shown, after 144 h of fermentation, the yield of bisabolol was 47.1 g / L.

[0166] Example 8: Fermentation of Bisabolol by Pichia pastoris engineered strain KB-07

[0167] Use fermentation tank for culture. Prepare 2.5L fermentation medium: 5g / L calcium sulfate dihydrate, 10g / L potassium sulfate, 10g / L magnesium sulfate heptahydrate, 5g / L potassium hydroxide, 40g / L glycerol, 10g / L pyruvic acid, 10g / L citric acid, and adjust the pH to 6.5 with orthophosphoric acid. Place the fermentation medium in a 5L fermentation tank and sterilize at 121℃ for 20min.

[0168] The Pichia yeast engineered strain KB-07 described in Example 4 was inoculated into a 1L Erlenmeyer flask filled with 250mL BMMY medium, and cultured at 28°C and 200rpm for 24h to prepare seed solution. The seed solution prepared by the above method was inoculated into a 5L fermentation tank, the temperature was controlled at 28°C, ammonia water was added to control the pH to be stable at 6.5, and the stirring speed was adjusted to maintain the dissolved oxygen between 20-30%. When the glycerol in the initial culture medium was exhausted and the DO rose sharply, 80% (v / v) glycerol was added to the cell density OD 600 When the concentration reached 100, the glycerol feeding was stopped and maintained for 60 min for starvation culture. Then 500 mL of dodecane was added, methanol was fed, and DO-STAT was set to automatically add methanol in the positive direction to keep the dissolved oxygen DO at 20-30%.

[0169] The fermentation process curve is as follows Figure 6 As shown, after 144 h of fermentation, the yield of bisabolol was 38.8 g / L.

[0170] Sequence information

[0171] SEQ ID NO: 1: Nucleotide sequence encoding bisabolol synthase CcBBS

[0172]

[0173] SEQ ID NO: 2: Nucleotide sequence encoding tHMG1-T2A-IDI

[0174] Positions 1-1455: tHMG1, positions 1456-1509: T2A, positions 1510-2358: IDI

[0175]

[0176] SEQ ID NO: 3: Nucleotide sequence encoding ERG20

[0177]

[0178] SEQ ID NO:4: Nucleotide sequence encoding POS5

[0179]

[0180] SEQ ID NO:5: Nucleotide sequence encoding ERO1

[0181]

[0182] SEQ ID NO:6: Nucleotide sequence encoding PDI1

[0183]

[0184] SEQ ID NO:7: Nucleotide coding sequence of PCT expression cassette

[0185] No. 1-477: P GAP ; Positions 478-4617: Cas9; Positions 4618-4872: T CYC1

[0186]

[0187] SEQ ID NO:8: Nucleotide coding sequence of the PSST expression cassette

[0188] Positions 1 - 239: P SER , positions 240 - 259: sgRNA, positions 260 - 339: sgRNA scaffold, positions 340 - 594: T CYC1

[0189] AAGTATCACAGTTGGATTAATTAGATATGAAAACTAATTGTTTATTTACAATAAGACGCAGATAGCCCCTTTCGTTCAGAATAGTCATTTCATCATATTTCCTGATATATATGTCTACATTAGTCTTCAATTGAACTCTGTCACAGTGGCCGAGTGGTTAAGGCGATGCCCTGCTATTCTTTGAAAGTAGTTAAGGCATTGGGTTCTACCTGCGCAGGTTCGAATCCTGTCTGTGACGCTATCTGAAGTATTTACTGGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTGCTAGCCTCATGTAATTAGTTATGTCACGCTTACATTCACGCCCTCCCCCCACATCCGCTCTAACCGAAAAGGAAGGAGTTAGACAACCTGAAGTCTAGGTCCCTATTTATTTTTTTATAGTTATGTTAGTATTAAGAACGTTATTTATATTTCAAATTTTTCTTTTTTTTCTGTACAGACGCGTGTACGCATGTAACATTATACTGAAAACCTTGCTTGAGAAGGTTTTGGGACGCTCGAAGGCTTTAATTTGC

[0190] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that, for a person of ordinary skill in the art, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims. At the same time, all the documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference separately.

Claims

1. A method for producing bisabolol, comprising: a. Providing a yeast engineering bacterium, introducing a synthesis-promoting module into the yeast engineering bacterium, wherein the module comprises a gene encoding a protein of the following group: (1) Bisabolol synthase; (2) MVA pathway enzymes; (3) a protein selected from the group of anabolic proteins a, which includes NADH kinase; b. Fermenting with the engineered yeast prepared in step a to produce bisabolol.

2. The method according to claim 1, characterized in that The module also includes the following histone coding genes: (4) A protein selected from group b of anabolic proteins, which includes transcription factors or molecular chaperones.

3. The method according to claim 1 or 2, characterized in that The NADH kinase comprises: POS5; or The transcription factor or molecular chaperone includes one selected from: ERO1, PDI1, YAP1, ERO1, MXR1, HAC1; preferably includes one selected from: ScERO1, ScPDI1, KpYAP1, ScERO1, ScMXR1, ScHAC1; more preferably includes one selected from: ERO1, PDI1, YAP1; more preferably includes one selected from: ScERO1, ScPDI1, KpYAP1; or The bisabolol synthase comprises BBS; preferably comprises CcBBS derived from artichoke (Cynara cardunculus var. scolymus); or The MVA pathway enzymes include: ERG20, tHMG1, and IDI.

4. The method according to claim 1 or 2, characterized in that: The tHMG1 and IDI are fused and expressed; preferably, the two are fused through a self-cleaving peptide T2A linker to form tHMG1-T2A-IDI; or The ERG20 and BBS are fused and expressed; preferably, the two are fused via a polypeptide (GS)4 linker to form ERG20-(GS)4-BBS; More preferably, in the yeast engineered bacteria, the BBS is expressed in two or three copies; the ERG20 is expressed in two copies; and the tHMG1, IDI, POS5, ERO1 or PDI1 is expressed in a single copy. More preferably, in the yeast engineered bacteria, the coding genes of tHMG1 and IDI are introduced into the Int21 site; the coding genes of ERG20 and BBS are introduced into the Int12 and / or Int6 sites, preferably the Int12 and Int6 sites; the coding genes of the transcription factors or molecular chaperones are introduced into the Int18 site; or the coding gene of the NADH kinase is introduced into the Int10 site; more preferably, the protein coding genes introduced into the genome are expressed under the promoter P inducible by methanol. AOX1 As a promoter.

5. The method according to claim 1 or 2, characterized in that: b, comprising the following fermentation process steps: (1) inoculating the yeast engineering bacteria into a seed liquid culture medium for culturing to prepare a seed liquid; (2) inoculating the seed liquid of (1) into a fermentation medium for fermentation to obtain a fermentation liquid containing bisabolol; (3) separating and obtaining bisabolol from the fermentation liquid of (2); Preferably, shake flask culture is adopted: the yeast engineering bacteria are activated to prepare seed liquid, which is inoculated into a conical flask filled with fermentation medium at an inoculation rate of 5-10%, and shaken culture is carried out at 25-30°C. After culturing for 12-24 hours, 10-20% (v / v) dodecane is added, and 1% (v / v) methanol is added intermittently to induce the synthesis of related enzymes; more preferably, the fermentation medium comprises: peptone 10-20 g / L, yeast extract powder 10-20 g / L, pyruvic acid 0-5 g / L, citric acid 0-5 g / L, KH2PO4 10-15 g / L; more preferably, the pH is adjusted to 6.0-6.

5. Preferably, a fermentation tank is used for culture: the yeast engineering bacteria are activated to prepare a seed solution, which is inoculated into a fermentation tank containing an initial fermentation medium at an inoculation rate of 5-10%, and fermentation culture is started; during the fermentation process, ammonia water is added to control pH stability, and the stirring speed is adjusted to maintain the dissolved oxygen between 20-30%; after the glycerol in the fermentation medium is exhausted, a glycerol solution is added until the expected OD is reached. 600 value; then adding 10-20% (v / v) dodecane, and adding methanol to induce the synthesis of related enzymes to achieve the accumulation of bisabolol; more preferably, the initial fermentation medium comprises: 1-5g / L calcium sulfate dihydrate, 10-20g / L potassium sulfate, 10-20g / L magnesium sulfate heptahydrate, 1-5g / L potassium hydroxide, 20-40g / L glycerol, 0-10g / L pyruvic acid, and 0-10g / L citric acid; more preferably, the fermentation pH is 6.0-6.5, and the fermentation temperature is 25-30°C.

6. A yeast engineered bacterium, comprising a synthesis-promoting module, wherein the module comprises genes encoding the following proteins: (1) Bisabolol synthase; (2) MVA pathway enzymes; (3) a protein selected from the group of anabolic proteins a, which includes NADH kinase; Preferably, the module also includes the following histone coding genes: (4) A protein selected from group b of anabolic proteins, which includes transcription factors or molecular chaperones.

7. The yeast engineering bacterium according to claim 6, characterized in that: The NADH kinase includes: POS5; preferably, it is derived from Pichia pastoris GS115 or Saccharomyces cerevisiae S288C; The transcription factor or molecular chaperone includes one selected from: ERO1, PDI1, YAP1, ERO1, MXR1, HAC1; preferably includes one selected from: ScERO1, ScPDI1, KpYAP1, ScERO1, ScMXR1, ScHAC1; more preferably includes one selected from: ERO1, PDI1, YAP1; more preferably includes one selected from: ScERO1, ScPDI1, KpYAP1; The bisabolol synthase comprises BBS; preferably comprises CcBBS derived from artichoke (Cynara cardunculus var. scolymus); The MVA pathway enzymes include: ERG20, tHMG1, and IDI.

8. The yeast engineering bacterium according to claim 6, characterized in that: The tHMG1 and IDI are fused and expressed; preferably, the two are fused through a self-cleaving peptide T2A linker to form tHMG1-T2A-IDI; The ERG20 and BBS are fused and expressed; preferably, the two are fused via a polypeptide (GS)4 linker to form ERG20-(GS)4-BBS; More preferably, in the yeast engineered bacteria, the BBS is expressed in two or three copies; the ERG20 is expressed in two copies; and the tHMG1, IDI, POS5, ERO1 or PDI1 is expressed in a single copy. More preferably, in the yeast engineered bacteria, the coding genes of tHMG1 and IDI are introduced into the Int21 site; the coding genes of ERG20 and BBS are introduced into the Int12 and / or Int6 sites, preferably the Int12 and Int6 sites; the coding genes of the transcription factors or molecular chaperones are introduced into the Int18 site; or the coding gene of the NADH kinase is introduced into the Int10 site; more preferably, the coding genes of the proteins introduced into the genome are expressed under the promoter P inducible by methanol. AOX1 As a promoter; More preferably, the engineered yeast bacteria includes Pichia pastoris.

9. Use of a synthesis promoting module for promoting the production / yield of bisabolol; the module comprises the following group protein encoding genes: (1) Bisabolol synthase; (2) MVA pathway enzymes; (3) a protein selected from the group of anabolic proteins a, which includes NADH kinase; Preferably, the module also includes the following histone coding genes: (4) A protein selected from group b of anabolic proteins, which includes transcription factors or molecular chaperones.

10. A kit for producing bisabolol, comprising: The yeast engineered bacteria according to any one of claims 6 to 8; or the synthesis-promoting module defined in claim 9; Preferably, the gene combination is contained in an expression cassette or expression construct; Preferably, the kit further comprises: yeast culture medium, glycerol and / or methanol.

Images