Composition for real-time fluorescence quantitative PCR and its application

By designing specific primers and probes, combining blocking groups and fluorescence quenching groups, the difficulties of multiple target detection in the prior art are solved, and efficient and low-cost multiple target detection is achieved.

CN119876355BActive Publication Date: 2025-08-29SICHUAN MACCURA BIOTECH CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510361510.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-26
Publication Date
2025-08-29
Estimated Expiration
2045-03-26

AI Technical Summary

Technical Problem

The existing real-time fluorescence quantitative PCR technology has problems such as high probe design requirements, reduced specificity, restriction of instrument fluorescence channels and high reagent costs in multiple target detection, making it difficult to achieve efficient multi-target detection.

Method used

Design specific forward and reverse primers, and the specific probe adds blocking groups at the 3' end, and through the combination of fluorescence groups and quenching groups, ensuring that the probe and primers are not templates for each other, achieving multiple target detection.

Benefits of technology

The efficiency and specificity of multiple target detection is achieved, the cost of reagents is reduced, the fluorescence channel limitation is avoided, and the sensitivity and accuracy of detection is improved.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119876355B_ABST
    Figure CN119876355B_ABST
Patent Text Reader

Abstract

The present invention provides a composition for real-time fluorescence quantitative PCR and its application, which belongs to the field of determination or inspection of nucleic acids or microorganisms. The composition for real-time fluorescence quantitative PCR provided by the present invention includes a specific forward primer, a specific reverse primer and a specific probe, wherein the specific forward primer and the specific reverse primer are used to amplify the target DNA, and a blocking group is added between the i-th nucleotide and the (i+1)-th nucleotide from the 3' end of the specific reverse primer, 4≤i≤8; the two ends of the specific probe are respectively labeled with a fluorescent group and a second quenching group, and the middle is labeled with a first quenching group, and the partial sequence of the specific probe is the same as the partial sequence of the reverse primer. Real-time fluorescence quantitative PCR is performed based on the above composition, and multiple target detection is achieved by combining the type of fluorescent group carried by the specific probe with the different melting temperatures of each target PCR product.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of nucleic acid or microbial determination or testing, and in particular to a composition for real-time fluorescence quantitative PCR and application thereof. Background Art

[0002] Nucleic acid detection technology has always held a pivotal position in modern biological research and clinical diagnostics. Traditional PCR technology can rapidly amplify specific DNA fragments in vitro. However, it can only qualitatively analyze the amplified products after the reaction is complete, failing to accurately determine the copy number of the starting template. Furthermore, cross-contamination during post-amplification testing is highly susceptible to occur, severely impacting the accuracy and reliability of experimental results. With the continuous advancement of technology, real-time fluorescence quantitative PCR has emerged to address the shortcomings of traditional PCR. It cleverly combines fluorescence signals with PCR amplification, monitoring the fluorescence signal in real time as the PCR reaction proceeds. By analyzing the dynamic changes in the fluorescence signal, not only can the starting template be accurately quantified, but contamination issues associated with post-amplification testing can also be effectively avoided, significantly improving the sensitivity, accuracy, and reproducibility of the test.

[0003] The TaqMan probe method, a real-time fluorescence quantitative PCR method, involves adding a specific fluorescent probe to a pair of primers for PCR amplification. The probe is labeled with a fluorescent group and a quencher at each end. When the probe is intact, the fluorescent signal emitted by the reporter group is absorbed by the quencher. During PCR amplification, the 5'-3' exonuclease activity of the Taq enzyme cleaves and degrades the probe, separating the fluorescent group and quencher. The fluorescence signal is then detected by a fluorescence monitoring system. The accumulation of the fluorescent signal is synchronized with the formation of PCR products. The relationship between the fluorescent signal and the number of amplification cycles allows for the generation of a real-time amplification curve, enabling quantitative detection of the template copy number.

[0004] The biggest advantage of the TaqMan probe method is its high throughput and high sensitivity. It also eliminates the need for post-PCR electrophoresis, hybridization, and other procedures, reducing contamination and operational errors. However, TaqMan probe design places high demands on the sequence. Probes that are too short will result in a low Tm and will not hybridize to the target sequence, while probes that are too long will reduce probe specificity. Especially for the simultaneous detection of multiple pathogens, interference between primers can reduce detection specificity, making it impossible to simultaneously detect or distinguish multiple types. Furthermore, the construction of multiplex PCR systems using the TaqMan method is often limited by the number of fluorescence channels on the instrument. Separate construction steps can increase reagent costs and make the operation more cumbersome. Summary of the Invention

[0005] The present invention provides a composition for real-time fluorescence quantitative PCR, which can realize multiple target detection.

[0006] In a first aspect, the present invention provides a composition for real-time fluorescent quantitative PCR, comprising a specific forward primer, a specific reverse primer, and a specific probe, wherein:

[0007] The specific forward primer and the specific reverse primer are used to amplify the target DNA;

[0008] A blocking group is added between the i-th nucleotide and the (i+1)-th nucleotide at the 3' end of the specific reverse primer, where 4≤i≤8, and i is a positive integer;

[0009] The specific probe meets the following conditions:

[0010] 1) The specific probe is a single-stranded nucleic acid molecule;

[0011] 2) the first nucleotide at the first end of the specific probe is labeled with a fluorescent group, the nth nucleotide from the first end of the specific probe is labeled with a first quenching group, and the first nucleotide at the second end of the specific probe is labeled with a second quenching group, where 9≤n≤30, n is a positive integer and n is less than the total number of nucleotides in the specific probe;

[0012] 3) The partial nucleotide sequence of the specific probe is identical to the nucleotide sequence from the first nucleotide to the i-th nucleotide from the 3' end of the specific reverse primer;

[0013] 4) the specific probe does not bind to the specific forward primer;

[0014] 5) The specific probe does not bind to the specific reverse primer.

[0015] In the present invention, the target DNA refers to a DNA fragment corresponding to a target nucleic acid fragment, which can be DNA or RNA. A target nucleic acid fragment is a specific nucleic acid fragment present in a specific region of the gene of the pathogen to be detected, which can serve as a detection target. This nucleic acid fragment can be clearly distinguishable from the gene sequence of other pathogens or the sample to be detected itself. For pathogens whose genetic material is DNA, the target nucleic acid fragment is the target DNA; for pathogens whose genetic material is RNA, the target DNA is obtained by reverse transcription of the target nucleic acid fragment.

[0016] In the present invention, pathogens refer to organisms or substances that can cause disease in a host (e.g., humans, animals, plants, etc.), such as viruses, chlamydia, rickettsia, mycoplasma, bacteria, spirochetes, fungi, and other microorganisms and parasites. In one embodiment, the pathogen is a virus. Furthermore, the genetic material of the virus may be DNA.

[0017] In the present invention, the target DNA is double-stranded DNA, the specific forward primer is capable of specifically binding to one strand of the target DNA, and the specific reverse primer is capable of specifically binding to the other strand of the target DNA. Under the action of DNA polymerase, an extension reaction is carried out using the double-stranded DNA as a template. Both the specific forward primer and the specific reverse primer are single-stranded DNA.

[0018] In the present invention, the design principles of the specific forward primer and the specific reverse primer are the same as or similar to the design principles of conventional forward primers and reverse primers in the art, with the difference that a blocking group is added between the i-th nucleotide and the (i+1)-th nucleotide from the 3' end of the specific reverse primer in the present invention, 4≤i≤8, and i is a positive integer (i is one of 4, 5, 6, 7, 8), and i is less than the total number of nucleotides in the specific reverse primer; when the above-mentioned specific forward primer and specific reverse primer are used to perform PCR amplification on the target DNA, the specific forward primer binds to the template chain of the target DNA and extends, and the extension stops after encountering the blocking group, thereby obtaining a double-stranded amplification product in which one chain is shorter than the other chain.

[0019] Furthermore, the total number of nucleotides of the specific reverse primer may be 18-35 nucleotides.

[0020] In the present invention, the specific probe may be a single-stranded DNA molecule.

[0021] In the present invention, the first end may be the 5' end of the specific probe, and correspondingly, the second end is the 3' end of the specific probe; the first end may also be the 3' end of the specific probe, and correspondingly, the second end is the 5' end of the specific probe.

[0022] In the present invention, n may be any one of 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, and 30.

[0023] In the present invention, a portion of the nucleotide sequence of the specific probe is identical to the nucleotide sequence between the first nucleotide and the i-th nucleotide from the 3' end of the specific reverse primer. Furthermore, the nucleotide sequence in the specific probe that is identical to the specific reverse primer should be located near both ends of the specific probe to facilitate binding to the shorter DNA strand in the double-stranded amplification product and improve the binding rate. Furthermore, the nucleotide sequence in the specific probe that is identical to the specific reverse primer is located near the 3' end of the specific probe, i.e., between the nucleotides modified by the first quencher group and the second quencher group in the specific probe.

[0024] In the present invention, the aforementioned binding means that the specific probe will not serve as a template for PCR amplification with the specific forward primer or specific reverse primer. That is, in the absence of target DNA or the presence of the corresponding pathogen in the sample to be tested, the specific probe remains curled, and the fluorescent signal emitted by the fluorescent group labeled at the first end of the specific probe will be absorbed by the first quencher group and / or the second quencher group, making the corresponding fluorescent signal undetectable. When at least two specific forward primers and specific reverse primers are present in the PCR system, the specific probe will not bind to specific primer pairs targeting other target DNAs.

[0025] The principles involved in the present invention are as follows Figure 1 Specifically, when target double-stranded DNA is present, the specific forward primer and specific reverse primer provided by the present invention specifically bind to the target DNA and extend to produce a pre-amplification product, which includes a shorter DNA strand and a longer DNA strand. Simultaneously, the specific probe can bind to the shorter DNA strand in the pre-amplification product through base complementary pairing and continue PCR amplification along the 5' to 3' direction of the DNA strand. As PCR amplification proceeds, the structure of the specific probe changes (primarily by changing the distance between the fluorescent group and the quencher group), making the fluorescent signal emitted by the fluorescent group unable to be absorbed by the first quencher group and the second quencher group, and the fluorescent signal can be detected by the instrument. When target double-stranded DNA is absent, the specific forward primer and specific reverse primer do not bind to the specific probe as template strands and extend, and the specific probe remains in a coiled state. The fluorescent signal emitted by the fluorescent group is absorbed by the first quencher group or the second quencher group (primarily the first quencher group), and the fluorescent signal cannot be detected. By observing the presence of the fluorescent signal, the presence of the target double-stranded DNA can be determined, and whether the sample to be tested contains the pathogen to be detected can be determined, thereby achieving qualitative detection of the pathogen.

[0026] When multiplex PCR detection is required to determine whether the sample to be tested contains multiple pathogens, different targets can be distinguished by changing the fluorescent group labeled with the specific probe; when the number of fluorescent channels is limited, that is, when the specific probes are labeled with the same fluorescent group, by changing the melting temperature (Tm value) of each target PCR product, a melting curve analysis is performed after the PCR amplification is completed. Combining the type of fluorescent group carried by the specific probe and the different Tm values ​​of each target PCR product, multiple target detection can also be achieved.

[0027] The above detection process is illustrated by taking HPV 18 as an example: the nucleotide sequence of the target DNA for detecting HPV 18 provided by the present invention is shown in SEQ ID NO: 35; for the above target DNA, the nucleotide sequence of the specific forward primer provided by the present invention is 5'-GGTGACACTGTGCCTCAATCCT-3' (SEQ ID NO: 21), the nucleotide sequence of the specific reverse primer is 5'- ACACACAGCTGCCAGGTGAAG-3' (the first 16 nucleotide sequences are SEQ ID NO: 22), and a blocking group is connected between the 16th nucleotide (G) and the 17th nucleotide (T) from the 5' end, and the nucleotide sequence of the specific probe is 5'-ACTGCCAGTCCATCAACCTATCTGTGCAATGGCTGACATCCCCTAATGC TGAAG CAGGC -3' (SEQ ID NO: 34), and the first nucleotide (A) from the 5' end is labeled with a fluorescent group, the 13th nucleotide (T) is labeled with a first quenching group, and the 59th nucleotide (C) is labeled with a second quenching group. When the target DNA is PCR amplified using the above-mentioned specific forward primer and specific reverse primer, the obtained pre-amplification product includes a nucleotide sequence of 5'-GGTGACACTGTGCCTCAATCCTTATATATTAAAGGCACAGGTATGCCTG CTTCA -3' (SEQ ID NO:49), and the DNA chain from nucleotide 1 to nucleotide 5 (as underlined in the above sequence) at the 3' end of the DNA chain is bound to the specific probe from nucleotide 50 to nucleotide 54 (as underlined in the above sequence) at the 5' end through complementary pairing. Because the 3' end of the specific probe is labeled with a second quenching group, it cannot trigger the extension reaction of the DNA polymerase. Therefore, the DNA chain acts as a primer, and extension is performed using the specific probe as a template to generate a secondary PCR amplification. The secondary amplification product forms a double-stranded structure with the specific probe. The fluorescent signal emitted by the fluorescent group cannot be absorbed by the quenching group, and the fluorescent signal is detected, indicating the presence of the target DNA.

[0028] In the composition described above, the molar ratio of the specific forward primer to the specific reverse primer is greater than or equal to 3:1, thereby increasing the amplified product chain that can bind to the specific probe. Furthermore, the molar ratio of the specific forward primer to the specific reverse primer is 3:1-10:1, and specifically can be 3:1, 3.5:1, 4:1, 4.5:1, 5:1, 5.5:1, 6:1, 6.5:1, 7:1, 7.5:1, 8:1, 8.5:1, 9:1, 9.5:1, 10:1, or within the range of any two thereof. Furthermore, the molar ratio of the specific forward primer to the specific reverse primer is 10:1.

[0029] In the composition described above, the specific probe has a length of 20-60 nt and a GC content of 40%-60%.

[0030] In the composition as described above, the blocking group is at least one of C3 Spacer, C6 Spacer, C9 Spacer, and C12 Spacer.

[0031] In the composition as described above, the fluorescent group is selected from at least one of FAM (carboxyfluorescein), JOE (carboxydimethylfluorescein), TAMRA (tetramethylrhodamine), ROX (rhodamine X), CY3, CY5, VIC, and HEX (hexachlorofluorescein).

[0032] In the composition as described above, the quenching group is selected from at least one of BHQ1 and BHQ2.

[0033] In a second aspect, the present invention provides a method for preparing any of the above-mentioned compositions, comprising:

[0034] S1. providing the specific forward primer, specific reverse primer and specific probe in the above composition;

[0035] S2. Combining the specific forward primer, the specific reverse primer and the specific probe to obtain the composition.

[0036] In the present invention, the modification methods of the blocking group, fluorescent group and quenching group can be performed according to conventional methods in the art.

[0037] In the present invention, the specific forward primer, specific reverse primer and specific probe can be packaged separately or mixed together.

[0038] In a third aspect, the present invention provides an application of any of the above-mentioned compositions, wherein the application is at least one of A1) to A4):

[0039] A1) Application in real-time fluorescence quantitative PCR analysis;

[0040] A2) Application in the preparation of real-time fluorescence quantitative PCR analysis products;

[0041] A3) Application in pathogen detection;

[0042] A4) Use in the preparation of products for detecting pathogens.

[0043] In a fourth aspect, the present invention provides a method for pathogen detection based on real-time fluorescence quantitative PCR, comprising:

[0044] D1. Based on the target nucleic acid fragment of the pathogen to be detected, provide the composition as described above; prepare the nucleic acid of the sample to be detected;

[0045] D2. Using the composition to perform real-time fluorescence quantitative PCR on the nucleic acid to determine whether the sample to be detected contains the pathogen to be detected.

[0046] In the method described above, the nucleic acid of the sample to be detected may be double-stranded DNA.

[0047] As described above, the methods of the present invention are suitable for any pathogen, such as a pathogen whose genome is RNA or DNA.

[0048] The methods described above may have a direct purpose other than disease diagnosis and / or treatment. The applications or methods described above are non-disease diagnosis applications or methods. These applications or methods do not have a direct purpose of obtaining a disease diagnosis result or health status in a living human or animal body.

[0049] The above method is an application or method for non-disease treatment purposes and does not directly aim to restore or restore health or alleviate suffering in a living human or animal body.

[0050] In the above method, the sample to be detected may be a sample from a non-living human or animal body, such as an environmental sample (such as air), clothing or towels, or animal tissues and / or organs used as food.

[0051] According to the method described above, the molar concentration of the forward primer in the reaction system is 90-1000 nM, specifically 90 nM, 100 nM, 150 nM, 200 nM, 250 nM, 300 nM, 350 nM, 400 nM, 450 nM, 500 nM, 550 nM, 600 nM, 650 nM, 700 nM, 750 nM, 800 nM, 850 nM, 900 nM, 950 nM, 1000 nM or within the range of any two thereof.

[0052] In the method described above, the molar concentration of the reverse primer in the reaction system is 30-100 nM, specifically 30 nM, 35 nM, 40 nM, 45 nM, 50 nM, 55 nM, 60 nM, 65 nM, 70 nM, 75 nM, 80 nM, 85 nM, 90 nM, 95 nM, 100 nM or within the range of any two thereof.

[0053] According to the method described above, the molar concentration of the probe in the reaction system is 100-1000 nM, specifically 100 nM, 150 nM, 200 nM, 250 nM, 300 nM, 350 nM, 400 nM, 450 nM, 500 nM, 550 nM, 600 nM, 650 nM, 700 nM, 750 nM, 800 nM, 850 nM, 900 nM, 950 nM, 1000 nM or within the range of any two thereof.

[0054] As described above, in the method D2, whether the sample to be tested contains the pathogen to be tested can be determined by detecting the fluorescent signal. For example, if the corresponding fluorescent signal is detected, it means that the sample to be tested contains the pathogen to be tested. If the corresponding fluorescent signal is not detected, it means that the sample to be tested does not contain the pathogen to be tested or contains the pathogen below the detection limit. In addition, for multiplex PCR detection, whether the sample to be tested contains the pathogen to be tested can also be determined by detecting the fluorescent signal and Tm value. For example, if the same fluorescent signal is present, the Tm value is analyzed by melting curve analysis to determine the type or typing of the pathogen to be tested, thereby realizing multiplex target detection.

[0055] It is understood that the compositions provided herein are suitable for detecting a variety of pathogens. Those skilled in the art can provide compositions targeting different pathogens and perform multiplex PCR assays based on the disclosure of the present invention. In one embodiment, the number of pathogens to be detected is no less than two, and may be multiple types of pathogens, or multiple different types of pathogens. Furthermore, the number of pathogens to be detected is no less than three. Furthermore, the number of pathogens to be detected is no less than four.

[0056] In a fifth aspect, the present invention provides a composition for detecting human papillomavirus, comprising at least one of a first composition for detecting HPV type 58, a second composition for detecting HPV type 56, a third composition for detecting HPV type 52, a fourth composition for detecting HPV type 59, a fifth composition for detecting HPV type 39, a sixth composition for detecting HPV type 68, a seventh composition for detecting HPV type 16, an eighth composition for detecting HPV type 33, a ninth composition for detecting HPV type 31, a tenth composition for detecting HPV type 45, an eleventh composition for detecting HPV type 18, a twelfth composition for detecting HPV type 66, a thirteenth composition for detecting HPV type 35, and a fourteenth composition for detecting HPV type 51;

[0057] The first composition includes a first forward primer, a first reverse primer and a first probe for detecting HPV 58; the second composition includes a second forward primer, a second reverse primer and a first probe for detecting HPV 56; the third composition includes a third forward primer, a third reverse primer and a second probe for detecting HPV 52; the fourth composition includes a fourth forward primer, a fourth reverse primer and a second probe for detecting HPV 59; the fifth composition includes a fifth forward primer, a fifth reverse primer and a second probe for detecting HPV 39; the sixth composition includes a sixth forward primer, a sixth reverse primer and a second probe for detecting HPV 68; the seventh composition includes a seventh forward primer, a seventh reverse primer and a third probe for detecting HPV 16; the eighth composition includes an eighth forward primer, an eighth reverse primer and a third probe for detecting HPV 33; the ninth composition includes an eighth forward primer, an eighth reverse primer and a third probe for detecting HPV The tenth composition comprises a tenth forward primer, a tenth reverse primer and a third probe for detecting HPV 45; the eleventh composition comprises an eleventh forward primer, an eleventh reverse primer and a fourth probe for detecting HPV 18; the twelfth composition comprises a twelfth forward primer, a twelfth reverse primer and a fourth probe for detecting HPV 66; the thirteenth composition comprises a thirteenth forward primer, a thirteenth reverse primer and a fourth probe for detecting HPV 35; the fourteenth composition comprises a fourteenth forward primer, a fourteenth reverse primer and a fourth probe for detecting HPV 51;

[0058] The first forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 1;

[0059] The second forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 3;

[0060] The third forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 5;

[0061] The fourth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 7;

[0062] The fifth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 9;

[0063] The sixth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 11;

[0064] The seventh forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 13;

[0065] The eighth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 15;

[0066] The ninth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 17;

[0067] The tenth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 19;

[0068] The eleventh forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 21;

[0069] The twelfth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 23;

[0070] The thirteenth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 25;

[0071] The fourteenth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 27;

[0072] The general structural formula of the reverse primer is shown in Formula 1:

[0073] 5'-n(a)-Yn(b)-3' Formula 1

[0074] In Formula 1, n(a) and n(b) are polynucleotide fragments with different nucleotide sequences, and Y is a blocking group;

[0075] In the first reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 2, and the nucleotide sequence of n(b) is GGACC;

[0076] In the second reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 4, and the nucleotide sequence of n(b) is TCTAC;

[0077] In the third reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 6, and the nucleotide sequence of n(b) is TTTCC;

[0078] In the fourth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 8, and the nucleotide sequence of n(b) is GGTAG;

[0079] In the fifth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 10, and the nucleotide sequence of n(b) is TCCAA;

[0080] In the sixth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 12, and the nucleotide sequence of n(b) is CCCAG;

[0081] In the seventh reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 14, and the nucleotide sequence of n(b) is GGATG;

[0082] In the eighth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 16, and the nucleotide sequence of n(b) is ATGCC;

[0083] In the ninth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 18, and the nucleotide sequence of n(b) is CATCT;

[0084] In the tenth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 20, and the nucleotide sequence of n(b) is GCATG;

[0085] In the eleventh reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 22, and the nucleotide sequence of n(b) is TGAAG;

[0086] In the twelfth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 24, and the nucleotide sequence of n(b) is TCCC;

[0087] In the thirteenth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 26, and the nucleotide sequence of n(b) is CAATG;

[0088] In the fourteenth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 28, and the nucleotide sequence of n(b) is CAACC;

[0089] The first probe is a single-stranded DNA having a nucleotide sequence of SEQ ID NO: 31, wherein the first nucleotide of SEQ ID NO: 31 is labeled with a first fluorescent group, the 13th nucleotide is labeled with a first quenching group, and the 49th nucleotide is labeled with a second quenching group;

[0090] The second probe is a single-stranded DNA having a nucleotide sequence of SEQ ID NO: 32, wherein the first nucleotide of SEQ ID NO: 32 is labeled with a second fluorescent group, the 12th nucleotide is labeled with a third quenching group, and the 57th nucleotide is labeled with a fourth quenching group;

[0091] The third probe is a single-stranded DNA having a nucleotide sequence of SEQ ID NO: 33, wherein the first nucleotide of SEQ ID NO: 33 is labeled with a third fluorescent group, the 12th nucleotide is labeled with a fifth quenching group, and the 57th nucleotide is labeled with a sixth quenching group;

[0092] The fourth probe is a single-stranded DNA with a nucleotide sequence of SEQ ID NO: 34, and the first nucleotide of SEQ ID NO: 34 is labeled with a fourth fluorescent group, the 13th nucleotide is labeled with a seventh quenching group, and the 59th nucleotide is labeled with an eighth quenching group.

[0093] The composition described above further includes a composition for detecting an internal reference gene. In one embodiment, the internal reference gene can be a target DNA corresponding to human β-actin (β-actin). Furthermore, the composition for detecting the target DNA corresponding to human β-actin includes a fifteenth forward primer, a fifteenth reverse primer, and the first probe.

[0094] The fifteenth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 29;

[0095] The general structural formula of the fifteenth reverse primer is shown in Formula 1, and the nucleotide sequence of n(a) is SEQ ID NO: 30, and the nucleotide sequence of n(b) is TCTCG.

[0096] In the composition as described above, the blocking group is at least one of C3 Spacer, C6 Spacer, C9 Spacer, and C12 Spacer.

[0097] In the composition as described above, the first fluorescent group, the second fluorescent group, the third fluorescent group, and the fourth fluorescent group are independently selected from one of FAM, JOE, TAMRA, ROX, CY3, CY5, VIC, and HEX, and any two of the first fluorescent group, the second fluorescent group, the third fluorescent group, and the fourth fluorescent group are different.

[0098] In the composition as described above, the first quenching group, the second quenching group, the third quenching group, the fourth quenching group, the fifth quenching group, the sixth quenching group, the seventh quenching group and the eighth quenching group are independently selected from one of BHQ1 and BHQ2.

[0099] In a sixth aspect, the present invention provides a kit for detecting human papillomavirus, comprising any of the above-mentioned compositions.

[0100] In a seventh aspect, the present invention provides a method for detecting human papillomavirus based on real-time fluorescence quantitative PCR, comprising:

[0101] preparing nucleic acid of a sample to be tested;

[0102] Real-time fluorescence quantitative PCR is performed on the nucleic acid using any of the above-mentioned compositions to determine whether the sample to be detected contains human papillomavirus.

[0103] In the present invention, the sample to be detected can be a cervical exfoliated cell sample or an environmental sample.

[0104] In the present invention, the nucleic acid may be the DNA of the sample to be detected.

[0105] The present invention provides a novel specific forward primer, specific reverse primer, and specific probe for real-time fluorescence quantitative PCR. During real-time fluorescence quantitative PCR using this combination, the specific probe complementarily pairs with the amplified product and continues PCR amplification, causing the fluorescent signal on the specific probe to change, which can be detected by the instrument. By combining the type of fluorescent group carried by the specific probe with the different melting temperatures of the PCR products of each target, multiple target detection can be achieved. BRIEF DESCRIPTION OF THE DRAWINGS

[0106] Figure 1 This is a schematic diagram of the principle of the composition provided by the present invention in PCR amplification;

[0107] Figure 2 The results are from multiplex PCR testing of plasmid templates containing the corresponding target DNA using a combination of HPV types 18, 66, 35, and 51;

[0108] Figure 3The results are from multiplex PCR detection of plasmid templates containing the corresponding target DNA using a combination of HPV 58, HPV 56, and an internal reference gene;

[0109] Figure 4 The results are from multiplex PCR detection of plasmid templates containing the corresponding target DNA using a combination of HPV types 16, 33, 31, and 45;

[0110] Figure 5 The results are from multiplex PCR detection of plasmid templates containing the corresponding target DNA using a combination of HPV 52, HPV 59, HPV 39, and HPV 68;

[0111] Figure 6 The results are shown for multiplex PCR detection of HPV template plasmid mixtures using a combination of 14 HPV and internal reference genes;

[0112] Figure 7 The results are shown in Figure 1. Multiplex PCR detection of negative template plasmids using a combination of fourteen HPV types and internal reference genes.

[0113] Figure 8 The results of PCR detection of negative template plasmid using the composition targeting fourteen HPVs and internal reference genes provided in Comparative Example 1;

[0114] Figure 9 The results of PCR detection of positive template plasmids using the composition targeting fourteen HPVs and internal reference genes provided in Comparative Example 1;

[0115] Figure 10 The results of PCR detection of negative template plasmid using the composition targeting fourteen HPVs and internal reference genes provided in Comparative Example 2;

[0116] Figure 11 The results of PCR detection of positive template plasmids using the composition targeting fourteen HPVs and internal reference genes provided in Comparative Example 2. DETAILED DESCRIPTION

[0117] In order to make the purpose, technical solutions and advantages of the present invention clearer, the technical solutions of the present invention will be clearly and completely described below in conjunction with the drawings in the present invention. Obviously, the embodiments described are part of the embodiments of the present invention, not all of the embodiments, and they should not be understood as limitations on the present invention. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention. In the description of the present invention, it should be understood that the terms used are only for descriptive purposes and cannot be understood as indicating or implying relative importance.

[0118] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0119] The nucleotide sequences of the primers and probes involved in the following examples are shown in Table 1.

[0120]

[0121] In Table 1, iSpC3 indicates that a blocking group, C3 spacer, is inserted between two adjacent nucleotides in the reverse primer. The reverse primer sequence lists only the sequence 5' upstream of the C3 spacer. iBHQ1dT indicates that the corresponding thymine (T) base of the nucleotide is modified with a fluorescence quencher, BHQ1 (Black Hole Quencher 1); iBHQ2dT indicates that the corresponding thymine (T) base of the nucleotide is modified with a fluorescence quencher, BHQ2 (Black Hole Quencher 2). FAM denotes 5-carboxyfluorescein; VIC denotes green fluorescent protein; ROX denotes carboxy-X-rhodamine; CY5 denotes a cyanine dye; and BHQ1 and BHQ2 denote fluorescence quenchers, respectively.

[0122] Example 1: PCR detection of fourteen HPV types based on the primer-probe combination provided by the present invention

[0123] Step 1: providing a plasmid containing target DNA, wherein the nucleotide sequence of the target DNA corresponding to HPV type 18 is shown in SEQ ID NO: 35, the nucleotide sequence of the target DNA corresponding to HPV type 31 is shown in SEQ ID NO: 36, the nucleotide sequence of the target DNA corresponding to HPV type 33 is shown in SEQ ID NO: 37, the nucleotide sequence of the target DNA corresponding to HPV type 35 is shown in SEQ ID NO: 38, the nucleotide sequence of the target DNA corresponding to HPV type 39 is shown in SEQ ID NO: 39, the nucleotide sequence of the target DNA corresponding to HPV type 45 is shown in SEQ ID NO: 40, the nucleotide sequence of the target DNA corresponding to HPV type 51 is shown in SEQ ID NO: 41, the nucleotide sequence of the target DNA corresponding to HPV type 52 is shown in SEQ ID NO: 42, the nucleotide sequence of the target DNA corresponding to HPV type 56 is shown in SEQ ID NO: 43, the nucleotide sequence of the target DNA corresponding to HPV type 58 is shown in SEQ ID NO: 44, and the nucleotide sequence of the target DNA corresponding to HPV type 59 is shown in SEQ ID NO: NO:45, the nucleotide sequence of the target DNA corresponding to HPV type 66 is shown in SEQ ID NO:46, the nucleotide sequence of the target DNA corresponding to HPV type 16 is shown in SEQ ID NO:47, and the nucleotide sequence of the target DNA corresponding to HPV type 68 is shown in SEQ ID NO:48.

[0124] At the same time, a negative control plasmid is provided. The negative control plasmid does not contain the target DNA sequence, and the remaining sequences are the same as those of the plasmid containing the target DNA.

[0125] Step 2. Based on the target DNA, a primer-probe combination as shown in Table 1 was provided. According to the reaction system shown in Table 2, the plasmid containing the target DNA, the forward primer, reverse primer, probe shown in Table 1, and a PCR reaction premix were mixed to obtain a PCR reaction system with a total volume of 35 μL; wherein the PCR reaction premix included DEPC-treated water, Tris buffer (pH 8.5), dATP, dCTP, dGTP, dUTP, KCl, MgCl2, and DNA polymerase.

[0126]

[0127] Step 3: Seal the PCR tube cap and gently mix the sample, then centrifuge briefly and let it rest at room temperature for 5 minutes. Place the PCR tube in a handheld centrifuge again, centrifuge briefly, and transfer it to the tray of the SLAN real-time fluorescence quantitative PCR instrument of Shanghai Hongshi Medical Technology Co., Ltd. for PCR reaction. The PCR reaction procedure used is:

[0128]

[0129] Step 4, data analysis: Use SLAN real-time fluorescence quantitative PCR analysis software from Shanghai Hongshi Medical Technology Co., Ltd. to interpret the results by the Tm value of the melting curve. Figure 2-7 As shown, when multiple plasmid templates are mixed for multiplex PCR detection, different types of HPV viruses can be distinguished without false positives.

[0130] Comparative Example 1

[0131] The nucleotide sequences of the forward primer and reverse primer used in this comparative example are the same as those in Table 1, except that the reverse primer does not include the C3 spacer. The probe used is shown in Table 4.

[0132]

[0133] The positive template plasmid containing the target DNA and the positive template plasmid of the internal reference gene β-actin were mixed with the above primer-probe combination, and real-time fluorescence quantitative PCR was performed according to the method provided in Example 1. At the same time, real-time fluorescence quantitative PCR was performed using the negative template plasmid as a negative control (NTC). The reaction results are shown in FIG. Figure 8-9 As shown in the figure, when the C3 spacer is not added to the 3' end of the reverse primer, in the multiplex PCR system, the primers are likely to dimerize and produce nonspecific dimers, resulting in nonspecific peaks of the internal reference gene and false positives.

[0134] Comparative Example 2

[0135] The nucleotide sequences of the forward primer and reverse primer used in this comparative example for detecting HPV are the same as those in comparative example 1, and the forward primer used for detecting the internal reference gene is the same as that in comparative example 1, except that the reverse primer and probe for detecting HPV type 35 are optimized, and the optimized sequences are shown in Table 5.

[0136]

[0137] The positive template plasmid containing HPV target DNA and the positive template plasmid of the internal reference gene β-actin were mixed with the above primer-probe combination, and real-time fluorescence quantitative PCR was performed according to the method provided in Example 1. At the same time, real-time fluorescence quantitative PCR was performed using the negative template plasmid as a negative control (NTC). The reaction results are as follows: Figure 10-11 As shown, it can be seen that by optimizing the primers and probes for detecting the internal reference gene, the nonspecific peak corresponding to the internal reference gene disappears, but nonspecific peaks of other targets still appear. The composition provided by the present invention can well solve the appearance of nonspecific peaks and the problem of false positives, and is suitable for multiplex PCR detection.

[0138] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.

Claims

1. A composition for detecting human papillomavirus, characterized in that: comprising at least one of a first composition for detecting HPV type 58, a second composition for detecting HPV type 56, a third composition for detecting HPV type 52, a fourth composition for detecting HPV type 59, a fifth composition for detecting HPV type 39, a sixth composition for detecting HPV type 68, a seventh composition for detecting HPV type 16, an eighth composition for detecting HPV type 33, a ninth composition for detecting HPV type 31, a tenth composition for detecting HPV type 45, an eleventh composition for detecting HPV type 18, a twelfth composition for detecting HPV type 66, a thirteenth composition for detecting HPV type 35, and a fourteenth composition for detecting HPV type 51; The first composition includes a first forward primer, a first reverse primer, and a first probe for detecting HPV 58; the second composition includes a second forward primer, a second reverse primer, and a first probe for detecting HPV 56; the third composition includes a third forward primer, a third reverse primer, and a second probe for detecting HPV 52; the fourth composition includes a fourth forward primer, a fourth reverse primer, and a second probe for detecting HPV 59; the fifth composition includes a fifth forward primer, a fifth reverse primer, and a second probe for detecting HPV 39; the sixth composition includes a sixth forward primer, a sixth reverse primer, and a second probe for detecting HPV 68; and the seventh composition includes a seventh forward primer, a seventh reverse primer, and a third probe for detecting HPV 16. The eighth composition includes an eighth forward primer, an eighth reverse primer, and a third probe for detecting HPV type 33; the ninth composition includes a ninth forward primer, a ninth reverse primer, and a third probe for detecting HPV type 31; the tenth composition includes a tenth forward primer, a tenth reverse primer, and a third probe for detecting HPV type 45; the eleventh composition includes an eleventh forward primer, an eleventh reverse primer, and a fourth probe for detecting HPV type 18; The twelfth composition includes a twelfth forward primer, a twelfth reverse primer and a fourth probe for detecting HPV type 66; The thirteenth composition includes a thirteenth forward primer, a thirteenth reverse primer and a fourth probe for detecting HPV type 35; The fourteenth composition comprises a fourteenth forward primer, a fourteenth reverse primer and a fourth probe for detecting HPV type 51; The first forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 1; The second forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 3; The third forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 5; The fourth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 7; The fifth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 9; The sixth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 11; The seventh forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 13; The eighth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 15; The ninth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 17; The tenth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 19; The eleventh forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 21; The twelfth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 23; The thirteenth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 25; The fourteenth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 27; The general structural formula of the reverse primer is shown in Formula 1: 5'-n(a)-Yn(b)-3' Formula 1 In Formula 1, n(a) and n(b) are polynucleotide fragments with different nucleotide sequences, and Y is a blocking group; In the first reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 2, and the nucleotide sequence of n(b) is GGACC; In the second reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 4, and the nucleotide sequence of n(b) is TCTAC; In the third reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 6, and the nucleotide sequence of n(b) is TTTCC; In the fourth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 8, and the nucleotide sequence of n(b) is GGTAG; In the fifth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 10, and the nucleotide sequence of n(b) is TCCAA; In the sixth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 12, and the nucleotide sequence of n(b) is CCCAG; In the seventh reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 14, and the nucleotide sequence of n(b) is GGATG; In the eighth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 16, and the nucleotide sequence of n(b) is ATGCC; In the ninth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 18, and the nucleotide sequence of n(b) is CATCT; In the tenth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 20, and the nucleotide sequence of n(b) is GCATG; In the eleventh reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 22, and the nucleotide sequence of n(b) is TGAAG; In the twelfth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 24, and the nucleotide sequence of n(b) is TCCC; In the thirteenth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 26, and the nucleotide sequence of n(b) is CAATG; In the fourteenth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 28, and the nucleotide sequence of n(b) is CAACC; The first probe is a single-stranded DNA having a nucleotide sequence of SEQ ID NO: 31, wherein the first nucleotide of SEQ ID NO: 31 is labeled with a first fluorescent group, the 13th nucleotide is labeled with a first quenching group, and the 49th nucleotide is labeled with a second quenching group; The second probe is a single-stranded DNA having a nucleotide sequence of SEQ ID NO: 32, wherein the first nucleotide of SEQ ID NO: 32 is labeled with a second fluorescent group, the 12th nucleotide is labeled with a third quenching group, and the 57th nucleotide is labeled with a fourth quenching group; The third probe is a single-stranded DNA having a nucleotide sequence of SEQ ID NO: 33, wherein the first nucleotide of SEQ ID NO: 33 is labeled with a third fluorescent group, the 12th nucleotide is labeled with a fifth quenching group, and the 57th nucleotide is labeled with a sixth quenching group; The fourth probe is a single-stranded DNA with a nucleotide sequence of SEQ ID NO: 34, and the first nucleotide of SEQ ID NO: 34 is labeled with a fourth fluorescent group, the 13th nucleotide is labeled with a seventh quenching group, and the 59th nucleotide is labeled with an eighth quenching group.

2. The composition according to claim 1, characterized in that The composition further includes a fifteenth composition for detecting an internal reference gene, the fifteenth composition including a fifteenth forward primer, a fifteenth reverse primer, and the first probe for detecting an internal reference gene; The fifteenth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 29; The general structural formula of the fifteenth reverse primer is shown in Formula 1, and the nucleotide sequence of n(a) is SEQ ID NO: 30, and the nucleotide sequence of n(b) is TCTCG.

3. The composition according to claim 1 or 2, characterized in that The blocking group is at least one of C3 Spacer, C6 Spacer, C9 Spacer, and C12 Spacer.

4. The composition according to claim 1 or 2, characterized in that The first fluorescent group, the second fluorescent group, the third fluorescent group, and the fourth fluorescent group are independently selected from one of FAM, JOE, TAMRA, ROX, CY3, CY5, VIC, and HEX, and any two of the first fluorescent group, the second fluorescent group, the third fluorescent group, and the fourth fluorescent group are different; And / or, the first quenching group, the second quenching group, the third quenching group, the fourth quenching group, the fifth quenching group, the sixth quenching group, the seventh quenching group, and the eighth quenching group are independently selected from one of BHQ1 and BHQ2.

5. A kit for detecting human papillomavirus, characterized in that: The invention comprises the composition according to any one of claims 1 to 4.

Citation Information

Patent Citations

  • Primer probe and primer probe group for detection and application thereof

    CN116356075A

  • Primer probe for detection, primer probe set, and application thereof

    US20250059602A1