Probe, detection reagent and kit for detecting PCA3 in urine and use method of probe, detection reagent and kit

Abstract

The invention relates to the technical field of disease diagnosis, and provides a probe, a detection reagent and a kit for detecting PCA3 in urine and a use method thereof. The probe is as shown in SEQ ID NO. 4; a position which is 34nt away from a 5'end of a nucleotide sequence of the probe and is more than or equal to 15nt away from a 3 'end is marked with tetrahydrofuran, a T basic group at the upstream of a tetrahydrofuran site is marked with a fluorophore, a T basic group at the downstream of the tetrahydrofuran site is marked with a quench group, the distance between the fluorophore and the quench group is 2-4nt, and the distance between the fluorophore and the quench group is 2-4nt. According to the present invention, the multi-enzyme isothermal rapid amplification and the CRISPR / Cas12a system are combined, such that the amplification of the fluorescence detection signal is achieved, the one-tube reaction of the in vitro amplification and the CRISPR / Cas12a shearing is achieved, and the aerosol pollution is avoided;

Description

Technical Field

[0001] The present application belongs to the field of disease diagnosis technology, and in particular, relates to a probe, a detection reagent, a kit and a method of using the same for detecting PCA3 in urine, and specifically relates to the combined application of multi-enzyme isothermal rapid amplification technology and CRISPER / Cas12a in prostate cancer screening. Background Art

[0002] Prostate cancer is one of the deadliest cancers in the world and the leading cause of cancer-related death in men. The prognosis of prostate cancer patients mainly depends on the tumor stage at the time of initial diagnosis, and screening can reduce the risk of men dying from prostate cancer. Currently, prostate cancer screening is mainly based on abnormalities in serum PSA, and one of the main problems with PSA screening for prostate cancer is the lack of specificity. With the development of laboratory molecular diagnostic technology, based on in vitro amplification technology, a small amount of tumor nucleic acid markers in the early stages of the disease can be detected, which makes early screening possible.

[0003] PCA3 is a prostate-specific noncoding messenger RNA that is overexpressed in more than 90% of prostate tumors. As a nucleic acid marker, PCA3 can appear earlier in the early stages of the disease than the protein marker PSA. However, the question of whether DRE must be performed before urine PCA3 testing has not yet been resolved. DRE can increase the number of prostate markers in urine and facilitate the detection of markers. However, this process also increases the variability factor.

[0004] Multi-enzyme isothermal rapid amplification (MIRA) is a new isothermal amplification technology based on recombinase. The multi-enzyme system speeds up the reaction and improves tolerance to potential inhibitors. The amplification process of nucleic acid templates in MIRA can be completed within 10-30 minutes at room temperature. MIRA does not require a high-temperature DNA lysis process, avoiding aerosol contamination. The CRISPR / Cas system is an adaptive immune system of archaea and bacteria. The Cas12a protein can specifically recognize and shear ds DNA under the guidance of CRISPER RNA. The CRISPR / Cas12a system can also compensate for the false positive risk of in vitro amplification of negative samples, thereby improving detection specificity and accuracy. Summary of the invention

[0005] The purpose of the present application is to provide a probe, a detection reagent, a kit and a method of using the same for detecting PCA3 in urine, in order to solve the problem that whether DRE must be performed before urine PCA3 detection is currently unsolved and that DRE can increase the number of prostate markers in urine and facilitate the detection of markers, but this process will also increase the problem of variability factors.

[0006] In order to achieve the above application purpose, the technical solution adopted in this application is as follows:

[0007] In a first aspect, the present application provides a probe for detecting PCA3 in urine, wherein the nucleotide sequence of PCA3 is shown as SEQ ID NO.1;

[0008] The nucleotide sequence of the forward primer of PCA3 is shown in SEQ ID NO.2, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.3;

[0009] The nucleotide sequence of the probe is shown in SEQ ID NO.4;

[0010] A tetrahydrofuran is labeled at a position 34 nt away from the 5' end of the probe nucleotide sequence and greater than or equal to 15 nt away from the 3' end, a fluorescent group is labeled on the T base upstream of the tetrahydrofuran site, and a quencher group is labeled on the T base downstream of the tetrahydrofuran site, the distance between the fluorescent group and the quencher group is 2 to 4 nt, and a C3-spaser closed probe is labeled at the 3' end of the probe nucleotide sequence.

[0011] In the second aspect, the present application provides a detection reagent for detecting PCA3 in urine, the detection reagent comprising a probe for detecting PCA3 and Crisper RNA, the Crisper RNA comprising two parts, wherein the first part is a DR sequence for connecting to the LbCas12a protein, and the DR sequence nucleotide sequence is shown in SEQ ID NO.5; the nucleotide sequence of the second part is the same as the nucleotide sequence of the upstream part of the probe.

[0012] As a possible design, the detection reagent also includes a buffer solution and water, and the volume ratio of the forward primer, the reverse primer, the probe and the template RNA diluent is 10:10:3:25.

[0013] In a third aspect, the present application provides a kit for detecting PCA3 in urine, comprising a detection reagent.

[0014] In a fourth aspect, the present application provides a method for using a kit, comprising:

[0015] Obtain urine and obtain RNA extract;

[0016] The RNA extract is added to the kit according to claim 4, and then reacted at 37-41°C for 15-30 minutes, and then reacted at 37-39°C for 15-20 minutes. During the entire reaction process, fluorescence is collected every 25-35 seconds until the reaction is completed.

[0017] As a possible design, the RNA extract is added to the kit, and then reacted at 40°C for 25 minutes and then at 37°C for 20 minutes. During the entire reaction process, fluorescence is collected every 30 seconds until the reaction is completed.

[0018] As a possible design, the linear range of RNA detection by the kit is 100 to 0.01 ng / μL, and the determination coefficient is 0.973.

[0019] The beneficial effects of the present invention are:

[0020] The present invention combines multi-enzyme isothermal rapid amplification and CRISPR / Cas12a system to not only achieve the amplification of fluorescence detection signals, but also realizes a one-tube reaction of in vitro amplification and CRISPER / Cas12a shearing. This one-tube detection system reacts at room temperature to avoid aerosol contamination. In addition, the fluorescence detection signal of the MIRA-CRIS PER / Cas12a detection system can be observed by the naked eye under ultraviolet light. Compared with RT-qPCR, the MIRA-CRISPER / Cas12a detection system does not rely on complex mechanical equipment and has a shorter reaction time, making it more conducive to large-scale screening of prostate cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0022] Figure 1 Design of probes and CRISPER RNA (A) MIRA probe design (B) CRISPER RNA design (C) UV-visible absorption spectrum of RNA template (D) Agarose gel electrophoresis image of MIRA product (E) Specificity verification of CRISPER RNA

[0023] Figure 2 Establishment of MIRA-CRISPER / cas12a analysis system (A) Amplification curves of MIRA at different temperatures (B) Agarose gel electrophoresis images of MIRA products at different time periods (C) Effect of CRISPER / Cas12a reaction temperature on fluorescence intensity (D) Effect of CRISPER RNA and Cas12a volume on fluorescence intensity (E) Amplification curves of MIRA-CRISPER / Cas12a and traditional MIRA (F) and (G) Difference in fluorescence intensity between MIRA-CRISPER / Cas12a and traditional MIRA

[0024] Figure 3 Sensitivity and specificity analysis (A) Comparison of sensitivity between MIRA-CRISPER / Cas12a and traditional MIRA (B) Comparison of linear range between MIRA-CRISPER / Cas12a and traditional MIRA. (C) Specificity analysis of MIRA-CRISPER / Cas12a detection system (Note: NC: negative control)

[0025] Figure 4 To evaluate the diagnostic effect of PCA3 by MIRA-CRISPER / Cas 12a detection (A) MRI images of subjects with PCa (B) CDUS images of subjects with PCa (C) HE-stained pathological images and immunohistochemical staining images of prostate tissues of PCa patients (D) MRI images of subjects with PTIS (E) CDUS images of patients with prostatic hyperplasia (F) HE-stained pathological images and immunohistochemical staining images of prostate tissues of PTIS (G) Schematic diagram and results of MIRA-CRISPER / Cas12a system detection using urine without DRE of PCa and PTIS subjects (H) Fluorescence intensity detection results of PCA3 in urine without DRE of NC (n=3), PTIS (n=3) and PCa (n=5) patients (I) Serum PSA concentration of NC (n=3), PTIS (n=3) and PCa (n=5) (Note: NC: normal control). DETAILED DESCRIPTION

[0026] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present application more clearly understood, the present application is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application and are not used to limit the present application.

[0027] Example 1

[0028] (1) Obtain a conserved sequence of PCA3, the nucleotide sequence of which is shown in SEQ ID NO. 1: TA TTTTTATTGCTGACTTTTAAAATAAGTGATTCGGGGGGTGGGAGAACAGGGGAGGGAGAGCATTAGGACAAATACCTAATGCATGTGGGACTTAAAACCTAGATGATGGGTTGATAGGTGCAGCAAACCACTATGGCACACGTATACCTGTGTAACAAACCTACACATTCTGCACATGTATCCCAGAACGTAAAGTAAAATTTAAAAAAAAGTGA. The NCBI reference sequence is NR_015342.2 (3541-3757).

[0029] (2) Based on the above PCA3 conservative sequence, a pair of PCA3 primers and a pair of GA PDH primers were screened from the literature, from KPPHtoo, V. Yamkamon, S. Yainoy, T. Suksrichavalit, W. Viseshsindh, W. Eiamphungporn, Colorimetric detection of PCA3 in urine for prostate cancer diagnosis using thiol-labeled PCR primer and unmodified gold nanoparticles, Clinica Chimica Acta. 488 (2019) 40–49. https: / / doi.org / 10.1016 / j.cca.2018.10.036 That is, the specific PCA3 primer and GAPDH primer are SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.6 and SEQ ID NO.7.

[0030] (3) Based on the primer information, the probe sequence was designed using Primer Express 3.0.1 software and then aligned by NCBI. The nucleotide sequence of the probe is shown in SEQ ID NO.4. According to the MIRA probe design principle, a tetrahydrofuran (THF) was marked as a recognition site for the exonuclease at a position 34 nt away from the 5' end and greater than or equal to 15 nt away from the 3' end of the probe. A fluorescent group was marked on the T base upstream of the THF site, and a quenching group was marked on the T base downstream of the THF site, so that the distance between the two groups was 2 to 4 nt. Finally, a C3-spaser was marked at the 3' end to block the probe to avoid causing an extension reaction ( Figure 1 A).

[0031] (4) Crisper RNA consists of two parts, one part is the DR sequence of LbCas12a protein, the nucleotides of the DR sequence are shown in SEQ ID NO.5, and the DR sequence plays a role in connecting LbCas12a protein and Crisper RNA. The other part of the sequence is almost identical to the upstream part of the fluorescent probe sequence, which enables it to guide Cas 12a protein to hydrolyze the fluorescent probe that is complementary to the target fragment and does not hydrolyze the free probe in the system ( Figure 1 B).

[0032] (5) Results: The UV absorption spectrum of the RNA template showed a high absorption peak at 260 nm, and the A260 / A280 ratio was 2.16, indicating that it was pure RNA (( Figure 1 C). Agarose gel electrophoresis of MIRA products showed only one target band without any primer dimers ( Figure 1 D). These results indicate that crRNA enables LbCas12a protein to hydrolyze probes that are complementary to the target fragment only, rather than free probes in the system ( Figure 1 E).

[0033] Table 1

[0034]

[0035] Example 2

[0036] Constructing a one-tube detection system for MIRA-CRISPER / Cas12a

[0037] (1) MIRA condition optimization: 50 μL MIRA system includes: AbTffer (buffer) 29.4 μL, Forward primer (forward primer) 2 μL, Reserve primer (reverse primer) 2 μL, Probe (probe) 0.6 μL, template RNA diluent 5 μL, ddHO 2O 8.5μL, B bTffer 2.5μL, wherein AbTffer contains various enzymes required for the reaction. B bTffer is an activator of AbTffer. In order to make the multi-porous reaction system proceed simultaneously, it can be achieved by adding B bTffer at the same time at the end. AbTffer and B bTffer are common buffers in the field and are not elaborated in detail here. First, the temperature is optimized within the MIRA reaction temperature range, and the reaction is carried out at 37°C, 38°C, 39°C, 40°C, and 41°C for 25 minutes. Then the reaction time is optimized, and the reaction is carried out at the optimal reaction temperature for 5 minutes, 10 minutes, 15 minutes, 20 minutes, 25 minutes, 30 minutes, 35 minutes, and 40 minutes. After that, the amplified product is heated in a water bath at 100°C for 5 minutes to denature the single-stranded binding protein, and then proteinase k is added to digest the single-stranded binding protein. Centrifuge for 5 minutes, and take the supernatant for 1.2% agarose gel electrophoresis.

[0038] (2) Optimization of Crisper / cas12a conditions: First, prepare Tag DNA by MIRA reaction without adding probe. 50μL MIRA system includes: AbTffer 29.4μL, Forwardprimer 2μL, Reserve primer 2μL, template RNA diluent 5μL, 9.1μL ddH 2 O, B bTffer 2.5μL. Considering that the working temperature range of the enzymes related to the MIRA system is smaller than that of the enzymes related to Crisper / cas12a, in order to achieve the purpose of one-tube reaction, we will screen out the optimal reaction temperature of Crisper / cas12a reaction at 37℃, 38℃, 39℃, 40℃, and 41℃. The 20-μL Crisper / cas12a system includes: 2μL 10×HOLMES BTffer 1, 0.5μL 10μM LbCas12aNTclease, 0.5μL 10μM Crisper RNA, 5μLTag DNA, 0.5μLProbe, 11.5μLddH 2 O. The reaction was carried out at different temperatures for 25 min.

[0039] After determining the optimal reaction temperature, the Crisper RNA volume was optimized first according to the working concentration range of Crisper RNA and Cas12a. The Crisper / cas12a system includes: 2 μL 10×HOLMES BTffer, 0.5 μL 10 μM LbCas12aNTclease, N μL 10 μM Crisper RNA (N = 0.1 μL, 0.2 μL, 0.3 μL, 0.4 μL, 0.5 μL), 5 μL Tag DNA, 0.5 μL Probe, ddH 2 O to make up the system volume to 20 μL. . Secondly, the volume of LbCas12a NTclease was optimized. The Crisper / cas12a system included: 2 μL 10×HOLMES BTffer, 0.5 μL 10 μM Crisper RNA, N μL 10 μM LbCas12a NTclease (N = 0.1 μL, 0.2 μL, 0.3 μL, 0.4 μL, 0.5 μL), 5 μL Tag DNA, 0.5 μL Probe, ddH 2 O to make up the volume of the system to 20 μL. The above system was reacted at the optimal temperature for 20 minutes, and the experiment was repeated 3 times.

[0040] (3) Establish a MIRA-Crisper / Cas12a one-tube reaction system. The 50-μL MIRA-Crisper / cas12a system includes: 29.4 μL AbTffer, 2 μL Forward primer, 2 μL Reserve primer, 1 μL Probe, 5 μL 10×HOLMES BTffer 1, 1.2 μL 10 μM LbCas12a NTclease, 1.2 μL 10 μM Crisper RNA, 5 μL template RNA dilution solution (dd H 2 O instead of template RNA as negative control), 0.7 μL ddHO 2 O, 2.5 μL B bTffer. 50-μL MIRA system includes 29.4 μL A bTffer, 2 μL Forward primer, 2 μL Reserve primer, 1 μL Probe, 5 μL template RNA dilution solution, 8.1 μL ddH 2O, 2.5 μL B bTffer. First react at the optimal temperature (40°C) of MIRA-related enzymes for 25 minutes, and then react at the optimal temperature (37°C) of Crisper / Cas12a-related enzymes for 20 minutes. Fluorescence was collected every 30 seconds during the whole process. According to the maximum fluorescence intensity at the end of the reaction, the differences between the MIRA-Crisper / Cas12a detection system and the conventional MIRA detection system were analyzed and compared.

[0041] (4) Results: The amplification curve of traditional MIRA showed that as the temperature increased, the efficiency of MIRA-related enzymes first increased and then decreased. The efficiency was highest at 40°C ( Figure 2 A). Agarose gel electrophoresis of the MIRA reaction product showed that the band intensity no longer increased after 25 minutes of reaction ( Figure 2 B). For the CRISPR / Cas12a system, the optimal reaction temperature is 37°C ( Figure 2 C). When the volumes of CrRNA and LbCas12a were both 0.5 μL, the fluorescence intensity of the 20-μL CRISPR / Cas12a system was the highest ( Figure 2 D). When analyzing the same samples, MIRA-Crisper / Cas12a outperformed the traditional MIRA system, indicating that MIRA-CRISPR / Cas12a can amplify the detection signal ( Figure 2 E). Paired t-test analysis results showed that the fluorescence intensity detected by traditional MIRA and MIRA-CRISPR / Cas12a was significantly different (P<0.05) ( Figure 2 GH).

[0042] Example 3

[0043] (1) A series of samples with different concentrations were obtained by diluting the RNA template solution. They were then evaluated using the traditional MIRA and MIRA-CRISPR / Cas12a detection systems. The experiment was repeated three times, and the effectiveness of the two methods was evaluated using the linear range and correlation coefficient. Next, RNA samples were extracted from different cancer cells (HTH-7, MDA-MB-231, STM-159, and GL-261). MIRA-CRISPR / Cas12a was used for detection, and ddH 2 O was used as negative control. The results were observed under ultraviolet light.

[0044] (2) Results: In the analysis of gradient concentration RNA template solutions, the results showed that the linear range of the MIRA-CRISPR / Cas12a detection system was greater than that of the traditional MIRA detection method. The linear range of MIRA-CRISPR / Cas12a detection of RNA was 100 to 0.01 ng / μL, with a determination coefficient of 0.973; while the linear range of traditional MIRA detection of RNA was 100 to 0.1 ng / μL, with a determination coefficient of 0.932 ( Figure 3 AB). Specificity validation of MIRA-CRISPR / Cas12a showed that no specific signal was detected in HTH-7, MDA-MB-231, STM-159, and GL-261 cells ( Figure 3 C).

[0045] Example 5

[0046] Analysis of clinical samples using the MIRA-CRISPER / Cas12a detection system

[0047] (1) This study was approved by the Medical Ethics Committee of the 416th Hospital of Nuclear Industry [No.: YJ-2023-010] and was conducted in accordance with the standards of the 1964 Declaration of Helsinki and relevant Chinese policies. After obtaining written informed consent, two subjects with serum PSA>4 ng / mL underwent MRI, CDTS, and CDTS-guided prostate puncture biopsy at the 416th Hospital of Nuclear Industry (Chengdu, China) in March 2024. At the same time, their urine samples were also collected for analysis using the MIRA-CRISPR / Cas12a system. The collected urine (50 mL) was centrifuged at 13400g and 4℃ for 20 min. After discarding the supernatant, 1 mL of TRIzol reagent was added to the urine precipitate, which was then stored at -80℃ until RNA extraction. RNA was extracted using the conventional Trizol method. GAPDH was used as an internal reference gene. ddH 2 O and synthetic RNA were used as templates for negative and positive controls, respectively. PCA3 in urine was detected using the MIRA-CRISPR / Cas12a detection system. Prostate biopsy was considered the gold standard when comparing the results.

[0048] (2) Results: In one of the two patients with elevated serum PSA, MRI showed nodular abnormal signals in the prostate transition zone and multiple abnormal signals in the sacral vertebrae ( Figure 4 A). Therefore, the patient was initially diagnosed with PCa with multiple bone metastases. In addition, the patient's CDTS test results showed multiple abnormal signals ( Figure 4B). Hematoxylin-eosin (HE) staining of prostate tissue showed abnormal cell loss, negative CK (HMW) result (indicating the absence of basal cells), and positive result for the prostate cancer-specific marker p504s ( Figure 4 C). The patient was eventually diagnosed with prostate cancer. At the same time, another patient's MRI showed multiple nodular abnormal signals ( Figure 4 D), CDTS also showed abnormal signals ( Figure 4 E). In addition, HE staining of pathological tissues did not reveal abnormal cells, but CK (HMW) and p63 staining showed the presence of basal cells ( Figure 4 F). These results are consistent with the diagnosis of prostatitis (PTIS). The MIRA-CRISPR / Cas12a assay showed a difference in fluorescence intensity between the DRE-free urine collected from the two patients. This difference can be observed with the naked eye under ultraviolet light ( Figure 4 G). Next, MIRA-CRISPR / Cas12a was used to detect PCA3 in NC (n=3), PTIS (n=3), and PCa (n=5). The results showed that PCA3 had a sensitivity of 60% and a specificity of 83.3% in PCa screening (Table 2, Figure 4 F). However, for serum PSA>4 ng / mL, the specificity was only 33.3% (2 / 6) ( Figure 4 I).

[0049] Table 2 Diagnostic efficacy of MIRA-Crisper / Cas12a

[0050]

[0051] The above description is only a preferred embodiment of the present application and is not intended to limit the present application. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present application should be included in the protection scope of the present application.

Claims

1. A probe for detecting PCA3 in urine, characterized in that: The nucleotide sequence of PCA3 is shown in SEQ ID NO.1; The nucleotide sequence of the forward primer of PCA3 is shown in SEQ ID NO.2, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.3; The nucleotide sequence of the probe is shown in SEQ ID NO.4; A tetrahydrofuran is labeled at a position 34 nt away from the 5' end of the probe nucleotide sequence and greater than or equal to 15 nt away from the 3' end, a fluorescent group is labeled on the T base upstream of the tetrahydrofuran site, and a quencher group is labeled on the T base downstream of the tetrahydrofuran site, the distance between the fluorescent group and the quencher group is 2 to 4 nt, and a C3-spaser closed probe is labeled at the 3' end of the probe nucleotide sequence.

2. A detection reagent for detecting PCA3 in urine, characterized in that: The detection reagent includes a probe for detecting PCA3 according to claim 1 and Crisper RNA, wherein the Crisper RNA includes two parts, wherein the first part is a DR sequence for connecting to the LbCas12a protein, and the DR sequence nucleotide sequence is shown in SEQ ID NO.5; the nucleotide sequence of the second part is the same as the nucleotide sequence of the upstream part of the probe.

3. The detection reagent according to claim 2, characterized in that The detection reagent also includes a buffer and water, and the volume ratio of the forward primer, the reverse primer, the probe and the template RNA diluent is 10:10:3:

25.

4. A kit for detecting PCA3 in urine, characterized in that: The kit comprises the detection reagent according to claim 2 or 3.

5. Use of the kit according to claim 4 in urine drug detection.

6. Use of the kit according to claim 4 in detecting drugs in the urine of cancer patients.

7. Use of the kit according to claim 4 in drugs for detecting prostate cancer.

8. A method for using the kit according to claim 4, characterized in that: The method of use includes: Obtain urine and obtain RNA extract; The RNA extract is added to the kit according to claim 4, and then reacted at 37-41°C for 15-30 minutes, and then reacted at 37-39°C for 15-20 minutes. During the entire reaction process, fluorescence is collected every 25-35 seconds until the reaction is completed.

9. The method of use according to claim 8, characterized in that: The RNA extract is added to the kit according to claim 4, and then reacted at 40°C for 25 minutes, and then reacted at 37°C for 20 minutes. During the entire reaction process, fluorescence is collected every 30 seconds until the reaction is completed.

10. The method of use according to claim 8, characterized in that: The linear range of RNA detection by the kit is 100 to 0.01 ng / μL, and the determination coefficient is 0.973.

Images