Recombinant angiotensin-converting enzyme inhibitory peptide, recombinant strain, preparation method and application thereof

Abstract

The present invention discloses a recombinant angiotensin-converting enzyme inhibitory peptide, a recombinant strain, a preparation method and its application, and belongs to the field of genetic engineering and active peptide technology. The present invention discloses a recombinant angiotensin-converting enzyme inhibitory peptide with an amino acid sequence of YWLKP. The recombinant angiotensin-converting enzyme inhibitory peptide YWLKP disclosed in the present invention has a significantly improved inhibitory activity against ACE compared to the original inhibitory peptide LYPVK, IC 50 The value decreased from 10.6±0.86 μg / mL to 5.0±0.62 μg / mL. The recombinant angiotensin-converting enzyme inhibitory peptide YWLKP disclosed in the present invention has strong intracellular blood pressure lowering activity, which is conducive to its application in the development of products with blood pressure lowering efficacy.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering and active peptide technology, and more particularly to a recombinant angiotensin converting enzyme inhibitory peptide, a recombinant strain, a preparation method and applications thereof. Background Art

[0002] Hypertension is the most common chronic disease, and its prevention, treatment, and improvement are important tasks related to human life and health. Angiotensin-converting enzyme (ACE) is a key enzyme involved in the body's blood pressure regulation system. It can promote the production of angiotensin II and the degradation of bradykinin, thereby increasing blood pressure. ACE inhibitors such as captopril and enalapril can significantly lower blood pressure and are currently the main treatment method. However, long-term medication can cause certain side effects on the human body. The discovery of safe and green ACE targeted inhibitors is a current research hotspot. ACE inhibitory peptides are bioactive peptides that are widely derived from food, act on ACE, and have the effect of lowering blood pressure. In recent years, their preparation, structural characterization, activity evaluation, and mechanism of action have attracted much attention.

[0003] Currently, ACE inhibitory peptides are primarily prepared by enzymatic hydrolysis of protein raw materials such as soybeans, oysters, and milk, followed by isolation, purification, and characterization. While production costs are low, the target product yield is low, activity is low, and isolation and purification are difficult and time-consuming. Furthermore, the enzymatic hydrolysis products are mixtures with complex active components, making it difficult to precisely elucidate the blood pressure-lowering mechanism of ACE inhibitory peptides. For example, the ACE inhibitory peptide VGLFPSRSF was prepared from tilapia skin using alkaline protease hydrolysis. Its IC50 for ACE inhibition was 61.43 μM, and the prepared product had a low concentration, making it difficult to scalably prepare high-purity inhibitory peptide products from protein raw materials using enzymatic hydrolysis. However, the use of microorganisms for heterologous expression of recombinant proteins is a growing technology that can generate target products, is simple to operate, easily regulated, and readily scalable for large-scale production, offering broad application prospects.

[0004] Therefore, providing a recombinant angiotensin-converting enzyme inhibitory peptide, a recombinant strain, a preparation method and applications thereof is an urgent problem to be solved by those skilled in the art. Summary of the Invention

[0005] In view of this, the present invention provides a recombinant angiotensin-converting enzyme inhibitory peptide, a recombinant strain, a preparation method and applications thereof.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions:

[0007] A recombinant angiotensin-converting enzyme inhibitory peptide, wherein the amino acid sequence of the recombinant angiotensin-converting enzyme inhibitory peptide is YWLKP.

[0008] The present invention is based on the original ACE inhibitory peptide LYPVK amino acid sequence, adopts the idea that molecular weight, hydrophobic residues, amino acid sequence distribution, arrangement and the type of amino acid residues at the end of the sequence will affect the inhibitory activity of the ACE peptide, and rationally designs its original amino acid sequence to obtain the amino acid sequence of the ACE inhibitory peptide with enhanced ACE inhibitory activity. The ACE inhibitory peptide is prepared by genetic engineering methods to further verify its ACE inhibitory activity. The intracellular hypotensive effects of the two ACE inhibitory peptides are verified and compared, and the changes in the levels of intracellular blood pressure-related products after the two ACE inhibitory peptides are analyzed to explore the intracellular hypotensive efficacy.

[0009] The larger the molecular weight of an ACE inhibitory peptide, the less likely it is to enter the active center of ACE, and the lower its ACE inhibitory activity. Furthermore, based on the amino acid composition of the ACE active center, the hydrophobic amino acids, lysine, and proline at the end of the ACE inhibitory peptide are more likely to interact with ACE, thereby further inhibiting ACE activity. Therefore, adopting the above approach to rationally design ACE inhibitory peptides and developing new ACE inhibitory peptides is beneficial for improving their ACE inhibitory activity.

[0010] Furthermore, a recombinant expression vector is provided, comprising multiple copies of the recombinant angiotensin-converting enzyme inhibitory peptide YWLKP gene SEQ ID NO.1.

[0011] CATCATCATCATCATCATGATGATGACGATAAGTACTGGTTGAAACCCTATTGGTTAAAGCCTTACTGGCTTAAGCCATACTGGTTGAAACCCTATTGGTTAAAGCCTTACTGGCTTAAGCCATACTGGTTGAAACCCTATTGGTTAAAGCCTTACTGGCTTAAGCCA SEQ ID NO.1.

[0012] In SEQ ID NO. 1, 1-18 bp are His-tag, 19-33 bp are enterokinase tag, and 34-333 bp are YWLKP tandem coding gene.

[0013] Furthermore, a recombinant Escherichia coli strain is capable of expressing the recombinant angiotensin-converting enzyme inhibitory peptide YWLKP.

[0014] Furthermore, the method for preparing a recombinant angiotensin-converting enzyme inhibitory peptide comprises tandemly connecting multiple copies of the inhibitory peptide encoding gene using codon degeneracy, heterologously expressing the tandem peptide in Escherichia coli, and obtaining the recombinant angiotensin-converting enzyme inhibitory peptide YWLKP after purification and proline endonuclease-specific enzymatic cleavage.

[0015] Furthermore, the recombinant angiotensin converting enzyme inhibitory peptide is used in the preparation of angiotensin converting enzyme inhibitors.

[0016] Furthermore, the recombinant angiotensin-converting enzyme inhibitory peptide is used in the preparation of blood pressure lowering drugs.

[0017] Furthermore, an angiotensin converting enzyme inhibitor comprises the recombinant angiotensin converting enzyme inhibitory peptide as an active ingredient.

[0018] Furthermore, a blood pressure lowering pharmaceutical composition comprises the recombinant angiotensin converting enzyme inhibitory peptide.

[0019] Furthermore, a blood pressure lowering pharmaceutical preparation includes the recombinant angiotensin-converting enzyme inhibitory peptide or the blood pressure lowering pharmaceutical composition, and also includes a pharmaceutically acceptable carrier.

[0020] Furthermore, the pharmaceutically acceptable carrier is suitable for tablets, capsules, powders, pills, granules, oral solutions, injections or emulsions.

[0021] Through the above technical solutions, it can be seen that compared with the prior art, the present invention discloses a recombinant angiotensin-converting enzyme inhibitory peptide, a recombinant strain, a preparation method and its application. The inhibitory activity of the recombinant ACE inhibitory peptide YWLKP on ACE is improved compared with the original inhibitory peptide LYPVK. 50 The value decreased from 10.6 ± 0.86 μg / mL to 5.0 ± 0.62 μg / mL. Further cell experiments confirmed that the intracellular antihypertensive efficacy of the recombinant ACE inhibitory peptide YWLKP was improved compared to the original inhibitory peptide LYPVK, with increased NO content and decreased ET-1 content. The recombinant ACE inhibitory peptide YWLKP of the present invention is beneficial for its application in the development of products with antihypertensive efficacy. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.

[0023] Figure 1 This is an amino acid comparison chart of the recombinant ACE inhibitory peptide YWLKP and the original ACE inhibitory peptide LYPVK.

[0024] Figure 2 This is a map of the recombinant expression vector of the recombinant ACE inhibitory peptide YWLKP.

[0025] Figure 3 The protein electrophoresis diagram and purified protein electrophoresis diagram of the tandemly copied recombinant ACE inhibitory peptide YWLKP; where A: protein electrophoresis diagram; M: protein marker; 1-4: cell fragmentation supernatant after fermentation of single colonies of different transformants; 5-6: cell fragmentation supernatant after fermentation of single colonies of different transformants in the empty state; B: purified protein electrophoresis diagram; M: protein marker; 1: purified protein.

[0026] Figure 4 This is the HPLC molecular weight determination diagram of the tandem copy recombinant ACE inhibitory peptide YWLKP.

[0027] Figure 5 This is the HPLC molecular weight determination chart of the recombinant ACE inhibitory peptide YWLKP.

[0028] Figure 6 This is the mass spectrum of the recombinant ACE inhibitory peptide YWLKP.

[0029] Figure 7 IC of ACE inhibition by recombinant ACE inhibitory peptide YWLKP and original ACE inhibitory peptide LYPVK 50 value.

[0030] Figure 8 It is the cytotoxicity of the recombinant ACE inhibitory peptide YWLKP and the original ACE inhibitory peptide LYPVK.

[0031] Figure 9 It is the intracellular NO content of the recombinant ACE inhibitory peptide YWLKP and the original ACE inhibitory peptide LYPVK.

[0032] Figure 10 It is the intracellular ET-1 content of the recombinant ACE inhibitory peptide YWLKP and the original ACE inhibitory peptide LYPVK. DETAILED DESCRIPTION

[0033] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0034] Example 1 Rational Design of ACE Inhibitory Peptides

[0035] The original ACE inhibitory peptide LYPVK (SEQ ID NO.3) was rationally designed to obtain the amino acid sequences of two inhibitory peptides as follows Figure 1 As shown, the sequence of the recombinant ACE inhibitory peptide of the present invention is YWLKP (SEQ ID NO. 4).

[0036] Example 2 Construction of recombinant expression vector of recombinant ACE inhibitory peptide YWLKP

[0037] Codon degeneracy was utilized to obtain the recombinant ACE inhibitory peptide YWLKP encoding gene (as shown in SEQ ID NO.1, bp 34-333). A gene sequence containing a His-tag, an enterokinase tag, and multiple copies of the YWLKP encoding gene in tandem was artificially synthesized (as shown in SEQ ID NO.1). The artificially synthesized gene sequence was ligated into the Escherichia coli expression vector pET28a(+) via NotI (GCGGCCGC, C-terminus) and EcoRI (GAATTC, N-terminus) to construct the recombinant expression vector YWLKP20-pET28a(+). A map of the recombinant expression vector is shown in Figure 2 , including a vector backbone, a His-tag, an enterokinase tag, and multiple copies of tandem peptide genes.

[0038] Example 3 Heterologous Expression and Purification of Tandem Recombinant ACE Inhibitory Peptide YWLKP

[0039] A recombinant expression vector containing multiple copies of the gene encoding the tandemly recombinant ACE inhibitory peptide YWLKP was transformed into Escherichia coli BL21. Positive transformants were screened for further fermentation expression. Fermentation conditions were 37°C and 180 rpm for 24 hours. The fermentation temperature was then adjusted to 20°C and IPTG was added for induction at a final concentration of 1 mM. Fermentation was continued for another 24 hours. The fermentation product was the expressed tandemly recombinant ACE inhibitory peptide YWLKP.

[0040] The fermentation product was centrifuged, the supernatant was removed, and the cells were collected. The collected cells were then disrupted and the supernatant was collected. Protein electrophoresis was performed on the collected samples. The results were as follows: Figure 3As shown in Figure A, compared with the empty fermentation sample (transformed with pET28a(+)), the transformant sample of the multi-copy tandem recombinant ACE inhibitory peptide YWLKP contained an additional single band between 11-17 kDa, which is almost consistent with the theoretical molecular weight of the multi-copy tandem recombinant ACE inhibitory peptide YWLKP (15.1 kDa).

[0041] The His-tag in the expressed product was further purified using nickel magnetic beads, and the collected samples were detected by protein electrophoresis. Figure 3 As shown in Figure B, the purified sample contained a single band between 11 and 17 kDa (molecular weight of 15.1 kDa), indicating that multiple copies of the tandem recombinant ACE inhibitory peptide YWLKP were successfully expressed and purified.

[0042] The molecular weight of the purified multi-copy tandem recombinant ACE inhibitory peptide YWLKP was further verified using HPLC. Figure 4 As shown, the sample has a single peak, and the peak time corresponds to the molecular weight (15.1 kDa), further demonstrating that the multi-copy tandem recombinant ACE inhibitory peptide YWLKP was successfully expressed and purified.

[0043] Example 4 Preparation of recombinant ACE inhibitory peptide YWLKP by specific enzymatic cleavage

[0044] Purified multi-copy tandem recombinant ACE inhibitory peptide YWLKP was digested with enterokinase (Sigma) at 37°C for 3 hours to remove the histidine tag contained in the expressed product. The product had a molecular weight of 13.7 kDa. The digested product was further specifically digested with proline endonuclease (Sigma) at 37°C for 12 hours. The digested product is the recombinant ACE inhibitory peptide YWLKP.

[0045] The prepared recombinant ACE inhibitory peptide YWLKP was subjected to HPLC molecular weight determination to confirm the accuracy of the prepared product. The results are as follows Figure 5 As shown in the figure, the sample has a single peak, and the peak time corresponds to the molecular weight (705.4 Da), indicating that the recombinant ACE inhibitory peptide YWLKP was successfully prepared.

[0046] The prepared recombinant ACE inhibitory peptide YWLKP was subjected to mass spectrometry analysis to further confirm the accuracy of the molecular weight of the prepared target product. Figure 6 As shown in the figure, the molecular weight of the sample is 705.4 Da, and the detected molecular weight is consistent with the theoretical molecular weight, indicating that the enzymatic cleavage product after specific enzymatic cleavage is the recombinant ACE inhibitory peptide YWLKP.

[0047] Example 5 Determination of ACE Inhibitory Activity of Recombinant ACE Inhibitory Peptide YWLKP

[0048] The ACE inhibitory activity of the recombinant ACE inhibitory peptide YWLKP and the original ACE inhibitory peptide LYPVK was determined using a visible spectrophotometer in a 96-well plate.

[0049] 1 mM N-[3-(2-furyl)acryloyl]-L-phenylalanylglycylglycine (FAPGG), 100 mL HEPES buffer (1.901 g HEPES reagent, 1.755 g NaCl reagent, pH 8.3), and 0.1 U / mL angiotensin-converting enzyme (ACE) were prepared respectively.

[0050] To a 96-well plate, 40 μL of recombinant ACE inhibitory peptide YWLKP or original ACE inhibitory peptide LYPVK samples at varying concentrations, along with 40 μL of 1 mM FAPGG substrate and 10 μL of 0.1 U / mL ACE, were added sequentially. The final concentrations of recombinant ACE inhibitory peptide YWLKP or original ACE inhibitory peptide LYPVK were 2.5, 5, 10, and 20 μg / mL. The absorbance of the mixed system at 340 nm was measured using a microplate reader. The system was incubated on a shaker at 37°C for 30 min. After the reaction, the absorbance at 340 nm was again measured using a microplate reader. The ACE inhibition rate of the sample was determined by calculating the change in absorbance before and after the reaction. HEPES buffer (40 μL) was used as a blank control.

[0051] The calculation formula is: ACE inhibition rate % = 1-change in sample absorbance value / change in blank absorbance value. IC of ACE inhibitory peptide 50 The value is the ACE inhibitory peptide concentration when the inhibition rate of ACE is 50%.

[0052] The preparation method of the original ACE inhibitory peptide LYPVK is the same as that of the recombinant ACE inhibitory peptide YWLKP. The multi-copy gene of the original ACE inhibitory peptide LYPVK is shown in SEQ ID NO.2.

[0053] CATCATCATCATCATCATGATGATGACGATAAGCTGTATCCAGTAAAATTATACCCGGTCAAGTTGTATCCTGTTAAACTGTATCCAGTAAAATTATACCCGGTCAAGTTGTATCCTGTTAAACTGTATCCAGTAAAATTATACCCGGTCAAGTTGTATCCTGTTAAA CTGTATTCCAGTAAAATTATACCCGGTCAAGTTGTATCCTGTTAAACTGTATCCAGTAAAATTATACCCGGTCAAGTTGTATCCTGTTAAACTGTATCCAGTAAAATTATACCCGGTCAAGTTGTATCCTGTTAAACTGTATCCAGTAAAATTATACCCGGTCAAG; SEQ ID NO.2.

[0054] In SEQ ID NO. 2, 1-18 bp are His-tag, 19-33 bp are enterokinase tag, and 34-333 bp are LYPVK tandem coding gene.

[0055] The results are as follows Figure 7 As shown, the IC of ACE inhibition by recombinant ACE inhibitory peptide YWLKP 50 The value was 5.0 ± 0.62 μg / mL, while the IC of the original ACE inhibitory peptide LYPVK for ACE inhibition was 50 The value was 10.6 ± 0.86 μg / mL, indicating that the ACE inhibitory activity of the recombinant ACE inhibitory peptide YWLKP was enhanced.

[0056] Example 6 Study on the intracellular hypotensive effect of recombinant ACE inhibitory peptide YWLKP

[0057] Human umbilical vein endothelial cells (EA.hy926) were used as the study subjects to investigate the intracellular hypotensive effects of the recombinant ACE inhibitory peptide YWLKP and the original ACE inhibitory peptide LYPVK. First, the cytotoxicity of the two inhibitory peptide samples was determined. Specifically, the cells were diluted to prepare a cell suspension. The cells to be used were washed with PBS, trypsinized, and removed from the culture flask. The suspension was then reconstituted with complete culture medium and counted using a hemocytometer. The cells were diluted with complete culture medium to 2000 cells / well, plated onto a 96-well plate, and incubated in an incubator for approximately 24 hours until adherent and confluent. The supernatant from each well was aspirated, and 100 μL of PBS was added to each well for washing, which was then aspirated again. The samples were diluted in FBS-free culture medium (DMEM-H + 1% P / S, purchased from Gibco). The samples were weighed in advance, diluted to different concentrations in a clean hood, and sterilized by microfiltration. 100 μL of the diluted sample was added to each well and incubated in an incubator for approximately 24 hours. Remove the supernatant from each well using a pipette, add 100 μL of PBS to each well for washing, and remove again using a pipette. Prepare CCK in FBS-free culture medium (i.e., DMEM-H + 1% P / S) (ratio: 90 μL culture medium + 10 μL CCK). Add 100 μL of CCK-containing culture medium to each well, incubate in an incubator, and measure absorbance at 450 nm using a microplate reader. Calculate cell viability after treatment with the inhibitory peptide using the cell viability formula.

[0058] The results are as follows Figure 8 As shown, both the recombinant ACE inhibitory peptide YWLKP and the original inhibitory peptide LYPVK of the present invention are non-cytotoxic. Cell viability is greater than 90% at concentrations between 2.5 and 40 μg / mL, demonstrating that both inhibitory peptides exhibit no endothelial cell toxicity at concentrations where they effectively inhibit ACE. The antihypertensive drug captopril (10 μg / mL) served as a positive control. The control was a negative control.

[0059] Intracellular NO and ET-1 levels are important markers of blood pressure. Whether these levels change in response to ACE inhibitory peptides is a key indicator for evaluating intracellular antihypertensive efficacy. The antihypertensive efficacy of these two inhibitory peptides was investigated by measuring NO and ET-1 (endothelin-1) levels released by human umbilical vein endothelial cells EA.hy926 after treatment with the recombinant ACE inhibitory peptide YWLKP and the native inhibitory peptide LYPVK. The antihypertensive drug captopril (10 µg / mL) was used as a positive control. NO and ET-1 detection kits were used for detection.

[0060] The results of intracellular NO content were as follows Figure 9As shown, after the action of the two inhibitory peptides, both peptides increased the amount of NO released into the cells compared to the negative control (Control). At the same concentration of the two inhibitory peptides, the recombinant ACE inhibitory peptide YWLKP of the present invention released more NO than the original inhibitory peptide LYPVK, indicating that the recombinant ACE inhibitory peptide YWLKP of the present invention has a stronger antihypertensive effect on cells.

[0061] The results of intracellular ET-1 content are as follows Figure 10 As shown, compared with the negative control, both peptides can reduce the amount of ET-1 released into cells. Under the same concentration treatment of the two inhibitory peptides, the ET-1 content of cells treated with the recombinant ACE inhibitory peptide YWLKP of the present invention is lower than that of the original inhibitory peptide LYPVK, indicating that the recombinant ACE inhibitory peptide YWLKP of the present invention has a stronger antihypertensive effect on cells.

[0062] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is intended to conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A recombinant angiotensin-converting enzyme inhibitory peptide, characterized in that: The amino acid sequence of the recombinant angiotensin-converting enzyme inhibitory peptide is YWLKP.

2. A recombinant expression vector, characterized in that: A multi-copy gene containing the recombinant angiotensin-converting enzyme inhibitory peptide YWLKP according to claim 1, SEQ ID NO.

1.

3. A recombinant Escherichia coli strain, characterized in that The invention can express the recombinant angiotensin-converting enzyme inhibitory peptide YWLKP according to claim 1.

4. The method for preparing a recombinant angiotensin-converting enzyme inhibitory peptide according to claim 1, characterized in that: The inhibitory peptide encoding gene was concatenated in multiple copies using codon degeneracy, and the concatenated peptide was heterologously expressed in Escherichia coli. After purification and proline endonuclease-specific enzymatic digestion, the recombinant angiotensin converting enzyme inhibitory peptide YWLKP was obtained.

5. Use of the recombinant angiotensin-converting enzyme inhibitory peptide according to claim 1 in the preparation of antihypertensive drugs.

6. An angiotensin-converting enzyme inhibitor, characterized in that The invention comprises the recombinant angiotensin converting enzyme inhibitory peptide according to claim 1 as an active ingredient.

7. A pharmaceutical composition for lowering blood pressure, characterized in that: The invention comprises the recombinant angiotensin-converting enzyme inhibitory peptide according to claim 1.

8. A pharmaceutical preparation for lowering blood pressure, characterized in that: A pharmaceutical composition comprising the recombinant angiotensin-converting enzyme inhibitory peptide according to claim 1 or the blood pressure lowering pharmaceutical composition according to claim 7, and also comprising a pharmaceutically acceptable carrier.

9. The blood pressure lowering pharmaceutical preparation according to claim 8, characterized in that: The pharmaceutically acceptable carrier is suitable for tablets, capsules, powders, pills, granules, oral liquids, injections or emulsions.

Images