AAV capsid protein variants and uses thereof

Abstract

The present invention relates to adeno-associated virus (AAV) capsid protein variants, isolated nucleic acid molecules encoding the same, recombinant adeno-associated virus vectors having the AAV capsid protein variants and their use in the treatment and prevention of myopathies (e.g., myocardial and / or skeletal muscle diseases).

Description

Technical Field

[0001] The present invention relates to the field of gene therapy of recombinant adeno-associated virus vectors. Specifically, the present invention relates to adeno-associated virus (AAV) capsid protein variants, isolated nucleic acid molecules encoding the same, recombinant adeno-associated virus vectors having the AAV capsid protein variants, and their use in the treatment and prevention of myopathy (e.g., myocardial and / or skeletal muscle diseases). Background Art

[0002] Adeno-associated virus (AAV) is a single-stranded DNA virus belonging to the genus Dependoviridae of the parvoviridae family. By designing a synthetic recombinant AAV vector (rAAV), the target gene can be transported and delivered to the target cell. In recent years, AAV vectors have occupied a very important position in the research of gene therapy (Naso MF, Tomkowicz B, Perry WL 3rd, Strohl WR. Adeno-Associated Virus (AAV) as a Vector for Gene Therapy. BioDrugs. 2017; 31 (4): 317-334.). However, wild-type AAV lacks targeting and cannot effectively infect target tissue cells during systemic administration, resulting in the utilization rate of AAV not being maximized, and non-targeted tissue cells are at risk of being infected. Therefore, it is proposed to modify the AAV capsid to obtain a highly targeted AAV vector to facilitate gene therapy of human diseases.

[0003] At present, the mutation area of ​​AAV capsid protein that has been studied more is the area near position 588 of the capsid (VP) protein. For example, patent application CN 112011571A discloses that the original amino acid AQ at positions 587-588 of the AAV9 capsid protein was replaced with the peptide DGTLAVPFK to obtain the mutant PHP.eB, and a gene expression vector carrying the mutant expression cassette was constructed, and the infection efficiency of the vector to the nervous system and its use in the treatment of spinal muscular atrophy were further studied. Patent CN114127089A also discloses the mutant PHP.eB; and discloses that after the constructs encoding AAV9-GFP and AAV.PHP.eB-GFP were intravenously injected into mice, it was found that the transduction efficiency of AAV9 and AAV.PHP.eB in mouse brain tissue was comparable.

[0004] In addition, it is also proposed to screen for combined mutations in different regions of the AAV capsid to give the AAV vector improved performance or superimposed advantages. For example, patent CN 113121654A discloses the simultaneous modification of two different regions of the AAV capsid, including replacing the amino acids 574-579 of the variable region VR-VIII of the AAV5 capsid protein with the oligopeptide GIVADNLQQQ, and introducing the point mutation T711S to obtain the mutant AAVz82, so as to reduce the formation rate of empty shell vectors that do not carry the target gene and provide a solid rate for the vector.

[0005] In order to expand the application potential of rAAV in the field of gene therapy, the field also needs to provide new rAAV capsid protein mutants to obtain recombinant adeno-associated virus vectors with high transduction efficiency in target tissues and low off-target toxicity in non-target tissues. Summary of the invention

[0006] In the development of new capsid protein variants, the inventors obtained the capsid protein variants of the present invention by screening capsid protein variants. Compared with the wild-type AAV9 capsid protein, the AAV capsid variant of the present invention has an amino acid sequence of SEQ ID NO.4 between amino acid positions 586 and 589 (amino acid positions are numbered according to SEQ ID NO:9) to replace the original 587-588 residues; and between amino acid positions 327 and 332 (amino acid positions are numbered according to SEQ ID NO:9), it has an amino acid sequence of SEQ ID NO.6 to replace the original 328-331 residues. The capsid protein variant according to the present invention produced by the replacement is referred to herein as CapX-123 / 528 (one of its examples is shown in SEQ ID NO:8). By comparing the expression of reporter genes and the fluorescence intensity, it was demonstrated in animal experiments that the capsid protein variant CapX-123 / 528 can enhance the transduction of adeno-associated virus vectors to cardiomyocytes and various skeletal muscle cells, while reducing the transduction of the liver and kidneys. Compared with the introduction of the 588-589 mutation or the 328-331 mutation alone, the combination of two mutated AAV capsid protein variants not only expands the myopathy treatment spectrum of AAV recombinant viral vectors, but also brings about reduced liver / kidney toxicity, and is expected to be a better choice for AAV treatment of myopathies (e.g., skeletal muscle diseases and myocardial diseases).

[0007] Therefore, in a first aspect, the present invention provides an adeno-associated virus (AAV) capsid protein variant, wherein the variant has the following mutations relative to the parent AAV capsid protein:

[0008] (a) an amino acid sequence mutation between amino acid positions 586 and 589, wherein the mutation is a substitution of residues 587-588 of the parent AAV capsid protein with the amino acid sequence set forth in SEQ ID NO: 4, and

[0009] (b) an amino acid sequence mutation between amino acid positions 327 and 332, wherein the mutation is substitution of residues 328-331 of the parent AAV capsid protein with the amino acid sequence set forth in SEQ ID NO:6,

[0010] The amino acid positions are numbered according to SEQ ID NO:9.

[0011] In some embodiments, the capsid protein variants of the present invention confer increased transduction of AAV virus particles containing it to cardiomyocytes compared to the parent AAV capsid protein. In some embodiments, the capsid protein variants of the present invention confer increased transduction of AAV virus particles containing it to skeletal muscle cells compared to the parent AAV capsid protein. In some embodiments, the skeletal muscle cells are selected from the quadriceps, biceps, triceps, intercostal muscles and gastrocnemius. In other embodiments, compared to the parent AAV capsid protein, the AAV virus particles containing the capsid protein variants of the present invention have increased transduction efficiency for cardiomyocytes and skeletal muscle cells, and reduced transduction efficiency for liver and / or kidney cells. In some embodiments, the transduction efficiency of the cardiomyocytes is increased by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 150%, 200%, 250%, 350% or 400%. In some embodiments, the transduction efficiency of the skeletal muscle cells is increased by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 150%, 200%, 250%, 300%, 350%, or 400%. In other embodiments, the transduction efficiency of the liver cells and / or kidney cells is reduced by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90%. In some embodiments, the transduction efficiency of a particular cell population can be measured by the proportion of cells in the population that are positive for AAV transduction. For example, if 1×10 6 cells were exposed to AAV virus, and 0.5×10 6If 10 cells contain at least one copy of the AAV genome, the transduction efficiency measured by the proportion of positive cells is 50%. Methods for determining the transduction efficiency include, but are not limited to, flow cytometry. For example, when the AAV genome contains a polynucleotide encoding green fluorescent protein (GFP), GFP can be expressed as + The percentage of cells transduced with AAV can be used as a measure of transduction efficiency. In other embodiments, the transduction efficiency of a particular cell population can also be measured by measuring the average transgene expression level in the population via AAV transduction, wherein the transgene is contained in the genome of the AAV vector and is preferably expressed under the control of a constitutive promoter. For example, when the AAV genome contains a polynucleotide encoding green fluorescent protein (GFP), the transduction efficiency can be measured by measuring the average GFP expression level of the cell population transduced with the AAV.

[0012] In some embodiments, the parent AAV capsid protein is selected from the capsid proteins of AAV serotypes of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12 and AAV13. In some embodiments, the parent AAV capsid protein has surface-exposed hypervariable loops VR-II and VR-VIII that correspond in structure to AAV9 capsid protein. In some preferred embodiments, the parent AAV capsid protein is an AAV9 capsid protein.

[0013] In some more preferred embodiments, the parent AAV capsid protein is an AAV9 capsid protein, which comprises or consists of the following amino acid sequence:

[0014] (a) an amino acid sequence of amino acids 203 to 736 of SEQ ID NO:9, or an amino acid sequence at least 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identical thereto;

[0015] (b) an amino acid sequence of amino acids 137 to 736 of SEQ ID NO:9, or an amino acid sequence at least 95%, 96%, 97%, 98%, 99%, 99.5% or 100% identical thereto; or

[0016] (c) an amino acid sequence of SEQ ID NO: 9, or an amino acid sequence that is at least 95%, 96%, 97%, 98%, 99%, 99.5% or 100% identical thereto.

[0017] In some embodiments, the capsid protein variant of the present invention is a VP1, VP2 or VP3 capsid protein variant, for example, the capsid protein variant:

[0018] (a) comprising the amino acid sequence of SEQ ID NO:8, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity thereto and having the amino acid sequence of SEQ ID NO:4 at positions 587 to 588 and the amino acid sequence of SEQ ID NO:6 at positions 328 to 331;

[0019] (b) encoded by a nucleic acid comprising SEQ ID NO: 7 or a nucleotide sequence that differs from the nucleotide sequence of SEQ ID NO: 7 due to the degeneracy of the genetic code;

[0020] (c) is derived from a transcript encoding the amino acid sequence of (a) or comprising the nucleotide sequence of (b).

[0021] In some preferred embodiments, the capsid protein variant according to the present invention is a VP1, VP2 or VP3 capsid protein variant comprising the amino acid sequence of SEQ ID NO: 8 or its N-terminal truncated sequence. In other embodiments, the capsid protein variant according to the present invention is a VP1, VP2 or VP3 capsid protein variant encoded by a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 7.

[0022] In a second aspect, the present invention provides an isolated nucleic acid, wherein the nucleic acid comprises a polynucleotide sequence encoding the AAV capsid protein variant described in the present invention.

[0023] In some embodiments, a nucleic acid according to the invention comprises:

[0024] (a) a polynucleotide encoding SEQ ID NO:8, or an amino acid sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% identical thereto; or

[0025] (b) the nucleotide sequence of SEQ ID NO:7, or a nucleotide sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% identical thereto.

[0026] In some embodiments, the nucleic acid according to the present invention is capable of transcribing and expressing at least one or any two or all three AAV capsid proteins selected from the following: VP1, VP2 and VP3. In this article, the expression "capable of transcribing and expressing" with respect to nucleic acid means that when the nucleic acid is placed under the control of a suitable promoter, it can be transcribed and expressed in a suitable cell into which the nucleic acid is introduced to produce the gene product mentioned above.

[0027] In a third aspect, the present invention provides a nucleic acid vector, e.g., a nucleic acid expression vector, comprising the nucleic acid of the present invention. In some embodiments, the vector further comprises a nucleic acid encoding an AAV REP protein. In some embodiments, the vector is a plasmid.

[0028] In a fourth aspect, the present invention provides an isolated host cell comprising the nucleic acid of the present invention, optionally wherein the nucleic acid is stably transfected into the host cell, preferably, the host cell further comprises a nucleic acid encoding an AAV REP protein and / or a nucleic acid encoding a helper virus function.

[0029] In some embodiments, the host cell is a recombinant adeno-associated virus vector (rAAV) production cell. In some embodiments, the nucleic acid stably transfects the production cell. In other embodiments, the production cell further comprises a nucleic acid encoding an AAV REP protein (especially an AAV9 or AAV2 REP protein). In other embodiments, the production cell further comprises a nucleic acid capable of trans-providing the helper virus functions required for AAV replication and assembly (e.g., E1a and E1b helper genes from adenovirus, and / or E4, E2a and VA helper genes). In other embodiments, the production cell further comprises an rAAV genome carrying a heterologous nucleic acid.

[0030] In a fifth aspect, the present invention provides the use and method of using a nucleic acid according to the present invention, a vector according to the present invention, or a host cell or a production cell according to the present invention encoding an AAV capsid protein variant according to the present invention for preparing a recombinant adeno-associated virus (rAAV) vector. In some embodiments, the use or method comprises:

[0031] (i) providing a production cell according to the invention;

[0032] (ii) culturing the cells under conditions that allow packaging to produce rAAV virions comprising the recombinant AAV genome; and

[0033] (iii) harvesting the cultured host cells or the culture medium to collect the produced recombinant AAV viral vector.

[0034] In a sixth aspect, the present invention provides a recombinant adeno-associated virus (rAAV) vector comprising a capsid protein variant according to the present invention or produced using a production cell of the present invention comprising a nucleic acid according to the present invention. Preferably, the rAAV vector according to the present invention has a capsid consisting mainly of or consisting of a capsid protein variant of the present invention.

[0035] In some embodiments, rAAV vectors comprising a capsid protein variant according to the present invention exhibit increased transduction of muscle cells (particularly cardiomyocytes and skeletal muscle cells), and optionally reduced transduction of liver cells and / or kidney cells, relative to rAAV vectors comprising wild-type AAV capsid proteins or relative to reference rAAV vectors comprising parental capsid proteins.

[0036] In some embodiments, the rAAV vector according to the present invention comprises in its genome:

[0037] a. 5' and 3' AAV inverted terminal repeat (ITR) sequences, and

[0038] b. an expression construct comprising a heterologous nucleic acid located between the 5' and 3' ITRs, wherein the heterologous nucleic acid encodes a gene product of interest;

[0039] Preferably, the expression construct comprises the following elements functionally linked to each other in the transcriptional direction:

[0040] - promoter,

[0041] - a heterologous nucleic acid,

[0042] - Transcription terminator.

[0043] In some embodiments, the heterologous nucleic acid encodes a target gene product for gene replacement, gene suppression or gene editing. Preferably, the target gene product is a protein or RNA.

[0044] In a seventh aspect, the present invention provides a pharmaceutical composition comprising a recombinant AAV viral vector according to the present invention and a pharmaceutically acceptable carrier.

[0045] In an eighth aspect, the present invention provides a method for delivering a heterologous nucleic acid to a subject in need thereof, wherein the method comprises administering to the subject a recombinant AAV viral vector according to the present invention or a pharmaceutical composition according to the present invention, for example, by intramuscular injection or intravenous injection, for example, for the treatment or prevention of a myopathy, such as a hereditary myopathy. In some embodiments, the myopathy is selected from heart failure and hereditary cardiomyopathy. In other embodiments, the myopathy is a skeletal muscle disease.

[0046] In a ninth aspect, the present invention provides the use of a recombinant AAV viral vector according to the present invention for preparing a pharmaceutical composition for treating or preventing myopathy, such as a hereditary myopathy, preferably, the pharmaceutical composition is administered by intramuscular injection or intravenous injection. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Combined with the following Figure 1When reading together, the preferred embodiments of the present invention described in detail below will be better understood. For the purpose of illustrating the present invention, the drawings show the currently preferred embodiments. However, it should be understood that the present invention is not limited to the precise arrangement and means of the embodiments shown in the drawings.

[0048] Figure 1 The schematic diagram shows the pRDAV-CMV-EGFP-Cap9 backbone plasmid (Construct 1). ITR: AAV inverted terminal repeat (ITR); CMV promoter: cytomegalovirus promoter; EGFP: gene encoding enhanced green fluorescent protein; shortpA: short polyadenylation signal; p40: p40 promoter from AAV9; CAP9: gene encoding capsid protein of wild-type AAV9 serotype.

[0049] Figure 2 The pRDAV-CMV-EGFP-Cap9Δ-588 backbone plasmid generated based on construct 1 is schematically shown (construct 2).

[0050] Figure 3 Representative schematic diagrams showing the results of EGFP fluorescence microscopy of mouse myocardium after mice were infected with CapX-123 capsid variant virus via tail vein injection.

[0051] Figure 4 Representative schematic diagrams showing the results of EGFP fluorescence microscopy of the quadriceps and biceps brachii muscles of mice infected with CapX-528 capsid variant virus via tail vein injection.

[0052] Figure 5 The transfer plasmid pRDAV-CMV-EGFP-P40-CAPX123 / 528 obtained in Example 5.5 is schematically shown, which encodes a CAP9 variant having an amino acid sequence substitution of "KTSC" at positions 328-331 and an amino acid substitution of "YGNSPSKL" at positions 587-588.

[0053] Figure 6 Representative schematic diagrams showing the results of EGFP fluorescence microscopy of mouse skeletal muscles (including quadriceps, biceps, triceps, gastrocnemius and intercostal muscles) after mice were infected with CapX-123 / 528 capsid variant virus via tail vein injection.

[0054] Figure 7 Shown is a statistical graph of the changes in the mean fluorescence intensity of EGFP detected in mouse skeletal muscle after intravenous infection of mice with CapX-123 / 528 capsid variant virus relative to control rAAV9 virus.

[0055] Figure 8Representative schematic diagrams of EGFP fluorescence microscopy results and statistical graphs of changes in the mean fluorescence intensity of EGFP detected in the heart, liver, and kidney of mice after intravenous infection of mice with CapX-123 / 528 capsid variant virus relative to control rAAV9 virus are shown.

[0056] Fig. 9 Shown is a sequence alignment of the capsid protein variant of SEQ ID NO: 8 and the wild-type AAV9 capsid protein of SEQ ID NO: 9. The sequence alignment shows that the amino acid residues of SEQ ID NO: 8 correspond to the position numbers of SEQ ID NO: 9; and shows that SEQ ID NO: 8 has a mutated amino acid sequence between positions 586-589 and between positions 327-332 corresponding to amino acid residues of SEQ ID NO: 9. DETAILED DESCRIPTION

[0057] Unless defined otherwise hereinafter, all technical and scientific terms used in this specification have the same meaning as those of ordinary skill in the art to which the present invention belongs. All publications, patent applications, patents and other references mentioned herein are fully incorporated by reference. In addition, the materials, methods and examples described herein are only illustrative and are not intended to be restrictive. Other features, purposes and advantages of the present invention will be apparent from this specification and the accompanying drawings and from the appended claims.

[0058] I. Definitions

[0059] As used herein, the term "about" when used in conjunction with a numerical value is intended to encompass numerical values ​​within a range having a lower limit that is 5% less than the specified numerical value and an upper limit that is 5% greater than the specified numerical value. The term is also intended to encompass numerical values ​​within the range of ±1%, ±0.5%, or ±0.1% of the specified numerical value.

[0060] Herein, the expression "and / or" is used to indicate any one of the related listed items, or any and all possible combinations of a plurality of the related listed items.

[0061] In this article, the term "comprising" or "including" means including the mentioned elements, integers or steps, or groups of elements, integers or steps, but does not exclude any other elements, integers or steps, or other groups of elements, integers or steps. In this article, when the term "comprising" or "including" is used, unless otherwise indicated, the situation consisting of the mentioned elements, integers or steps is also covered. For example, when referring to a polypeptide / protein "comprising" a specific sequence, it is also intended to cover polypeptides / proteins consisting of the specific sequence.

[0062] As used herein, the terms "AAV capsid protein variant", "AAV variant capsid protein" and "AAV capsid variant" refer to an AAV capsid protein having at least one modification (including deletion, insertion and / or substitution) in the amino acid sequence relative to the parent AAV capsid protein. The variant AAV capsid protein may have at least 90%, at least 95%, at least 98%, at least 99% identity to the amino acid sequence of the parent capsid protein.

[0063] Herein, "parent AAV capsid protein" or "parent capsid protein" refers to an AAV capsid protein used as a template for introducing capsid protein mutations at positions 568-589 and 327-332 according to the present invention. The parent of the variant AAV capsid protein may be a naturally occurring or "wild-type" AAV capsid protein; it may also be a non-wild-type capsid protein, for example, a capsid protein into which one or more (e.g., no more than 10 or 5, 4, 3, 2, 1) amino acid modifications are introduced into the natural AAV capsid protein; a chimeric capsid protein formed by splicing capsid proteins of different AAV serotypes, for example, an AAV5 / AAV9 chimeric capsid protein, an AAV2 / AAV9 chimeric capsid protein. It should be understood that in the case where the parent capsid protein is a non-natural capsid protein, the parent capsid protein does not contain the capsid protein mutations at positions 586-589 and 327-332 according to the present invention. In some embodiments, the parent capsid protein is a native AAV9 serotype capsid protein, for example, a VP1 protein having the amino acid sequence of SEQ ID NO: 9, or a corresponding VP2 or VP3 protein having an N-terminal truncation.

[0064] As used herein, when referring to an amino acid position in an AAV capsid protein or a segment thereof, it refers to the amino acid position numbered according to SEQ ID NO: 9. The amino acid position corresponding to the amino acid position of SEQ ID NO: 9 in the sequence of the capsid protein can be determined by aligning the amino acid sequence of the AAV capsid protein with SEQ ID NO: 9. For example, when referring to position 586 of the capsid protein, it refers to the amino acid residue at position 586 of SEQ ID NO: 9, or an amino acid residue that appears at a corresponding position in another capsid protein after alignment. It should be understood that in the present disclosure, when an AAV capsid protein variant involves amino acid substitutions at certain specific amino acid position segments (for example, replacing the original sequence with an amino acid sequence with a different number of residues), the alignment of the AAV capsid protein variant with SEQ ID NO: 9 in the segment can be visually detected, and if necessary, a gap is introduced in one or both of the two aligned sequences to ensure that after the gap is introduced, the segment of the AAV capsid protein and the corresponding segment of SEQ ID NO: 9 are in the corresponding position region in the alignment and have the corresponding amino acid residue number. As an example of such an alignment, see Fig. 9 To determine the position of amino acids, the sequence alignment can be performed using https: / / blast.ncbi.nlm.nih.gov / Blast.cgi The available Basic Local Alignment Search Tool was run with default parameters.

[0065] In this article, "AAV virus particle" and "AAV virus particle" are used interchangeably to refer to a complete virus particle comprising an AAV capsid and an AAV nucleic acid genome (including a wild-type AAV genome and a recombinant AAV genome) packaged in the capsid. In this regard, the AAV nucleic acid molecule chain packaged into any one AAV virus particle can be a sense (e.g., "positive") chain or an "antisense" chain, and these two chains have equal infectivity.

[0066] Herein, the terms "recombinant AAV vector" and "recombinant AAV virions" and "recombinant AAV virus particles" are used interchangeably to refer to non-wild-type recombinant AAV virus particles that can serve as a carrier of a target nucleic acid. Typically, the viral vector comprises a capsid and a viral genome packaged therein, and preferably the viral genome comprises a target nucleic acid to be delivered to a target cell or tissue inserted therein. Herein, "recombinant" may be abbreviated as "r", for example, recombinant AAV may be referred to as rAAV. Therefore, herein, the terms "recombinant AAV virions" and "recombinant AAV vectors" may also be used interchangeably with "rAAV virions", "rAAV virus particles" or "rAAV" or "rAAV vectors". Typically, recombinant AAV vectors are infectious but replication-defective.

[0067] Herein, for the purpose of the present disclosure, the rAAV capsid may be from or derived from various adeno-associated virus serotypes, including but not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, and AAV13. For example, the rAAV may have a viral protein capsid composed of an AAV capsid protein from the serotype, a chimeric capsid protein formed by splicing at least two AAV capsid protein portions of the serotype (e.g., AAV5 / AAV9 chimeric capsid protein, AAV2 / AAV9 chimeric capsid protein), and / or variants thereof.

[0068] Herein, for the purposes of this disclosure, the viral genome packaged in the rAAV vector is recombinant, that is, an AAV genomic DNA with genetic modification relative to wild-type AAV genomic DNA. In order to produce recombinant AAV virions that can deliver the nucleic acid of interest to tissues or cells, it is generally only necessary to retain the reverse terminal repeat (ITR) cis element in the genome, and the remaining sequences required for viral packaging can be provided in trans. Therefore, typically, rAAV can have one or more AAV wild-type genes that are completely or partially deleted, for example, rep and / or cap genes that are completely or partially deleted, and are thus replication-defective; but functional flanking ITR sequences necessary for the rescue, replication and packaging of AAV virions are retained. More typically, the recombinant AAV viral genome packaged in the rAAV virion can retain only functional ITR sequences, and preferably comprises or consists of one or more exogenous nucleotide sequences located between two AAV ITR sequences. It should be understood that, with respect to rAAV, the functional ITR sequence can be, but not necessarily, a wild-type nucleotide sequence, which can be changed, for example, by insertion, deletion or substitution of nucleotides, as long as it still provides the functions required for rescue, replication and packaging. Therefore, in this article, the rAAV vector is a viral vector that at least contains the functional ITR required for viral replication and packaging in cis. It should also be understood that the recombinant AAV viral genome can contain two or more (e.g., three) ITR sequences, and these ITR sequences can be the same or different.

[0069] As used herein, the terms AAV "inverted terminal repeat" or "ITR" are used interchangeably to refer to the functional inverted terminal repeat cis-acting elements from the AAV viral genome and encompass wild-type ITR sequences and variant ITR sequences.

[0070] The wild-type ITR of the natural AAV virus contains a Rep protein binding site (RBS) and a terminal resolution site trs (terminal resolution site) in the sequence. It can be bound and recognized by the Rep protein and produce an incision at the trs, and can form a unique "T"-shaped secondary structure, which plays an important role in the life cycle of the AAV virus. The earliest isolated AAV virus, AAV2, has a "reverse terminal repeat sequence" (ITR) with a length of 145bp and a palindromic-hairpin structure located at both ends of the genome. Afterwards, different ITR sequences were found in AAV viruses of various serotypes, but they can all form a hairpin structure and have a Rep binding site. Recombinant AAV viral vectors based on these wild-type ITR sequences are generally single-stranded AAV vectors (ssAAV).

[0071] Relative to the wild-type ITR sequence, the variant ITR can be, for example, a non-natural ITR sequence comprising one or more nucleotide deletions, substitutions, and / or additions, and / or truncations, but still functional, i.e., capable of being used to produce rAAV viral vectors. It has been found that, unlike the above-mentioned ssAAV, by modifying the ITR, deleting the trs sequence and optionally the D sequence in the ITR sequence on one side of the AAV virus, the packaged recombinant AAV viral vector can carry self-complementary genomic DNA, thereby producing a virus called scAAV (self-complementary AAV). The packaging capacity of the scAAV viral vector is half that of the ssAAV viral vector, about 2.2 kb-2.5 kb, but the transduction efficiency is higher after infecting cells. See, for example, Self-complementary AAV Vectors; Advances and Applications, https: / / doi.org / 10.1038 / mt.2008.171. Such variant ITR sequences that can be used to produce scAAV viruses are also referred to herein as ΔITR. The present disclosure contemplates not only ssAAV vectors generated by combining two wild-type ITRs, but also scAAV vectors generated by combining a ΔITR sequence with a wild-type ITR.

[0072] As those skilled in the art will appreciate, the viral capsid protein and viral genome ITR sequence of the recombinant adeno-associated virus may be from the same or different AAV virus serotypes.

[0073] As used herein, the term "host cell" refers to a cell into which an exogenous polynucleotide has been introduced, including the progeny of such cells. Examples of host cells include, but are not limited to, microorganisms, yeast cells, insect cells, and mammalian cells. In some embodiments, the host cell is a mammalian cell. In some embodiments, the host cell is a muscle cell, such as a cardiomyocyte or a skeletal muscle cell. Depending on the context in which the term is used, the host cell can be an in vitro, ex vivo, or in vivo cell. In other embodiments, the host cell is a production cell for producing an rAAV vector according to the present invention, for example, a "HEK293 cell" or "293 cell", or a cell line derived from the cell.

[0074] Herein, in some embodiments, the term "producer cell" or "producer cell line" refers to a cell population that can grow and divide continuously or for a long time in vitro. It is known in the art that during the storage or passage of such a clonal cell population, the karyotype may undergo spontaneous or induced changes, and thus may not be completely identical to the ancestral cell or culture, but still maintain the desired characteristics of the original producer cell. Such producer cells or cell lines are encompassed within the scope of the present invention.

[0075] As used herein, the terms "exogenous" or "heterologous" are used interchangeably to describe a nucleic acid or protein and refer to a nucleic acid or protein that is exogenous or heterologous relative to a virus, host cell, subject, or other organism containing the nucleic acid or protein, or relative to a flanking nucleic acid or polypeptide to which it is attached, i.e., the nucleic acid or protein is present in a non-natural state in the virus, host cell, subject, or organism, or is non-naturally attached to the flanking nucleic acid or polypeptide. For example, a nucleic acid that is introduced into a particular viral genome or host cell or subject by recombinant techniques so as to be attached to a sequence that is not naturally attached thereto or is in a non-natural chromosomal or cellular location or state is heterologous relative to the viral genome or host cell or subject. Thus, a nucleic acid that is inserted into the same host cell as the cell from which it is derived or into the same organism as the organism from which it is derived, but is present in a non-natural state, e.g., in a different copy number or under the control of different regulatory elements, is exogenous or heterologous.

[0076] In this article, "isolated" nucleic acid refers to a nucleic acid molecule that is artificially synthesized or separated from at least some components of the natural environment containing it. For example, an isolated nucleic acid can be part of a larger nucleic acid, or part of a carrier or material composition, or can be contained in a cell and still be "isolated" if the larger nucleic acid, carrier, material composition or specific cell is not the natural environment of the nucleic acid. In some embodiments, the "isolated" nucleic acid is enriched at least about 10 times, 100 times, 1000 times, 10,000 times or more relative to the starting material.

[0077] As used herein, the term "functional connection" is also referred to as "operably linked", meaning that the specified components are in a relationship that allows them to function in an intended manner. For example, a promoter or enhancer sequence is operably linked to a coding sequence if it stimulates or regulates transcription of the coding sequence in a suitable host cell or other expression system. In general, promoters that are operably linked to a transcribable sequence are continuous with the transcribable sequence, i.e., they are cis-acting. However, some transcriptional regulatory sequences (such as enhancers) do not need to be physically adjacent to or in close proximity to the coding sequence whose transcription they enhance.

[0078] In this article, the term sequence "identity" is used to describe the sequence structure similarity between two amino acid sequences or polynucleotide sequences. To determine the identity percentage of two amino acid sequences or two nucleic acid sequences, the sequences can be compared for the best comparison purpose (for example, a room can be introduced in one or both of the first and second amino acid sequences or nucleic acid sequences for the best comparison or a non-homologous sequence can be abandoned for the purpose of comparison). In a preferred embodiment, for the purpose of comparison, the length of the compared reference sequence is at least 30%, preferably at least 40%, more preferably at least 50%, 60%, and even more preferably at least 70%, 80%, 90%, or 100% of the length of the reference sequence. Subsequently, the amino acid residues or nucleotides at the corresponding amino acid positions or nucleotide positions are compared. When the position in the first sequence is occupied by the same amino acid residue or nucleotide at the corresponding position in the second sequence, the molecules are identical at this position.

[0079] Mathematical algorithms can be used to compare sequences and calculate percent identity between two sequences. In a preferred embodiment, the Needlema and Wunsch ((1970) J. Mol. Biol. 48: 444-453) algorithm (available at http: / / www.gcg.com) that has been integrated into the GAP program of the GCG software package is used, using a Blossum 62 matrix or a PAM250 matrix and a gap weight of 16, 14, 12, 10, 8, 6 or 4 and a length weight of 1, 2, 3, 4, 5 or 6 to determine the percent identity between two amino acid sequences. In another preferred embodiment, the GAP program in the GCG software package is used (available at http: / / www.gcg.com) to determine the percent identity between two nucleotide sequences using the NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70 or 80 and a length weight of 1, 2, 3, 4, 5 or 6. A particularly preferred parameter set (and the one that should be used unless otherwise stated) is the Blossum 62 scoring matrix with a gap penalty of 12, a gap extension penalty of 4, and a frameshift gap penalty of 5.

[0080] The percent identity between two amino acid or nucleotide sequences can also be determined using the algorithm of E. Meyers and W. Miller, ((1989) CABIOS, 4: 11-17), which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weighted remainder table, a gap length penalty of 12, a gap penalty of 4).

[0081] As used herein, the term "conservative" amino acid or nucleotide changes refers to neutral or nearly neutral amino acid or nucleotide changes that result in the protein or nucleic acid molecule containing the amino acid or nucleotide changes substantially maintaining the original function. For example, a conservative amino acid substitution is a substitution or replacement of an amino acid with a different amino acid having a similar biochemical property (e.g., charge, hydrophobicity, and size) in the side chain. Such conservatively modified variants are additional to and do not exclude polymorphic variants, interspecies homologs, and alleles. The following 8 groups contain amino acids that are conservative substitutions for each other: 1) alanine (A), glycine (G); 2) aspartic acid (D), glutamic acid (E); 3) asparagine (N), glutamine (Q); 4) arginine (R), lysine (K); 5) isoleucine (I), leucine (L), methionine (M), valine (V); 6) phenylalanine (F), tyrosine (Y), tryptophan (W); 7) serine (S), threonine (T); and 8) cysteine ​​(C), methionine (M) (see, e.g., Creighton, Proteins (1984)). Those skilled in the art can easily detect the conservative nature of amino acid or nucleotide changes in a particular polypeptide sequence or nucleotide sequence by conventional technical means, such as functional assays.

[0082] As used herein, "individual" or "subject" refers to a mammal. Examples of mammals include, but are not limited to, humans, non-human primates (e.g., cynomolgus monkeys, rhesus monkeys), rodents, and other mammals, e.g., cattle, pigs, horses, dogs. As used herein, mammals include individuals at all stages of development (including embryonic and fetal stages).

[0083] As used herein, the term "treatment" refers to a clinical intervention intended to alter the natural course of a disease in the individual being treated. Desired therapeutic effects include, but are not limited to, preventing the onset or recurrence of the disease, alleviating symptoms, reducing any direct or indirect pathological consequences of the disease, preventing metastasis, reducing the rate of progression of the disease, ameliorating or relieving the disease state, and alleviating or improving prognosis. The term "treatment" also encompasses modification or improvement of at least one physical parameter, including physical parameters that may not be discernible by the patient.

[0084] As used herein, the term "prevention" refers to preventing or delaying the onset or development or progression of a disease or condition. As used herein, "prevention" generally refers to hospital intervention performed before at least one symptom of a disease occurs.

[0085] Various aspects of the invention are described below.

[0086] II. Capsid protein variants

[0087] Adeno-associated virus (AAV) is a non-pathogenic parvovirus consisting of a non-enveloped capsid and a 4.7 kb single-stranded DNA genome within it. The genome contains three open reading frames (ORFs) flanked by inverted terminal repeats (ITRs) that serve as the origin of viral replication and packaging signals. The rep ORF encodes four nonstructural proteins that play a role in viral replication, transcriptional regulation, site-specific integration, and virion assembly. The cap ORF encodes three structural proteins (VP1-3) that assemble to form the viral capsid.

[0088] The AAV viral capsid is composed of a total of about 60 VP monomers from three VP capsid proteins, arranged in an icosahedral structure, wherein the molar ratio of the three capsid proteins VP1:VP2:VP3 is "optimal" at about 1:1:10. The three capsid proteins VP1, VP2, and VP3 are all encoded by the cap gene of AAV and produced from the same transcript, regulated by the p40 promoter. The three VP proteins have a common C-terminal sequence, but different N-terminal start sites; VP2 and VP3 produced by alternative splicing are two truncated forms of VP1. As an example, the capsid protein sequence of AAV9 is shown below, in which the VP1-specific amino acid sequence is shown in black and bold (VP1 unique region). The amino acid sequence shared by VP1 and VP2 ("VP1 / VP2 common region") is underlined and italicized; the entire VP3 is contained in VP1 and VP2, and is the amino acid shared by all three capsid proteins ("common VP3 region"), which is bold and italicized below.

[0089]

[0090] VP1 and VP2 are mainly located in the nucleus, while the monomeric VP3 is distributed in both the nucleus and the cytoplasm. The outer surface of the assembled AAV capsid is composed of the VP3 sequence (including VP3 and the C-termini of VP1 and VP2), and the N-termini of VP1 and VP2 are located inside the capsid.

[0091] The VP has nine protruding loops called variable regions (VRs). VRs vary among AAV serotypes and are responsible for serotype-specific differences in receptor binding. Due to their exposed position and their function in receptor binding, the VRs forming the protruding loops are ideal locations for capsid modifications aimed at redirecting or expanding AAV tropism (i.e., cell surface targeting).

[0092] In order to develop new cell / tissue-targeted AAV capsid protein variants, the inventors screened AAV capsid protein variants. Random sequences were inserted into the cap ORF at the amino acid positions corresponding to the VR-VIII loop (positions 586-589) and the VR-II loop (positions 327-332), and an AAV transfer plasmid containing a reporter gene and the cap ORF was constructed to couple the genotype and phenotype of the AAV capsid variant with reporter gene expression, thereby generating a plasmid library. Subsequently, through capsid variant screening and in vivo tissue distribution detection in animals, CapX-123 mutations and Cap-X528 mutations that can more efficiently and / or more specifically transduce cardiac and skeletal muscle cells under intravenous administration were identified. On this basis, in order to further explore and expand the applicability of capsid protein variants, the inventors combined the identified mutations. Through the in vivo tissue distribution test in animals, it was surprisingly found that the combination of the two mutants in the capsid protein not only did not affect the correct folding and assembly of the capsid protein, but also gave the advantages of capsid protein superposition: it not only enhanced the transduction efficiency of cardiomyocytes, but also enhanced the transduction efficiency of skeletal muscle cells, and at the same time reduced the transduction of the liver and kidneys. Thus, the inventors established the new capsid protein variant of the present invention.

[0093] Therefore, in one aspect, the present invention provides AAV capsid protein variants. In one embodiment, the AAV capsid protein variant according to the present invention is derived from the parent AAV capsid protein, and the peptide of SEQ ID NO:4 is inserted between the amino acid positions 586 and 589 of the parent capsid protein to replace the original 587-588 residues; and the peptide of SEQ ID NO:6 is inserted between the amino acid positions 327 and 332 of the parent capsid protein to replace the original 328-331 residues (according to the AAV9 VP1 numbering of SEQ ID NO:9). Herein, for convenience, the substitution mutation between the 586 and 589 residues of the present invention is also referred to as "586-589 mutation according to the present invention" or "588 mutation according to the present invention"; similarly, the substitution mutation between the 327 and 332 residues of the present invention is also referred to as "327-332 mutation according to the present invention" or "328 mutation according to the present invention". Modification of the capsid protein according to the present invention does not interfere with capsid assembly and genome packaging and allows rAAV to acquire modified myocyte targeting and optionally reduced liver and / or kidney targeting.

[0094] In some embodiments, the parent AAV capsid protein is a capsid protein of an AAV serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12 and AAV13, for example, an AAV9 serotype capsid protein. In other embodiments, the parent AAV capsid protein can be a chimeric capsid protein formed by splicing capsid proteins of different AAV serotypes, for example, an AAV5 / AAV9 chimeric capsid protein, an AAV2 / AAV9 chimeric capsid protein. In some embodiments, the parent AAV capsid protein is an AAV9 capsid protein comprising the following amino acid sequence or an AAV9 capsid protein consisting of the following amino acid sequence:

[0095] (a) an amino acid sequence of amino acids 203 to 736 of SEQ ID NO:9;

[0096] (b) an amino acid sequence of amino acids 137 to 736 of SEQ ID NO:9;

[0097] (c) the amino acid sequence of SEQ ID NO: 9;

[0098] (d) an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identical to the amino acid sequence of any one of (a) to (c); or

[0099] (e) has one or more (e.g., 1, 2, 3, 4, 5, 7, 8, 9 or 10) amino acid residue substitutions, deletions and / or additions (preferably conservative amino acid substitutions) compared to the amino acid sequence of any one of (a) to (c).

[0100] In other embodiments, the AAV capsid protein variant according to the present invention is derived from a transcript encoding the following amino acid sequence, wherein the amino acid sequence is an AAV9 capsid protein sequence having the amino acid sequence shown in SEQ ID NO:4 between amino acid positions 586 and 589 and having the amino acid sequence shown in SEQ ID NO:6 between amino acid positions 327 and 332 (e.g., the sequence of SEQ ID NO:8). In this article, the expression "derived from" a transcript related to a capsid protein variant means that the transcript is capable of producing the capsid protein variant when it is in conditions suitable for its expression to produce protein, including different forms of capsid protein variants produced from the transcript by using alternative translation start sites and / or alternative splicing, such as VP1, VP2 or VP3 capsid protein variants. In some embodiments, therefore, the AAV capsid protein of the present invention derived from the transcript may be a capsid protein variant selected from VP1, VP2 and VP3. In some preferred embodiments, the AAV capsid protein variant according to the present invention is derived from a transcript encoding the amino acid sequence shown in SEQ ID NO:8. In some preferred embodiments, the AAV capsid protein variants according to the present invention are derived from a transcript comprising the nucleotide sequence shown in SEQ ID NO:7.

[0101] In some embodiments, in addition to the 586-589 mutation and the 327-332 mutation according to the present invention, the capsid protein variant according to the present invention may or may not include amino acid substitutions (preferably conservative substitutions) at one or more other amino acid positions, for example, 2 to 5, 5 to 10, or 10 to 15 amino acid substitutions.

[0102] In some embodiments, the AAV capsid protein variants according to the present invention can be further modified, for example, to enhance or extend the delivery of the recombinant vector. Methods for constructing and screening recombinant AAV capsid protein libraries are well known in the art. See, for example, US2005 / 0053922 and US2009 / 0202490, the disclosures of which are incorporated herein by reference in their entirety.

[0103] In some embodiments, the variant capsid proteins disclosed herein confer increased myocyte transduction to rAAV virions comprising the same, compared to transduction of myocytes using rAAV virions comprising the corresponding parental AAV capsid protein or wild-type AAV capsid protein. In some embodiments, the myocytes are cardiomyocytes, skeletal muscle cells, and both. In some embodiments, skeletal muscle cells are selected from quadriceps, biceps, triceps, intercostal muscles, and gastrocnemius. In some embodiments, the variant capsid proteins of the present invention result in more AAV virions per myocyte on average, relative to AAV virions comprising parental AAV capsid proteins or wild-type AAV; and / or the variant capsid proteins of the present invention result in more myocytes taking up AAV virions. In some embodiments, AAV viral particles comprising a variant capsid protein of the present invention preferentially transduce muscle cells relative to other cells, for example, having an increased muscle cell / kidney cell transduction efficiency ratio and / or an increased muscle cell / liver cell transduction efficiency ratio compared to using rAAV viral particles comprising the corresponding parental AAV capsid protein or wild-type AAV capsid protein, wherein preferably, the transduction efficiency ratio is increased by about 1.0 times, about 2.0 times, about 3.0 times, about 4.0 times, about 5.0 times, about 6.0 times, about 7.0 times, about 8.0 times, about 9.0 times, or about 10.0 times, or more times.

[0104] The transduction efficiency of the AAV virus particles to be tested to myocytes and other cells (e.g., liver and / or kidney) can be evaluated in vitro or in vivo using a variety of methods for measuring gene expression in the art, such as an increase in transduction efficiency, transduced cell type selection, transduction preference, etc. For example, the rAAV genome containing a reporter gene (e.g., a fluorescent protein under the control of a constitutive promoter) can be packaged using AAV capsid proteins, and the transduction efficiency and / or transduced cell type selectivity / preference can be evaluated by detecting the expression of the reporter gene (e.g., fluorescence microscopy) in an in vitro cell-based assay (e.g., after transfection of a target cell or a group of target cells) or in an animal model-based assay. In some embodiments, for example, according to the fluorescent reporter molecule measurement assay described in the Examples, after transduction with the AAV particles, the transduction efficiency of the AAV particles for different cells and the transduction efficiency ratio between different cells are measured by measuring the average expression level of the transgene carried by the AAV particles in different cells (e.g., cells of skeletal muscle, myocardium, kidney and / or liver).

[0105] III. rAAV production

[0106] In some aspects, the present invention provides the use of nucleic acids encoding the AAV capsid protein variants of the present invention, vectors and host cells comprising the same in preparing rAAV vectors.

[0107] The general principles of rAAV production are reviewed in, for example, Carter, 1992, Current Opinions in Biotechnology, 1533-539; and Muzyczka, 1992, CUM Topics in Microbial. and Immunol., 158: 97-129). Various methods are described in the following documents: WO 95 / 13365; WO 95 / 13392; WO 96 / 17947; PCT / US98 / 18600; WO 97 / 09441; WO 97 / 08298; WO 97 / 21825; WO 97 / 06243; WO 99 / 11764; US 5,786,211; US ​​5,871,982; and US 6,258,595. These documents, especially those related to rAAV production, are incorporated herein by reference in their entirety.

[0108] It has been confirmed that the two inverted terminal repeat sequences (ITR) in the AAV genome are cis-acting elements necessary for AAV integration, replication, rescue and packaging. The two open reading frames located between the ITR sequences in the wild-type AAV genome, called Rep and Cap, encode four Rep proteins (Rep78, Rep68, Rep52 and Rep40) and three Cap proteins (VP1, VP2 and VP3) involved in AAV replication and packaging, as well as one assembly activation protein (AAP). The transcription of Rep78 and Rep68 is controlled by the p5 promoter, the transcription of Rep52 and Rep40 is initiated by the p19 promoter, and the p40 promoter regulates the transcription of Cap proteins VP1, VP2 and VP3.

[0109] Generally, to produce rAAV virions, it is necessary to retain the cis-acting element ITR in the rAAV genome, but the REP and CAP proteins required for replication and packaging can be provided in trans. Therefore, typically, a vector (e.g., a plasmid) carrying an rAAV genome that has deleted all or part of the rep and / or cap genes can be used to transfect a suitable host cell (e.g., a suitable packaging cell) that can provide the deleted AAV function (e.g., rep and / or cap proteins) in trans to produce infectious rAAV virions.

[0110] Herein, the nucleic acid vector carrying the rAAV genome to be transferred into the target cell is also referred to as an "AAV transfer vector", which can be in the form of various nucleic acid vectors suitable for gene transfer, for example, a plasmid. Herein, the AAV functions that are missing from the rAAV genome and need to be provided in trans to assist the rAAV genome in packaging into productive AAV virus particles are also referred to as "AAV auxiliary functions", such as the rep and / or cap genes deleted from the rAAV genome, or nucleic acids encoding AAV rep and / or cap expression products or functional variants thereof. In some embodiments, the AAV auxiliary function can be provided by a vector encoding the auxiliary function, for example, in the form of a plasmid, phage, transposon, cosmid, virus or virus particle. Typically, such a vector provides transient expression of AAV rep and / or cap nucleic acids, but lacks AAV ITR, and therefore can neither replicate nor package itself. In other embodiments, the AAV auxiliary function can be provided by cells or cell lines that stably express the auxiliary function.

[0111] Adeno-associated virus (AAV) is a non-enveloped virus of the Parvoviridae family, belonging to the genus Dependoparvovirus, and requires the presence of a helper virus to replicate and assemble to produce infectious virions. A virus that allows AAV (e.g., wild-type AAV) to be replicated and packaged by mammalian cells is also referred to herein as an "AAV helper virus." Various helper viruses for AAV are known in the art, including adenovirus, herpes virus, and poxvirus. In this article, the functions required for AAV replication and packaging encoded by the helper virus genome are also referred to herein as "helper virus functions," for example, E1a and E1b helper genes from adenovirus, and E4, E2a, and VA helper genes. Helper virus functions can be provided in the form of plasmids or other vectors, and / or in the form of stable cell lines expressing the helper genes. In addition, as will be appreciated by those skilled in the art, AAV helper functions (rep / cap genes) and helper virus functions (e.g., E4, E2a, and VA helper genes) can be provided on a single or separate vector. In some aspects, helper virus functions can also be provided by wild-type adenovirus. For example, a cell line containing and stably expressing the AAV Rep and Cap proteins can be transduced with wild-type adenovirus and an AAV transfer vector, thereby producing infectious rAAV viral particles.

[0112] In some aspects, the technology for producing rAAV particles involves providing the rAAV genome to be packaged, rep and cap genes, and helper virus functions to the cells. Such technology is well known in the art. For example, rAAV production cells (or packaging cells) comprising the following components can be produced: rAAV genome, AAV rep and cap genes separated from the rAAV genome (i.e., not in the rAAV genome), and helper virus functions. Afterwards, the production cells can be used to produce the infectious rAAV particles of interest.

[0113] In some aspects, therefore, the present invention provides a production cell (or packaging cell) that can be used to prepare a recombinant adeno-associated virus (rAAV) vector, which comprises a cap gene encoding a capsid protein variant of the present invention, and optionally further comprises a nucleic acid encoding an AAV rep gene and / or a nucleic acid encoding a helper virus function. In some embodiments, the production cell also comprises an rAAV genome. In some embodiments, the rAAV genome comprises the cap gene or the rep gene. In other embodiments, the rAAV genome does not comprise the cap gene and the rep gene.

[0114] In other aspects, the present invention provides a method for preparing a recombinant adeno-associated virus (rAAV) vector. In some embodiments, the method comprises:

[0115] (i) providing a production cell according to the invention;

[0116] (ii) culturing the cells under conditions that allow packaging to produce rAAV virions comprising the recombinant AAV genome; and

[0117] (iii) harvesting the cultured host cells or the culture medium to collect the produced recombinant AAV viral vector.

[0118] In some embodiments, the production cell comprises a nucleic acid according to the invention encoding an AAV capsid protein variant according to the invention. In some embodiments, the nucleic acid according to the invention comprises:

[0119] (a) encoding SEQ ID NO:8, or a polynucleotide having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% identity thereto and having the amino acid sequence of SEQ ID NO:4 between amino acid positions 586-589 and the amino acid sequence of SEQ ID NO:6 between amino acid positions 327-332; or

[0120] (b) the nucleotide sequence of SEQ ID NO:7, or a nucleotide sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% identical thereto and encodes an amino acid sequence having the amino acid sequence as set forth in SEQ ID NO:4 between amino acid positions 586-589 and the amino acid sequence as set forth in SEQ ID NO:6 between amino acid positions 327-332.

[0121] In some embodiments, the nucleic acid according to the present invention is capable of transcribing and expressing at least one, or any two, or all three AAV capsid proteins selected from the group consisting of: VP1, VP2, and VP3.

[0122] In some embodiments, the nucleic acid according to the present invention is introduced into the production cell in the form of a nucleic acid vector. In some embodiments, the nucleic acid vector further comprises a nucleic acid encoding an AAV REP protein. In some embodiments, the nucleic acid vector is a plasmid.

[0123] In some embodiments, the nucleic acid according to the present invention is stably transfected and integrated into the genome of the producer cell.

[0124] In other embodiments, the production cell further comprises (e.g., stably integrated) a nucleic acid encoding an AAV REP protein (particularly an AAV9 or AAV2 REP protein). In other embodiments, the production cell further comprises (e.g., stably integrated or introduced via a vector) a nucleic acid capable of providing helper virus functions in trans (e.g., E1a and E1b helper genes, and / or E4, E2a and VA helper genes from adenovirus).

[0125] In some embodiments, step (i) of the method according to the present invention comprises: introducing a recombinant AAV genome comprising a heterologous nucleic acid into a production cell according to any of the above embodiments. In some embodiments, the rAAV genome to be introduced into the host cell lacks AAV rep and cap DNA. In some embodiments, the rAAV genome to be introduced into the host cell comprises cap DNA encoding a capsid protein variant of the present invention, but lacks AAV rep DNA. In some embodiments, the rAAV genome is introduced into the host cell via an AAV transfer vector.

[0126] In some embodiments, the rAAV production method according to the present invention further comprises: a step of generating a production cell (or cell line). In some embodiments, the production cell (or cell line) expresses one or more of the following components necessary for rAAV genome packaging: an rAAV genome lacking AAV rep and cap genes, an AAV rep gene separated from the rAAV genome, and a cap gene encoding a capsid protein variant according to the present invention. Afterwards, the production cell can be infected with a helper virus (such as an adenovirus) to produce infectious rAAV virus particles.

[0127] In some preferred embodiments, the rAAV production method according to the present invention comprises: co-transfection with three plasmids to produce production cells (or cell lines), wherein the three plasmids are: a plasmid (transfer plasmid) providing an rAAV genome containing heterologous nucleic acid and flanking ITRs, a plasmid providing AAV auxiliary functions (cap and / or rep proteins), and a plasmid providing auxiliary virus (such as adenovirus or herpes simplex virus) functions. In other embodiments, the present invention also contemplates the use of adenovirus or baculovirus to replace the above-mentioned plasmids to introduce AAV auxiliary functions and auxiliary virus functions.

[0128] IV. rAAV vectors

[0129] In some aspects, the present invention provides a viral vector, which is a man-made recombinant viral particle. In some embodiments, the recombinant viral particle has an rAAV genome packaged in a viral capsid consisting of or mainly consisting of a capsid protein variant of the present invention. In some embodiments, the rAAV genome according to the present invention is a ssAAV genome or a scAAV genome.

[0130] In some embodiments, the recombinant AAV vector according to the present invention comprises in its genome:

[0131] a. AAV inverted terminal repeat (ITR) sequences, and

[0132] b. an expression construct comprising a heterologous nucleic acid, wherein the heterologous nucleic acid encodes a gene product of interest,

[0133] Preferably, the expression construct comprises the following elements functionally linked to each other in the transcriptional direction:

[0134] - promoter,

[0135] - a heterologous nucleic acid encoding a gene product of interest,

[0136] - Transcription terminator.

[0137] In some embodiments, the genome lacks AAV rep and cap DNA, ie, AAV rep and cap DNA are not present in the genome.

[0138] In some embodiments, the rAAV genome disclosed herein comprises two AAV ITRs flanking the expression construct. In some embodiments, the ITR sequences flanking the expression construct in the rAAV genome are native, variant or modified AAV ITR sequences. In some embodiments, at least one ITR sequence is a native, variant or modified AAV ITR sequence. In some embodiments, both ITR sequences are native, variant or modified AAV ITR sequences. In some embodiments, one of the two flanking ITRs is a modified AAV ITR sequence that allows the generation of a self-complementary genome, and the other ITR is a native AAV ITR sequence.

[0139] In the rAAV genome according to the present invention, the AAV ITR may be derived from or may be derived from any AAV serotype, including but not limited to AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, and AAV-13. The genomic sequences of various serotypes of AAV, as well as the natural inverted terminal repeats (ITRs), can be found in the literature or in public databases such as GenBank. See, e.g., GenBank Accession Nos. NC_002077 (AAV1), AF063497 (AAV1), NC_001401 (AAV2), AF043303 (AAV2), NC_001729 (AAV3), NC_001829 (AAV4), U89790 (AAV4), NC_006152 (AAV5), AF513851 (AAV7), AF513852 (AAV8), NC_006261 (AAV8), and AY530579 (AAV9). Publications describing AAV include Srivistava et al. (1983) J. Virol. 45:555; Chiorini et al. (1998) J. Virol. 71:6823; Chiorini et al. (1999) J. Virol. 73:1309; Bantel-Schaal et al. (1999) J. Virol. 73:939; Xiao et al. (1999) J. Virol. 73:3994; Muramatsu et al. (1996) Virol. 221:208; Shade et al. (1986) J. Virol. 58:921; Gao et al. (2002) Proc. Nat. Acad. Sci. USA 99:11854; Moris et al. (2004) Virology 33:375-383; International Patent Publication Nos. WO2018 / 222503A1, WO2012 / 145601A2, WO2000 / 028061A2, WO1999 / 61601A2, and WO1998 / 11244A2; U.S. Patent Application Nos. 15 / 782,980 and 15 / 433,322; and U.S. Patent No. 10,036,016 , 9,790,472, 9,737,618, 9,434,928, 9,233,131, 8,906,675, 7,790,449, 7,906,111, 7,718,424, 7,259,151, 7,198,951, 7,105,345, 6,962,815, 6,984,517 and 6,156,303.

[0140] In some embodiments, the heterologous nucleic acid contained in the rAAV genome is effectively linked to transcription control DNA, particularly promoter DNA, enhancer DNA and polyadenylation signal sequence DNA that are functional in the target cell to form an expression construct. The expression construct may also include intron sequences to facilitate the processing of RNA transcripts when expressed in mammalian cells.

[0141] The heterologous nucleic acid contained in the rAAV according to the present invention is not particularly limited. In some embodiments, the heterologous nucleic acid encodes a gene product to be expressed in a target tissue / cell (e.g., a muscle cell). In some embodiments, the expression of the gene product in the target cell / tissue will be beneficial to the treatment or prevention of a disease or disorder (e.g., myopathy, such as hereditary cardiomyopathy or hereditary skeletal myopathy) associated with a genetic defect of the tissue. In other embodiments, the heterologous nucleic acid comprises a polynucleotide encoding a marker or reporter protein.

[0142] In some embodiments, the target tissue / cell is a cardiomyocyte. In some embodiments, the cardiomyocyte includes atrial cardiomyocytes and / or ventricular cardiomyocytes. In some embodiments, the cardiomyocyte is a cardiomyocyte carrying a gene mutation associated with a cardiovascular disease or condition. In some embodiments, the cardiomyocyte is an in vitro or ex vivo cell. In other embodiments, the cardiomyocyte is an in vivo cardiomyocyte. In some embodiments, the expression of the gene product in cardiomyocytes / tissues will be beneficial to the treatment or prevention of a disease or condition (e.g., cardiovascular disease, such as heart failure or hereditary cardiomyopathy) associated with a genetic defect of the tissue. In other embodiments, the heterologous nucleic acid comprises a polynucleotide encoding a marker or reporter protein.

[0143] In some embodiments, the target tissue / cell is a skeletal muscle cell / tissue. In some embodiments, the skeletal muscle cell is a quadriceps, biceps and / or triceps. In some embodiments, the skeletal muscle cell is an intercostal muscle. In some embodiments, the skeletal muscle cell is a muscle cell carrying a gene mutation associated with myopathy. In some embodiments, the skeletal muscle cell is an in vitro or ex vivo muscle cell. In other embodiments, the skeletal muscle cell is an in vivo muscle cell. In some embodiments, the expression of the gene product in skeletal muscle cells / tissue will be beneficial to the treatment or prevention of a disease or disorder (e.g., skeletal muscle disease) associated with a genetic defect of the tissue. In other embodiments, the heterologous nucleic acid comprises a polynucleotide encoding a marker or reporter protein.

[0144] In some embodiments, the heterologous nucleic acid encodes a target gene product for gene replacement, gene suppression or gene editing. Preferably, the target gene product is a protein or RNA.

[0145] Gene replacement is the most "direct gene therapy method, which generally involves introducing a nucleic acid encoding a functional protein into a host cell and expressing it in the host cell to compensate for the lack of the functional protein caused by a defective gene in the host cell. As those skilled in the art will appreciate, depending on the size and properties of the functional protein, a full-length functional protein can be expressed by introducing a nucleic acid molecule encoding the protein into a host cell, or by introducing multiple nucleic acids encoding a portion of the protein into the same host cell. In some embodiments, the rAAV according to the present invention comprises an expression construct, wherein the expression construct comprises at least one heterologous nucleic acid for gene replacement operably linked to a promoter. In some embodiments, the at least one heterologous nucleic acid encodes a therapeutic protein.

[0146] Gene suppression can be achieved by RNA interference (RNAi) means such as antisense nucleic acids, siRNA or microRNA, to inhibit the expression or translation of defective genes in host cells, thereby treating or preventing functional disorders caused by the defective genes. In some embodiments, the rAAV according to the present invention comprises an expression construct, wherein the expression construct comprises at least one heterologous nucleic acid for gene suppression operably linked to a promoter. In some embodiments, the at least one heterologous nucleic acid, after being introduced into the host cell for expression, will result in the production of siRNA or microRNA to inhibit the expression or translation of defective genes in the host cell.

[0147] Gene editing is another gene therapy method for targeted repair of gene defects, including but not limited to ZFN, TALEN and CRISP / Cas editing. In some embodiments, the rAAV according to the present invention comprises an expression construct, wherein the expression construct comprises at least one heterologous nucleic acid for gene editing (especially CRISP / Cas9 editing) operably linked to a promoter. In some embodiments, the expression of the heterologous nucleic acid in the target cell / tissue will target the repair of the gene defect in the cell / tissue.

[0148] Without wishing to be bound by any theory, myopathies, including skeletal muscle diseases and cardiac myopathies, may be treated following expression of heterologous nucleic acids in rAAV according to the present invention.

[0149] Non-limiting examples of skeletal muscle diseases and exemplary proteins or genes that can be targeted for each skeletal muscle disease are listed below:

[0150] - Duchenne muscular dystrophy (DMD) and / or Becker Kiener muscular dystrophy, wherein an exemplary protein that can be targeted is dystrophin, and an exemplary gene that can be targeted is a dystrophin gene with a pathogenic mutation;

[0151] - X-linked myotubular myopathy (XLMTM), an exemplary protein that can be targeted is myotubularin, and an exemplary gene that can be targeted is the myotubularin gene (MTM1) with a pathogenic mutation.

[0152] Non-limiting examples of myocardial diseases and exemplary proteins or genes that can be targeted for each myocardial disease are listed below:

[0153] - Heart failure. For such diseases, examples of targets that can be used for AAV gene therapy can be selected from: SERCA2a, SUMO1, S100A1, I1c (constitutively active inhibitor-1), shRNA-PLB, βARKct, VEGF / Ang1, VEGF-A / PDGF-B, VEGF-B, Heme Oxygenase-1;

[0154] - Inherited cardiomyopathies (CM), including, but not limited to, hypertrophic cardiomyopathy (HCM), dilated cardiomyopathy (DCM), arrhythmogenic right ventricular cardiomyopathy (ARVC), restrictive cardiomyopathy (RCM), and left ventricular noncompaction cardiomyopathy (LVNC). For such diseases, examples of targets that can be used for AAV gene therapy can be selected from: TTN (Titin), LMNA (Lamin-A / C), MYH7 (Myosin Heavy Chain 7), MYH6 (Myosin Heavy Chain 6), SCN5a (Sodium Channel Protein Type 5, α Subunit), MYBPC3 (Cardiac-Type Myosin-Binding Protein C), TNNT2 (Cardiac Muscle Troponin T), RBM20 (RNA-Binding Protein 20, TNNI3 (Cardiac Troponin I), MYL2 (Regulatory Light Chain of Cardiac Myosinβ), MYL3 (Myosin Light Chain, Ventricular Isoform), PKP2 (Plakophilin 2), DSP (Desmoplakin), DSG2 (Desmoglein 2), DSC2

[0155] (Desmocolin 2), JUP (Junction Plakoglobin).

[0156] Other examples of myocardial diseases and therapeutic nucleic acids that can be used include, but are not limited to, Barth syndrome (Tafazzin); myocardial hypertrophy and heart failure (dODN, decoyoligodeoxynucleotides); myocardial cell loss or dysfunction (miRNAi-LRP6). See, for example, Kyle Chamberlain et al., Cardiac Gene Therapy with Adeno-Associated Virus-Based Vectors, 2017, Curr Opin Cardiol. 2017 May; 32 (3): 275–282; Huili Zhang et al., AAV-mediated gene therapy: Advancing cardiovascular disease treatment, Front. Cardiovasc. Med. 9: 952755.

[0157] In some embodiments, the heterologous nucleic acid encodes angiogenic growth factor for treating cardiovascular disease, for example, in an individual in need of induction of therapeutic angiogenesis (e.g., an individual with coronary artery disease or peripheral vascular disease). In some embodiments, the angiogenic growth factor is, for example, fibroblast growth factor, platelet-derived growth factor, hepatocyte growth factor, or hypoxia-inducible factor.

[0158] In other embodiments, the heterologous nucleic acid encodes SERCA2a, S100A1, Ilc, or βARKct, for example, to treat a subject with heart failure.

[0159] The promoter for being connected to heterologous nucleic acid in the expression construct is not particularly limited. In some embodiments of the rAAV vector disclosed herein, the heterologous nucleic acid encoding the gene product is effectively connected to a constitutive promoter. Suitable constitutive promoters include, for example, cytomegalovirus (CMV) promoters, CMV early enhancer / chicken β-actin (CBA) promoters / rabbit β-globin introns (CAG) 7, human elongation factor 1α promoter (EF1α), human phosphoglycerate kinase promoter (PGK), mitochondrial heavy chain promoter, ubiquitin promoter. In other embodiments, the heterologous nucleic acid encoding the gene product is effectively connected to an inducible promoter. In some cases, the heterologous nucleic acid encoding the gene product is effectively connected to a muscle tissue-specific or muscle cell type-specific regulatory element.

[0160] In addition to the promoter and the heterologous nucleic acid, other regulatory sequences may be included in the expression construct as needed. The terms "regulatory sequence" and "expression control sequence" are used interchangeably herein and refer to nucleic acid sequences that induce, inhibit or otherwise control the transcription of proteins of the coding nucleic acid sequence that is effectively connected thereto. Regulatory sequences may be, for example, initiation sequences, enhancer sequences, intron sequences, and transcription terminator sequences, etc. In some embodiments, the expression construct further comprises a Kozak sequence located upstream (i.e., 5') of the heterologous nucleic acid.

[0161] V. Pharmaceutical Compositions

[0162] In one aspect, the present invention provides a pharmaceutical composition comprising the rAAV vector of the present invention. The rAAV virions according to the present disclosure can be formulated according to known methods after purification to prepare pharmaceutically useful compositions. The compositions of the present disclosure can be formulated using techniques known in the art for administration to mammalian subjects, such as humans.

[0163] When the delivery system is formulated as a solution or suspension, the delivery system is in an acceptable carrier, such as an aqueous carrier. A variety of aqueous carriers can be used, such as water, buffered water, 0.8% saline, 0.3% glycine, hyaluronic acid, etc. These compositions can be sterilized by conventional well-known sterilization techniques, or can be aseptically filtered. The resulting aqueous solution can be packaged for use as is, or lyophilized, and the lyophilized preparation is combined with a sterile solution before administration.

[0164] The pharmaceutical composition according to the present invention may contain pharmaceutically acceptable auxiliary substances to approach physiological conditions, such as pH adjusters and buffers, tonicity adjusters, wetting agents, etc., such as sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, sorbitan monolaurate, triethanolamine oleate, etc. The pharmaceutical composition according to the present invention may or may not contain a preservative.

[0165] The genomic titer of a viral vector, such as the genomic titer of a viral vector in a composition and formulation disclosed herein, can be determined using a variety of standard methods, including, for example, using PCR to determine the genomic titer of a viral vector. The genomic titer of a viral vector is determined using qPCR and ddPCR.

[0166] In some embodiments, the pharmaceutical composition of the present invention is in the form of a pharmaceutical preparation formulated to deliver the AAV vector to the myocardium. The delivery can be direct intramuscular injection or delivery via vascular administration.

[0167] In some embodiments, the pharmaceutical compositions of the present invention can be formulated in a form suitable for the following routes of administration: by intramuscular injection, vascular delivery via the coronary arteries, systemic delivery via the superior vena cava, or systemic delivery via a peripheral vein.

[0168] In a preferred embodiment, the pharmaceutical composition of the present invention is in the form of a pharmaceutical preparation formulated for intravenous delivery.

[0169] VI. Uses of viral vectors

[0170] As a gene drug, the viral vector of the present invention can be physically introduced into a subject using any of a variety of methods and delivery systems known to those skilled in the art, including but not limited to intramuscular injection, vascular delivery through the coronary artery, systemic delivery through the superior vena cava or systemic delivery through a peripheral vein, intramuscular, subcutaneous, intraperitoneal, spinal or other non-parenteral administration, such as by injection or infusion.

[0171] AAV viral vectors with capsid protein variants of the present invention show improved targeting and transduction efficiency to muscle cells (especially cardiomyocytes and skeletal muscle cells); thus providing an effective gene delivery-based means for treating various myopathies (e.g., myocardial diseases and skeletal muscle diseases). In some aspects, the AAV viral vectors of the present invention preferably also show reduced liver and / or kidney cell transduction efficiency, thereby being suitable for formulation as AAV therapeutic drugs that target muscle cells / tissues while also requiring reduced liver / kidney toxicity.

[0172] In some embodiments, myopathy that can be treated with the viral vector of the present invention is skeletal muscle disease. Skeletal muscle disease is a group of diseases in which the body's skeletal muscle, under the damaging effects of certain causes, causes muscle fiber destruction as the main pathophysiological process, mainly including: inflammatory myopathy, muscular dystrophy, congenital myopathy, metabolic myopathy, ion channel disease, because of their low incidence, they are all rare diseases. The main clinical symptoms of skeletal muscle disease are muscle weakness, including proximal symmetrical limb weakness and distal asymmetrical muscle weakness; muscle pain, cramps and stiffness; muscle hypertrophy and atrophy. In addition, patients with skeletal muscle diseases are often accompanied by other systemic damage, such as scoliosis, joint contracture, arrhythmia, skin changes such as rash, endocrine metabolic abnormalities, etc. In some embodiments, skeletal muscle diseases that can be treated with the viral vector of the present invention are, for example, hereditary skeletal muscle defects, for example, hereditary skeletal muscle defects involving the quadriceps, biceps, triceps and / or intercostal muscles. In some embodiments, the skeletal muscle disease is selected from Duchenne muscular dystrophy and / or Becker-Kiener muscular dystrophy; X-linked myotubular myopathy.

[0173] In some embodiments, myopathy that can be treated with the viral vector of the present invention is a cardiovascular disease involving the myocardium. In some embodiments, cardiovascular diseases that can be treated with the viral vector of the present invention include coronary heart disease, cardiomyopathy, endocarditis, congenital cardiovascular defects, and congestive heart failure. In some embodiments, cardiovascular diseases or conditions that can be treated with the viral vector of the present invention include hypertrophic cardiomyopathy; valvular heart disease; myocardial infarction; congestive heart failure; long QT syndrome; atrial arrhythmias; ventricular arrhythmias; diastolic heart failure; systolic heart failure; heart valve disease; heart valve calcification; left ventricular noncompaction; ventricular septal defect; and ischemia. In some preferred embodiments, the cardiovascular disease is, for example, heart failure or genetic cardiomyopathy.

[0174] Example

[0175] The present invention is further described and illustrated with reference to the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all embodiments. Based on the embodiments in the present invention, the modifications or changes made to the embodiments of the present invention by those of ordinary skill in the art without departing from the spirit of the present invention all belong to the scope of protection of the present invention. Unless otherwise specified, the various reaction reagents involved in the embodiments can be purchased through commercial channels.

[0176] Example 1. Construction of a backbone plasmid for an AAV9 capsid protein variant library

[0177] 1.1. Construction of pRDAV-CMV-EGFP-Cap9 backbone plasmid (Construct 1)

[0178] The original plasmid pRDAV-CMV-EGFP (basket gene storage) contains EcoRI and MluI restriction sites after EGFP. Construct 1 (such as Figure 1 Schematically shown).

[0179] Amplification of the complete ORF fragment of Cap9

[0180] Using the complete AAV9 genome as a template, PCR amplified the complete Cap9 ORF fragment and introduced restriction sites, wherein the Cap9 complete ORF fragment refers to an ORF fragment starting from the P40 promoter and ending at the Cap9 termination codon TAA, with a length of 2637 bp, wherein a restriction endonuclease MluI restriction site is introduced at the P40 end, and a restriction endonuclease EcoRI restriction site is introduced at the Cap9 termination codon end.

[0181] The primer sequences used in the PCR amplification are as follows:

[0182] Upstream primer (SEQ ID NO: 10): ACGCGTacgtcaaaaagggtggagc

[0183] Downstream primer (SEQ ID NO: 11): GAATTCttacagattacgagtcaggtatctg

[0184] The PCR amplification program was as follows: pre-denaturation at 95°C for 2 min, denaturation at 95°C for 15 s, annealing at 56°C for 15 s, extension at 72°C for 30 s, repeated denaturation to extension for 35 cycles, finishing extension at 72°C for 2 min, and termination at 4°C.

[0185] Generation of construct 1

[0186] The PCR product was digested with EcoRI and MluI and recovered by gel electrophoresis to obtain the target fragment. The original plasmid pRDAV-CMV-EGFP was double digested with EcoRI and MluI, and the obtained target fragment was connected to the digested plasmid backbone to obtain the plasmid backbone pRDAV-CMV-EGFP-Cap9, i.e., construct 1 ( Figure 1 The size is 10191 bp and the sequence is shown in SEQ ID NO.1.

[0187] 1.2 Construction of pRDAV-CMV-EGFP-Cap9Δ-588 backbone plasmid (Construct 2)

[0188] The fragment from the 881st base position (c.881) to the 1985th base position (c.1985) on the wild-type Cap9 gene was selected, and the alanine codon corresponding to the amino acid 587 position was mutated to a tyrosine codon (A587Y), and the three bases encoding the original 588 amino acid residue were replaced with the GGTAACCGTT AACTT sequence (the sequence contains BestEII and HpaI restriction sites), thereby obtaining the Cap9Δ-588 sequence encoding the 587 mutation and the 588 deletion. The DraIII restriction site was introduced at the c.881 position of the Cap9Δ-588 sequence, and the BamHI restriction site was introduced at the c.1985 position, and the gene synthesis was entrusted to Qingke Biotechnology Co., Ltd. The synthetic product was constructed into construct 1 by enzyme ligation to replace the corresponding fragment located between the DraIII and BamHI restriction sites in the original Cap9, and construct 2, i.e., pRDAV-CMV-EGFP-Cap9Δ-588. The sequence of construct 2 is shown as SEQ ID NO.2.

[0189] Example 2. AAVΔ-588 capsid variant virus library

[0190] In this example, the construct 2 prepared in Example 1 (ie, plasmid pRDAV-CMV-EGFP-Cap9Δ-588) was used as the backbone to construct an AAVΔ-588 capsid variant virus library. The specific method is as follows.

[0191] 2.1 Obtaining linearized backbone vector

[0192] Construct 2 in Example 1 was used as the backbone vector, and double digested with BestEII and HpaI to linearize the backbone vector. The digestion system was: construct 2 (3 μg), CutSmart Buffer (5 μL), restriction endonuclease BestEII (0.5 μL), restriction endonuclease HpaI (0.5 μL), water was added to 50 μL, and incubated at 37°C for 3 to 4 hours. After digestion, the linearized vector was recovered by gel cutting.

[0193] 2.2 Synthesis of Oligo Library

[0194] The Oligo sequence used is as follows:

[0195] Oligo-F: GTAACNNNNNNNNN

[0196] Oligo-R: NNNNNNNNN

[0197] Oligo was denatured at 95 degrees and slowly annealed at room temperature to obtain the annealing product.

[0198] 2.3 Library construction and screening

[0199] The oligo annealing product was connected to the linearized backbone (construct 2) using T4 DNA ligase to obtain a recombinant plasmid. The ligation system was: annealing product (2 μL), linearized backbone vector (25 ng), T4 DNA ligase (0.5 μL), ligation buffer (5 μL), water was added to 10 μL, and incubated at 16°C overnight to obtain a recombinant plasmid with oligo inserted.

[0200] The recombinant plasmid was transformed into E. coli HB101 competent cells as follows.

[0201] 1) Add 10 μl of recombinant plasmid to 100 μl of HB101 competent cells in Eppendorf tubes, tap the tube wall several times to mix thoroughly, and place on ice for 30 min;

[0202] 2) Place the Eppendorf tube in a 42°C water bath for 90 seconds;

[0203] 3) Slowly add 0.5 mL of LB medium into the Eppendorf tube and shake at 37°C, 80 rpm for 45 min;

[0204] 4) Spread the bacterial solution on LB plates containing ampicillin (0.1 g / L) and culture at 37°C overnight.

[0205] A single colony was randomly picked and inoculated into a culture tube (LB medium containing 0.1 g / L ampicillin), and cultured overnight at 37°C with shaking at 200 rpm.

[0206] According to the instructions of the plasmid small-scale extraction kit (Shanghai Jierui Bioengineering Co., Ltd., GK2004-200), the bacterial precipitate was collected, and then the bacterial lysis, column loading, washing, elution and other steps were performed to collect the plasmid DNA.

[0207] The positive plasmids that passed the concentration test and enzyme digestion identification were numbered and 10 μL were taken for sequencing. The positive plasmids were stored in a -20°C refrigerator to obtain the AAVΔ-588 capsid variant virus library, which was a library of transfer plasmids carrying AAV ITR and expressing variant CAP9 and green fluorescent protein eGFP.

[0208] 2.4 Packaging and production of mutant AAV viruses and control AAV viruses

[0209] Reference (Xiao X, et al. Production of High-Titer Recombinant Adeno-Associated Virus Vectors in the Absence of Helper Adenovirus. J Virol. 1998; 72(3): 2224-2232), the three-plasmid packaging system was used to package and purify the recombinant AAV virus. In brief, the packaging plasmid expressing the Rep gene of AAV, the auxiliary plasmid providing the auxiliary function of AdV, and the transfer plasmid carrying the ITR of AAV and expressing the variant CAP9 and the green fluorescent protein eGFP (inserted with the variant of CAP9) were Figure 2 The plasmids shown) or transfer plasmids expressing wild-type CAP9 and green fluorescent protein eGFP ( Figure 1 The plasmids shown in the figure were mixed at a molar ratio of 1:1:1 and co-transfected into HEK293 cells using the calcium phosphate method. 72 hours after transfection, cells and culture supernatants were collected and the recombinant AAV virus was purified using the PEG8000-NaCl&CH3Cl extraction method. The AAV virus product was dissolved in 0.01% Pluronic F68-PBS, and the rAAV titer was determined by dot hybridization.

[0210] After preliminary experiments, a recombinant AAV virus that effectively transduces cardiomyocytes was selected, and an AAV capsid variant virus numbered CapX-123 was obtained for further experiments. The coding sequence of the CAP9 variant in the recombinant AAV virus numbered CapX-123 was sequenced, and its corresponding amino acid sequence was obtained as shown in SEQ ID NO.3. The sequence information obtained by sequencing was compared with the original capsid protein (CAP9) sequence, and the variant had mutations at positions 587 and 588 corresponding to the original sequence (SEQ ID NO:9). Residues 587 and 588 (AQ) of the original sequence were replaced by the amino acid sequence (YGNSPSKL) shown in SEQ ID NO.4 in the CAP9 variant of CapX-123 (see Fig. 9 ).

[0211] Example 3. AAVΔ-328 capsid variant virus library

[0212] In this example, the construct 1 prepared in Example 1 (ie, plasmid pRDAV-CMV-EGFP-Cap9) was used as the backbone to construct an AAVΔ-328 capsid variant virus library. The specific method is as follows.

[0213] 3.1. Obtaining nucleic acid fragments encoding the upstream and downstream sequences of the 328th amino acid residue site in the Cap9 protein sequence

[0214] Using the original AAV9 Cap9 gene sequence on construct 1 as a template, nucleic acid fragments encoding the upstream and downstream sequences of the 328th amino acid residue site in the Cap9 protein sequence were amplified by PCR to obtain the corresponding PCR products, fragment 1 and fragment 2. The primer set sequences used are as follows:

[0215] Primer Set 1:

[0216] Forward primer 1 (SEQ ID NO: 12): cactgccacttctcaccac

[0217] Reverse Primer 1 (SEQ ID NO: 13): gtccgtaacctctttgacctgaat

[0218] The program used for PCR amplification was: denaturation at 95°C for 15 s, annealing at 57°C for 30 s, and extension at 72°C for 30 s. The PCR product was subjected to gel electrophoresis and purified using a gel purification recovery kit to obtain fragment 1 with a size of ∼120 bp.

[0219] Primer set 2:

[0220] Forward Primer 2 (SEQ ID NO: 14): aggtcaaagaggttacggacNNNNNNNNNNNNaagaccatcgccaataacc Reverse Primer 2 (SEQ ID NO: 15): tgttgaaggccgttggagg

[0221] The program used for PCR amplification was: denaturation at 95°C for 15 s, annealing at 58°C for 30 s, and extension at 72°C for 15 s. The PCR product was subjected to gel electrophoresis and purified using a gel purification recovery kit to obtain fragment 2 containing a random sequence with a size of ∼1 kb.

[0222] 3.2. Homologous recombination plasmid using PCR fragments

[0223] i) Vector backbone acquisition

[0224] After double digestion of construct 1 with DraIII and BamHI, the linearized vector backbone with a size of 9.1 Kb was obtained by gel electrophoresis.

[0225] ii) Obtaining recombinant plasmid

[0226] According to the instructions of the TAKARA fusion kit (Clontech, 638948), the In-Fusion cloning reaction system was prepared, and fragments 1 and 2 were subjected to an In-Fusion reaction with the linearized backbone vector in i) above in the reaction system (incubated at 50° C. for 15 minutes) to obtain a recombinant plasmid.

[0227] 3.3. Transformation of E. coli HB101 competent cells with recombinant plasmid

[0228] 1) Add 10 μl of the recombinant plasmid prepared in Example 3.2 to the Eppendorf tube containing 100 μl of HB101 competent cells, gently tap the tube wall several times, mix thoroughly, and place on ice for 30 min;

[0229] 2) Place the Eppendorf tube in a 42°C water bath for 90 seconds;

[0230] 3) Slowly add 0.5 mL of LB medium into the Eppendorf tube and shake at 37°C, 80 rpm for 45 min;

[0231] 4) Spread the bacterial solution in the Ep tube on an LB plate containing ampicillin (0.1 g / L) and culture at 37°C overnight.

[0232] 3.4. Screening of positive clones

[0233] For the colonies grown on the LB plate cultured overnight in Example 3.3, a single colony was randomly picked and inoculated into a culture tube containing LB medium containing 0.1 g / L ampicillin, and cultured overnight at 37° C. with shaking at 200 rpm.

[0234] 3.5. Plasmid extraction

[0235] According to the instructions of the plasmid small-scale extraction kit (Shanghai Jierui Bioengineering Co., Ltd., GK2004-200), the bacterial precipitate was collected, and then the steps of bacterial lysis, column loading, washing, elution and the like were performed to collect the plasmid DNA.

[0236] The positive plasmids that passed the concentration test and enzyme digestion identification were numbered and 10 μL were taken for sequencing. The positive plasmids were stored in a -20°C refrigerator to obtain the AAVΔ-328 capsid variant virus library, which was a library of transfer plasmids carrying AAV ITR and expressing variant CAP9 and green fluorescent protein eGFP.

[0237] 3.6. Packaging of mutant AAV viruses and control AAV viruses

[0238] Reference (Xiao X et al., Production of High-Titer Recombinant Adeno-Associated Virus Vectors in the Absence of Helper Adenovirus. J Virol. 1998; 72(3): 2224-2232), the three-plasmid packaging system was used to package and purify the recombinant virus. The packaging plasmid expressing the Rep gene of AAV, the helper plasmid, and the transfer plasmid carrying the ITR of AAV obtained in Example 3.5 and expressing the variant CAP9 and the green fluorescent protein eGFP or the transfer plasmid expressing the wild-type CAP9 and the green fluorescent protein eGFP ( Figure 1 The plasmids were mixed at a molar ratio of 1:1:1 and co-transfected into HEK293 cells using the calcium phosphate method. After 72 h, the cells and culture supernatant were collected and PEG8000-NaCl&CH 3 The recombinant AAV virus was purified by Cl extraction. The AAV virus product was dissolved in 0.01% F68-PBS, and the rAAV titer was determined by dot hybridization.

[0239] After preliminary experiments, a recombinant AAV virus that effectively transduces skeletal muscle cells was selected, and a recombinant AAV virus numbered CAPX-528 was obtained for further experiments. The coding sequence of the CAP9 variant in the recombinant AAV virus numbered CapX-528 was sequenced, and its corresponding amino acid sequence was obtained as shown in SEQ ID NO.5. The sequence information obtained by sequencing was compared with the original CAP9 sequence, and it was found that the CAP9 sequence in the CAPX-528 recombinant AAV virus had mutations at positions 328-331. The residues 328-331 (NNGV) of the original sequence were replaced by the amino acid sequence (KTSC) shown in SEQ ID NO.6 in the CAP9 variant of CapX-528 (see Fig. 9 ).

[0240] Example 4. Biodistribution of AAV capsid variant viruses in mice

[0241] 4.1. AAV virus injection

[0242] 6-8 weeks, 18-20g male SPF-grade C57 mice were selected, and rAAV9 virus encoding fluorescent protein eFGP and having wild-type CAP9 capsid protein was used as a control, and AAV capsid variant viruses CapX-123 and CapX-528 obtained in Examples 2 and 3 were used as experimental groups, with at least 3 mice in each group. rAAV9 virus or capsid variant virus CapX-123 or CapX-528 was injected via the tail vein at a dose of 2E13 vg / kg. After injection, the mice were euthanized 28 days later and mouse tissues were obtained. Frozen sections of each tissue were prepared to observe EGFP fluorescence.

[0243] 4.2. Mouse tissue sections and immunofluorescence comparison

[0244] A. Preparation of frozen sections

[0245] 1) Tissue fixation: Fix the tissue with fresh tissue fixative for more than 24 hours, remove the tissue from the fixative, and use a scalpel to smooth the tissue at the target site.

[0246] 2) Dehydration: Place the trimmed tissue in a 15% sucrose solution and dehydrate it in a 4°C refrigerator until it sinks to the bottom. Then transfer it to a 30% sucrose solution and dehydrate it in a 4°C refrigerator until it sinks to the bottom.

[0247] 3) OCT embedding: Take out the dehydrated tissue, use filter paper to slightly absorb the surface water, place it on the embedding table with the cut surface facing up, drip OCT embedding agent around the tissue, and place the embedding table on the quick freezing table of the freezing microtome for quick freezing embedding. After the OCT turns white and hardens, it can be sliced. Fresh tissue does not need to be fixed and dehydrated for direct frozen sectioning. Use a scalpel to directly flatten the tissue of the target area, and then embed the slices with OCT embedding agent.

[0248] 4) Sectioning: Fix the embedding table on the slicer, make a rough cut first, and then start slicing after the tissue surface is trimmed flat. The slice thickness is 8-10μm. Place a clean slide flat on the cut tissue slice, then stick the tissue on the slide and write a label.

[0249] B. Observe fluorescence

[0250] The frozen sections were protected with anti-fading mounting medium (ProLong, Thermo Fischer), and the EGFP protein was observed and images were collected under a fluorescence microscope using a blue excitation band module (488 nm). The images were statistically analyzed using ImageJ software.

[0251] result

[0252] The experimental results showed that compared with the control group, after the AAV virus with the capsid protein mutant CapX-123 was injected through the tail vein, the fluorescence intensity in the mouse cardiomyocytes was significantly enhanced, and the number of infected cardiomyocytes increased significantly ( Figure 3 ).

[0253] The experimental results also showed that compared with the control group, after the AAV with the capsid protein mutant CapX-528 was injected through the tail vein, the fluorescence intensity in the mouse skeletal muscle cells was significantly enhanced, and the number of infected biceps and quadriceps cells increased significantly ( Figure 4 ).

[0254] The above results indicate that the AAV capsid protein mutant CapX-123 can significantly enhance the transduction efficiency to the myocardium, while the AAV capsid protein mutant CapX-528 can significantly enhance the transduction efficiency to the skeletal muscle.

[0255] Example 5. Construction of AAV9 double-site (328 and 588 sites) modified capsid variant virus

[0256] 5.1. PCR amplification of capsid variant fragments

[0257] PCR amplification was performed using the transfer plasmids CapX-123 and CapX-528 used to prepare the CAPX-123 and CAPX-528 recombinant AAV viruses as templates. In short, the genomic fragment Cap9 sequence of the plasmid CapX-123 was used as a template to PCR amplify the sequence containing the mutation at site 588 in the plasmid CapX-123 to obtain PCR fragment 1 (Fragment 1); the genomic fragment Cap9 sequence of the plasmid CapX-528 was used as a template to PCR amplify the sequence containing the mutation at site 328 in the plasmid CapX-528 to obtain PCR fragment 2 (Fragment 2). The primer sequences used are as follows:

[0258] Primer Set 1:

[0259] Forward primer (SEQ ID NO: 16): CGTCGCAAATGCTAAGAACG

[0260] Reverse primer (SEQ ID NO: 17): GCCCAAATGGGTCCTTGC

[0261] The procedure used for PCR amplification was: denaturation at 95°C for 15 s, annealing at 57°C for 30 s, and extension at 72°C for 30 s. The product was subjected to gel electrophoresis and purified using a gel purification recovery kit to obtain fragment 1 with a size of ∼635 bp.

[0262] Primer set 2:

[0263] Forward primer (SEQ ID NO: 18): TGTGTTGGTTTTTTTCTAGAGAATTCT

[0264] Reverse primer (SEQ ID NO: 19): CGTTCTTAGCATTTGCGACG

[0265] The PCR amplification procedure was as follows: denaturation at 95°C for 15 s, annealing at 58°C for 30 s, and extension at 72°C for 15 s. The product was subjected to gel electrophoresis and purified using a gel purification recovery kit to obtain fragment 2 with a size of ∼1.67 kb.

[0266] 5.2 Homologous recombination plasmid using PCR fragments

[0267] i) Vector backbone acquisition

[0268] After construct 2 was double-digested with XbaI and PpuMI, it was recovered by gel electrophoresis to obtain a vector backbone with a size of 7.9 kb.

[0269] ii) Obtaining recombinant plasmid

[0270] According to the instructions of the TAKARA fusion kit (Clontech, 638948), the In-Fusion cloning reaction system was prepared, and fragments 1 and 2 were subjected to an In-Fusion reaction with the linearized backbone vector in i) above in the reaction system (incubated at 50° C. for 15 minutes) to obtain a recombinant plasmid.

[0271] 5.3 Transformation of recombinant plasmid into competent E. coli HB101 cells

[0272] 1) Add 10 μL of the recombinant plasmid prepared in Example 5.2 to the Eppendorf tube containing 100 μL of HB101 competent cells, gently tap the tube wall several times, mix thoroughly, and place on ice for 30 min;

[0273] 2) Place the Eppendorf tube in a 42°C water bath for 90 seconds;

[0274] 3) Slowly add 0.5 mL of LB medium into the Eppendorf tube and shake at 37°C, 80 rpm for 45 min;

[0275] 4) Spread the bacterial solution in the Ep tube on an LB plate containing ampicillin (0.1 g / L) and culture at 37°C overnight.

[0276] 5.4 Screening of positive clones

[0277] For the colonies grown on the LB plate cultured overnight in Example 5.3, a single colony was randomly picked and inoculated into a culture tube containing LB medium containing 0.1 g / L ampicillin, and cultured overnight at 37° C. with shaking at 200 rpm.

[0278] 5.5 Plasmid extraction

[0279] According to the instructions of the plasmid small-scale extraction kit (Shanghai Jierui Bioengineering Co., Ltd., GK2004-200), the bacterial precipitate was collected, and then the steps of bacterial lysis, column loading, washing, elution and the like were performed to collect the recombinant plasmid.

[0280] The positive plasmid (pRDAV-CMV-EGFP-P40-CAPX123 / 528) that has been tested for concentration and identified by enzyme digestion (such as Figure 5 The CAP9 variant encoded in the recombinant plasmid was numbered as shown in SEQ ID NO.7 and 10 μL was taken for sequencing. The CAP9 variant encoded in the recombinant plasmid was sequenced, and its corresponding nucleotide sequence was shown in SEQ ID NO.7 and its corresponding amino acid sequence was shown in SEQ ID NO.8.

[0281] 5.6 Packaging of AAV capsid mutant virions

[0282] According to the same method as described in Example 3.6, the AAV capsid mutant virion CAP-X123 / 528 was packaged and purified. In brief, the three-plasmid packaging system was used to package and purify the recombinant virus. The packaging plasmid expressing the Rep gene of AAV, the auxiliary plasmid, and the transfer plasmid obtained in Example 5.5 (pRDAV-CMV-EGFP-P40-CAPX123 / 528, which carries the ITR of AAV and expresses the variant CAP9 and the green fluorescent protein eGFP) or the transfer plasmid expressing the wild-type CAP9 and the green fluorescent protein eGFP ( Figure 1The plasmids were mixed at a molar ratio of 1:1:1 and co-transfected into HEK293 cells using the calcium phosphate method. After 72 h, the cells and culture supernatant were collected and PEG8000-NaCl&CH 3 The recombinant AAV virus was purified by Cl extraction method. The recombinant AAV virus with the number of CAP-123 / 528 was obtained, and the AAV virus product was dissolved with 0.01% F68-PBS, and the rAAV titer was determined by dot hybridization method.

[0283] Example 6. Biodistribution of AAV capsid variant viruses in mice

[0284] According to the method described in Example 4, an animal experiment was conducted, in which the AAV virus injection dose used was 5E+13vg / kg mouse body weight. In brief, 6-8 weeks, 18-20g male SPF-grade C57 mice were selected, and rAAV9 virus encoding fluorescent protein eFGP and having wild-type CAP9 capsid protein was used as a control, and the AAV capsid variant virus CapX-123 / 528 obtained in Example 5 was used as an experimental group, with at least 3 mice in each group. The rAAV9 virus or the capsid variant virus CapX-123 / 528 was injected through the tail vein at a dose of 5E13 vg / kg. After injection, the mice were euthanized 28 days later and the mouse tissues were obtained. Frozen sections of each tissue were prepared to observe EGFP fluorescence.

[0285] result

[0286] The experimental results showed that compared with the control group, the transduction intensity of AAV virus with capsid protein mutant CapX123 / 528 was significantly improved in most skeletal muscle groups after tail vein injection ( Figure 6 ). From the fluorescence analysis results of ImageJ software ( Figure 7 ), compared with the control group, after CapX123 / 528 infection, the fluorescence intensity value in the quadriceps femoris of mice increased by 3.27 times; in the biceps brachii increased by 1.93 times; in the triceps brachii increased by 1.58 times; in the intercostal muscle increased by 2.4 times; and the intensity of EGFP transduced in the gastrocnemius muscle fibers also increased slightly (1.08 times), but not significantly.

[0287] The experimental results also showed that compared with the control group, the transduction intensity of AAV virus with capsid protein mutant CapX123 / 528 in the liver and kidney decreased significantly after tail vein injection, falling to 32% and 29% of the transduction intensity of AAV9, respectively. In addition, the myocardial transduction ability of CAPX123 / 528 was significantly improved, which was 3.9 times higher than that of AAV9 ( Figure 8 ).

[0288] The above results indicate that the AAV capsid protein mutant CapX123 / 528 can significantly enhance the transduction efficiency of skeletal muscle and myocardium while reducing liver and kidney toxicity, and can be used as a better choice for AAV treatment of skeletal muscle and myocardial diseases.

[0289]

[0290]

[0291]

[0292]

[0293]

[0294]

[0295]

[0296]

Claims

1. An adeno-associated virus (AAV) capsid protein variant, wherein the variant has the following mutations relative to the parent AAV capsid protein: (a) an amino acid sequence mutation between amino acid positions 586 and 589, wherein the mutation replaces residues 587-588 of the parent AAV capsid protein, and (b) an amino acid sequence mutation between amino acid positions 327 and 332, wherein the mutation replaces residues 328-331 of the parent AAV capsid protein, The amino acid positions are numbered according to SEQ ID NO:

9.

2. The AAV capsid protein variant according to claim 1, wherein the variant has the following mutations relative to the parent AAV capsid protein: (a) replacing residues 587-588 of the parent AAV capsid protein with the amino acid sequence shown in SEQ ID NO:4, and (b) replacing residues 328-331 of the parent AAV capsid protein with the amino acid sequence shown in SEQ ID NO:6, Preferably, wherein The capsid protein variants confer increased transduction of cardiac and skeletal muscle cells, and optionally reduced transduction of liver and kidney cells, to AAV virions comprising the capsid protein compared to the parent AAV capsid protein.

3. The capsid protein variant according to claim 1 or 2, wherein the parent AAV capsid protein is an AAV9 capsid protein.

4. The capsid protein variant of any one of claims 1 to 3, wherein the parent AAV capsid protein is an AAV9 capsid protein comprising or consisting of the following amino acid sequence: (a) an amino acid sequence of amino acids 203 to 736 of SEQ ID NO:9; (b) an amino acid sequence of amino acids 137 to 736 of SEQ ID NO: 9; or (c) The amino acid sequence of SEQ ID NO:

9.

5. The capsid protein variant according to any one of claims 1 to 4, wherein the capsid protein variant is a VP1, VP2 or VP3 capsid protein variant, for example, the capsid protein variant: (a) comprising an amino acid sequence of SEQ ID NO: 8; (b) is encoded by a nucleic acid comprising SEQ ID NO: 7 or a nucleotide sequence that differs from the nucleotide sequence of SEQ ID NO: 7 due to the degeneracy of the genetic code; or (c) derived from a transcript encoding the amino acid sequence of SEQ ID NO:8 or comprising the nucleotide sequence of SEQ ID NO:

7.

6. An isolated nucleic acid, wherein the nucleic acid comprises a polynucleotide sequence encoding the AAV capsid protein variant of any one of claims 1-5.

7. A nucleic acid according to claim 6, comprising: (a) a polynucleotide encoding the amino acid sequence of SEQ ID NO: 8; or (b) The nucleotide sequence of SEQ ID NO:

7.

8. The nucleic acid according to claim 6 or 7, wherein the nucleic acid is capable of transcribing and expressing at least one or any two or all three AAV capsid proteins selected from the following: VP1, VP2 and VP3.

9. A nucleic acid vector, e.g., a nucleic acid expression vector, comprising the nucleic acid of any one of claims 6-8, and optionally further comprising a polynucleotide encoding an AAV REP protein.

10. An isolated host cell comprising the nucleic acid of any one of claims 6-8, optionally wherein the nucleic acid stably transfects the host cell, preferably, the host cell further comprises a nucleic acid encoding an AAV REP protein and / or a nucleic acid encoding a helper virus function.

11. Use of the nucleic acid according to any one of claims 6 to 8, the nucleic acid vector according to claim 9, or the host cell according to claim 10 for preparing a recombinant adeno-associated virus (rAAV) vector.

12. A recombinant adeno-associated virus (rAAV) vector comprising the capsid protein variant according to any one of claims 1 to 5, Preferably, the rAAV exhibits increased transduction of cardiomyocytes and skeletal muscle cells and optionally reduced transduction of liver and / or kidney cells relative to wild-type AAV.

13. The rAAV vector according to claim 12, wherein the rAAV vector comprises in its genome: a. 5' and 3' AAV inverted terminal repeat (ITR) sequences, and b. An expression construct comprising a heterologous nucleic acid located between the 5' and 3' ITRs, wherein the heterologous nucleic acid encodes a gene product of interest.

14. The rAAV vector according to claim 13, wherein the expression construct comprises the following elements functionally linked to each other in the transcriptional direction: - promoter, - a heterologous nucleic acid, - Transcription terminator.

15. The rAAV vector according to claim 13 or 14, wherein the heterologous nucleic acid encodes a target gene product for gene replacement, gene suppression or gene editing, preferably, the target gene product is a protein or RNA.

16. A pharmaceutical composition comprising the recombinant AAV viral vector according to any one of claims 12 to 15 and a pharmaceutically acceptable carrier.

17. A method for delivering a heterologous nucleic acid to a subject in need thereof, wherein the method comprises administering to the subject a recombinant AAV viral vector of any one of claims 12-15 or a pharmaceutical composition of claim 16, e.g., by direct intracardiac or intramuscular injection or via vascular administration (e.g., intravenous injection), e.g., for the treatment or prevention of myopathy.

18. Use of the recombinant AAV viral vector according to any one of claims 12-15 for preparing a pharmaceutical composition for treating or preventing myopathy, preferably, administering the pharmaceutical composition by direct intramuscular injection or vascular administration (eg, intravenous injection).

19. The method of claim 17 or the use of claim 18, wherein the method or the use is for treating or preventing heart failure or a genetic cardiomyopathy.

20. The method of claim 17 or the use of claim 18, wherein the method or the use is for the treatment or prevention of a skeletal muscle disease.

21. A method for delivering a heterologous nucleic acid to cells cultured in vitro or in vitro, comprising contacting the cells with a rAAV viral vector according to any one of claims 12-15, wherein the cells are muscle cells (eg, cardiomyocytes or skeletal muscle cells).

Images