Construction method of tissue engineering skin organoid and UVB-induced skin organoid aging model

Abstract

The invention discloses a construction method of a tissue engineering skin organoid, which comprises the following steps: dissecting a primary skin organoid obtained by induced differentiation of iPSCs (induced pluripotent stem cells), inoculating a transparent sacculus-shaped structure on a decellularized pigskin scaffold in an inoculation mode that an epidermal layer faces upwards and a corium layer faces downwards, and culturing by adopting a gas-liquid interface culture system to obtain the tissue engineering skin organoid. The structure of the tissue engineering skin-like organ is close to the physiological anatomical structure of the human skin. The tissue engineering skin organ provided by the invention can be applied to the fields of disease model construction, drug screening and toxicity testing, skin injury and repair regeneration, skin development and the like. UVB irradiation treatment is carried out on the tissue engineering skin organoid, so that human skin organoid aging can be induced, and a UVB induced skin organoid aging model is constructed.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to a method for constructing tissue engineering skin organoids and a UVB-induced skin organoid aging model. Background Art

[0002] Organoids are organ-specific products obtained by culturing embryonic stem cells (ESCs), induced pluripotent stem cells (iPSCs), or stem and progenitor cells derived from tissues in vitro using three-dimensional culture technology.

[0003] Skin organoids are an emerging organoid model that can be differentiated from induced pluripotent stem cells (iPSCs) or totipotent stem cells. They generally have a transparent spherical head and an opaque tail. They can partially simulate the structure and function of real skin tissue and simulate in vivo communication. They can replace animal models to a certain extent and are now widely used in research fields such as skin development, disease models, and drug screening. Compared with traditional 2D cell models, organoid models have more stable genetic and phenotypic characteristics during in vitro culture, as well as a richer variety of cell types.

[0004] Existing in vitro skin research models are mainly based on 2D skin cells cultured in vitro and 3D self-assembled skin cell models. There is still a big gap between the interlayer interaction and the real physiological state, and there is a lack of structures such as skin appendages, which is very different from the real skin. Using human iPSCs, it is currently possible to construct cystic skin organoids similar to the skin of an 18-week human fetus, which are composed of stratified epidermis, fat-rich dermis, pigmented hair follicles with sebaceous glands, sensory neurons, Schwann cells, and touch-related Merkel cells. The skin organoids can form hair-containing skin organoids on the back of nude mice. However, the limitation of existing skin organoids is mainly the anatomical layer disorder caused by their spherical growth. The outermost layer of the normal skin structure is the stratum corneum formed by keratinocytes, which serves as a physical barrier of the skin and falls off when the cells age and die. Skin organoids form spherical vesicles, in which the hair shaft grows inward toward the fluid-filled core, accompanied by hair follicles protruding outward from the surface of the vesicle. During the culture of skin organoids, the cystic structure restricts shedding and accumulates keratinized tissue in the core. Thus, at late stages in culture (>150 days), floating dead keratinocytes can be observed growing out onto the surface of organoids. This ingrowth property makes the organizational structure of skin organoids anatomically and histologically distinct from the physiological skin structure.

[0005] There is currently no UVB-induced skin organoid aging model. Summary of the invention

[0006] The first object of the present invention is to provide a tissue engineered skin organoid and a construction method thereof to solve at least one of the above-mentioned technical problems.

[0007] The second object of the present invention is to provide a UVB-induced skin organoid aging model to solve at least one of the above-mentioned technical problems.

[0008] According to one aspect of the present invention, a method for constructing a tissue engineered skin organoid is provided, comprising the following steps:

[0009] (1) iPSCs were induced to differentiate and further cultured to days 85 to 100 to construct primary skin organoids;

[0010] (2) Slicing the decellularized pig skin to a thickness of 90 to 110 μm to obtain decellularized pig skin slices;

[0011] (3) After dissecting the primary skin organoid, the transparent spherical structure is taken out and inoculated on the decellularized pig skin slice with the inner surface facing up and the outer surface facing down to obtain a composite;

[0012] (4) The complex is cultured at an air-liquid interface for 10 to 21 days to obtain tissue-engineered skin organoids.

[0013] The present invention adopts the method of "dissection and inoculation" to dissect the primary skin organoids obtained by inducing differentiation of iPSCs and having a transparent spherical head structure with the dermis structure facing outward and the epidermis structure facing inward, remove the tail composed of dense opaque cell clusters, and then cut open the transparent spherical structure and inoculate it on a decellularized pig skin scaffold in an inoculation manner with the epidermis layer facing up and the dermis layer facing down, and culture it using an air-liquid interface culture system to construct a tissue-engineered skin organoid.

[0014] The tissue-engineered skin organoids provided by the present invention include the epidermis, basal layer, dermis (fibroblasts), hair follicles, pigment cells, sebaceous glands, sensory neurons, Merkel cells and other skin appendages, presenting an anatomical structure from top to bottom, which is close to the physiological anatomical structure of human skin, and the epidermis is closer to the physiological state of the human body.

[0015] The tissue-engineered skin organoids provided by the present invention can be applied to the construction of disease models. The tissue-engineered skin organoids provided by the present invention can highly simulate the physiological structure and function of skin tissue, such as the epidermis, dermis and accessory structures (such as hair follicles, sweat glands, etc.), and can provide a model closer to the real environment for studying the pathological mechanism of skin diseases; on the one hand, through further induced differentiation treatment, organoids with specific skin disease characteristics can be constructed on the basis of tissue-engineered skin organoids, such as skin cancer, psoriasis, etc. These models help to gain a deeper understanding of the occurrence and development of the disease; on the other hand, research on tissue-engineered skin organoids can explore the interaction between different cell types and molecular signaling pathways in the occurrence of the disease, and provide new targets and ideas for the diagnosis and treatment of the disease.

[0016] The tissue-engineered skin organoids provided by the present invention can be applied to drug screening and toxicity testing. The tissue-engineered skin organoids provided by the present invention can be used for high-throughput drug screening. By detecting the effects of drugs on tissue-engineered skin organoids, candidate drugs with potential therapeutic value can be quickly screened out. Using tissue-engineered skin organoids for toxicity testing can evaluate the potential toxicity of drugs to the skin, including irritation, allergy, etc., and provide important data for the safety evaluation of drugs. In addition, combined with the patient's genetic information and disease characteristics, a personalized tissue-engineered skin organoid model can be constructed to evaluate the patient's response to specific drugs and guide the formulation of personalized treatment plans.

[0017] The tissue-engineered skin organoids provided by the present invention can be applied to skin damage and repair and regeneration. By using tissue-engineered skin organoids as repair materials, through cell culture, amplification and differentiation, skin substitutes with biological activity and specific functions can be prepared for the repair of skin defects; in addition, the various cell types and growth factors contained in the tissue-engineered skin organoids can promote the regeneration and repair of skin tissue and accelerate the wound healing process. Therefore, the tissue-engineered skin organoids provided by the present invention can be applied to the treatment of skin diseases such as burns and chronic skin ulcers.

[0018] In some embodiments, the method of inducing differentiation of iPSCs to construct primary skin organoids can refer to the method described in the literature “Lee J, van der Valk WH, Serdy SA, Deakin C, Kim J, Le AP, Koehler KR. Generation and characterization of hair-bearing skin organoids from human pluripotent stem cells. Nat Protoc. 2022 May; 17(5): 1266-1305.”

[0019] In some embodiments, the method of constructing primary skin organoids by inducing differentiation of iPSCs may include the following steps:

[0020] S1. iPSCs cells were suspended in E8 medium containing 20 μM Y27632, and then inoculated into a cell culture device. After centrifugation at 110 g for 6 min, the cells were placed in a 37°C, 5% CO2 incubator for 24 h; then E8 medium was added and cultured for another 24 h to obtain cell aggregates;

[0021] S2. On day 0 of differentiation induction, cell aggregates were collected and induced to differentiate using E6 medium containing 2% Matrigel, 10 μM SB431542, 4 ng / mL bFGF and 2.5 ng / mL BMP4;

[0022] S3, on the third day of differentiation induction, add E6 medium containing 200 ng / mL LDN-193189 (BMP inhibitor) and 250 ng / mL bFGF;

[0023] S4. On the 6th day of differentiation induction, add E6 medium, and change the medium by half on the 8th and 10th days;

[0024] S5. On the 12th day of differentiation induction, the cell aggregates were collected, and skin organoid maturation medium containing 1% Matrigel was added, and the cells were placed on a shaker and cultured at 5% CO2, 37°C, and 65rpm. On the 15th day, the medium was replaced by half with skin organoid maturation medium containing 1% Matrigel;

[0025] S6. From day 18 to day 45 of differentiation induction, replace half of the medium with skin organoid maturation medium every 3 days;

[0026] S7. Starting from the 45th day of induction of differentiation, change half of the medium with skin organoid maturation medium every 2 days, and change the medium completely with skin organoid maturation medium once a week. Culture until the 85th to 100th day to obtain primary skin organoids.

[0027] Thus, primary skin organoids were prepared, the keratinocyte differentiation proteins Loricrin and Filaggrin were differentiated, and the organoids were thick enough to be cut into pieces or dissected and easy to handle.

[0028] In some embodiments, in step (4), Gelma glue can be dropped between the primary skin organoid and the decellularized pig skin slice, and the Gelma glue can be solidified by blue light irradiation, so that the primary skin organoid can be inoculated on the decellularized pig skin.

[0029] In some embodiments, the method of culturing the complex at the air-liquid interface in step (4) may include the following steps:

[0030] The complex was added into the Transwell chamber, and then the skin organoid maturation medium was added. The skin organoid maturation medium could not submerge the skin organoids in the primary complex to form an air-liquid culture interface. During the culture process, the full volume of medium was replaced every 3 days.

[0031] In some embodiments, the composition of the skin organoid maturation medium includes: basal medium, 1×GlutaMax, 0.5×B-27minus vitamin A, 0.5×N-2 supplement, 0.1 mM 2-mercaptoethanol and 100 μg / mL normocin, wherein the basal medium is composed of advanced DMEM / F-12 and neurobasal medium in a volume ratio of 1:1.

[0032] In some embodiments, the decellularized porcine skin can be a commercially available decellularized porcine skin matrix.

[0033] In some embodiments, the method for preparing decellularized pig skin may include the following steps:

[0034] A1) taking pig skin, washing and sterilizing it, freezing it at -80°C for 4 hours, thawing it at room temperature, and repeating the freezing and thawing process 10 times;

[0035] A2) placing the last thawed pig skin in 2% SDS and shaking at 350 rpm at room temperature for 36 h; then taking out the pig skin and placing it in 1% Triton X-100 containing 2% penicillin-streptomycin dual antibody and shaking at 350 rpm at room temperature for 12 h;

[0036] A3) The pig skin was taken out and placed in a 4% sodium deoxycholate aqueous solution, and shaken at 200 rpm at room temperature for 2 hours. The pig skin was taken out and deproteinized with distilled water, 3.4M NaCL solution, and denucleic acid with a solution containing 10 μg / mL DNase and 5 μg / mL RNase, and then dried and sterilized.

[0037] Thus, the prepared decellularized pig skin is completely decellularized, has a loose and porous structure, and has a qualified DNA residue. Compared with the commercially available decellularized pig skin matrix, the decellularized pig skin collagen provided by the present invention is more completely preserved.

[0038] In some embodiments, deproteinization with 3.4M NaCL solution may specifically include the following steps: placing the washed pig skin in 3.4M NaCL solution, shaking at 350 rpm and room temperature for 1 hour, taking out the pig skin, and washing it with PBS buffer at room temperature.

[0039] In some embodiments, the denucleic acid removal using a solution containing 10 μg / mL DNase and 5 μg / mL RNase can specifically include the following steps: placing the deproteinized pig skin in a PBS buffer containing 10 μg / mL DNase and 5 μg / mL RNase, shaking at 350 rpm and 37° C. for 1 hour, taking out the pig skin, and washing it with PBS buffer.

[0040] According to another aspect of the present invention, a method for preparing a UVB-induced skin organoid aging model is provided, comprising the following steps:

[0041] The tissue engineered skin organoids of the present invention are added to a PBS buffer solution, and after UVB irradiation for 5 to 10 minutes, a skin organoid maturation culture medium is added thereto and cultured for 24 hours to obtain the tissue engineered skin organoids.

[0042] After UVB irradiation, the β-galactosidase activity of tissue-engineered skin organoids increased, the expression of aging-related secretory phenotypes TNF-α, IL-6, IL-8, and MMP-2 increased, and the production of SOD decreased, indicating that UVB can induce aging of human skin organoids, and the UVB-induced skin organoid aging model was successfully constructed.

[0043] In some embodiments, the wavelength of UVB irradiation can be 302 nm and the intensity can be 900 μW / cm 2 .

[0044] The UVB-induced skin organoid aging model provided by the present invention can be applied to the screening of anti-photoaging materials, the study of the action mechanism of anti-photoaging materials, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 This is a diagram of the culture process of hiPSCs under a phase contrast microscope. The microscope magnification is 40 times, and the scale is 500μm;

[0046] Figure 2 The immunostaining results of NANOG and OCT4 in hiPSCs are shown in Figure 1. The magnification of the microscope is 100 times (upper) and 200 times (lower). The scale bars are 50 μm (upper) and 20 μm (lower).

[0047] Figure 3 The immunostaining results of SOX2 in hiPSCs are shown in Figure 1. The magnification of the microscope is 40 times (upper) and 100 times (lower). The scale bars are 500 μm (upper) and 100 μm (lower).

[0048] Figure 4 Schematic diagram of the differentiation process of skin organoids;

[0049] Figure 5This is the change of skin organoids during differentiation under a microscope. The magnification of the microscope is 40 times, and the scale is 500μm.

[0050] Figure 6 The size changes of skin organoids during differentiation induction, among which, *** P < 0.001, ** P<0.01, * P < 0.05;

[0051] Figure 7 HE staining and light microscopy images of skin organoids induced to differentiate on day 88. The magnifications of the microscope images were 40x (left), 100x (upper right), and 200x (lower right). The scale bars were 500μm (left), 50μm (upper right), and 20μm (lower);

[0052] Figure 8 This is an immunofluorescence identification image of skin organoids induced to differentiate for about 84 days. The microscope magnification is 100 times, and the scale is 50μm;

[0053] Fig. 9 Light microscopy (left) and scanning electron microscopy images of skin organoids induced to differentiate to day 79. The magnification of the light microscope is 100 times, and the scale is 50μm (left); the magnification of the electron microscope is 500 times (middle) and 1000 times (right), and the scale is 20μm (middle) and 10μm (right);

[0054] Fig.10 Light microscopy (left) and HE staining of skin organoids induced to differentiate to day 120. The magnification of the microscope was 40 times (left), 100 times (upper right), and 200 times (lower right). The scale bars are 500 μm (left), 50 μm (upper right), and 20 μm (lower);

[0055] Fig.11 This is an immunofluorescence identification diagram of mature skin organoids. The KRT5 indicator scale is 100μm; the NEFH indicator scale is 50μmm, 20μm; the NEFH / KRT5 double staining indicator scale is 50μm, 20μm; the SCD-1 indicator scale is 200μm, 20μm; the MITF indicator scale is 50μm, 20μm;

[0056] Fig.12 Oil Red O staining of mature skin organoids, scale bars are 200 μm (left) and 100 μm (right);

[0057] Fig.13 The DAPI staining results of normal pig skin and decellularized pig skin are shown in the figure. The magnification of the microscope is 100 times, and the scale is 200μm.

[0058] Fig.14 The following are the results of HE staining of normal pig skin and decellularized pig skin. The magnification of the microscope is 40 times, and the scale is 500μm.

[0059] Fig.15 The scanning electron micrographs of normal pig skin and decellularized pig skin are shown in Figure 1. The magnification of the scanning electron microscope is 500 times (cross section) and 200 times (vertical section). The scale is 20 μm (cross section) and 50 μm (vertical section).

[0060] Fig.16 The Masson staining results of normal pig skin and decellularized pig skin were taken under a microscope with a magnification of 200 times and a scale of 100 μm. * P < 0.05, vs normal pig skin;

[0061] Fig.17 The DNA quantification results of normal pig skin and decellularized pig skin are shown in Figure 2. *** P < 0.001;

[0062] Fig.18 This is a schematic diagram of the anatomy of skin organoids;

[0063] Fig.19 The HE staining results and immunofluorescence identification results of the tissue-engineered skin organoids prepared in Example 3 were obtained. The magnifications of the microscope shots were 100 times and 200 times, and the scales were 200 μm and 100 μm.

[0064] Fig. 20 HE staining results and immunofluorescence identification results of tissue-engineered skin organoids prepared in Comparative Example 1, the microscope magnifications were 100 times and 200 times, and the scales were 200 μm and 100 μm;

[0065] Fig.21 HE staining results and immunofluorescence identification results of tissue-engineered skin organoids prepared in Comparative Example 2, the microscope magnifications were 40 times, 100 times, and 200 times, and the scales were 500 μm, 200 μm, and 50 μm;

[0066] Fig. 22 The results of β-galactosidase staining of tissue-engineered skin organoids with different treatments are shown in the figure. The magnification of the microscope is 100 times, and the scale is 200μm.

[0067] Fig.23 The expression of TNF-α, IL-6, and IL-8 in tissue-engineered skin organoids with different treatments was shown in Figure 1. The magnification of the microscope was 400 times, and the scale was 20 μm.

[0068] Figures 24-26The TNF-α, IL-6, and IL-8 mRNA levels of tissue-engineered skin organoids with different treatments are shown in order; * P<0.05, *** P < 0.001;

[0069] Fig. 27 The expression of MMP-2 in tissue-engineered skin organoids with different treatments. * P < 0.05;

[0070] Fig.28 The expression of cycle-related proteins p16 / p21 / p-p53 in tissue-engineered skin organoids with different treatments. * P<0.05, ** P<0.01, *** P < 0.001;

[0071] Fig.29 SOD production in tissue-engineered skin organoids with different treatments. DETAILED DESCRIPTION

[0072] The present invention is further described in detail below in conjunction with the embodiments. The examples are only for explanation and are not intended to limit the present invention in any way. Unless otherwise specified, the raw materials and reagents used in the examples are conventional products that can be obtained commercially; the experimental methods in the examples where specific conditions are not specified are usually carried out according to conventional conditions in the art or according to the conditions recommended by the manufacturer.

[0073] Example 1 Construction of human skin organoids using hiPSCs

[0074] The human iPSCs (hiPSCs) cell line used in the present invention is from the School of Medicine of Sun Yat-sen University.

[0075] 1. Preparation of main reagents

[0076] 1. Preparation of Y-27632 (manufacturer: Tocris Bioscience, catalog number: 1254 / 1) stock solution: Instantly separate the tube containing Y-27632. Dissolve 1 mg of Y-27632 in 148 μL of sterile ultrapure water, at which point the concentration is 20 μmol / mL. Store in a -80℃ refrigerator until use. When using, add 1 to 2 μL of stock solution to 1 mL of culture system.

[0077] 2. Preparation of SB431542 (R&D, 1614 / 10) stock solution: Instantly separate the tube containing SB431542. Dissolve 10 mg of SB431542 in 2.378 mL of DMSO and protect from light. Dissolve and mix thoroughly and store in aliquots at -80°C for later use. When using, add 1 μL of stock solution to every 1 mL of culture system.

[0078] 3. Preparation of bFGF (Peprotech, 100-18B) stock solution: Instantly separate the tube containing bFGF. Dissolve 500μg of bFGF in 1mL 5mM Tris, pH 7.6. Dissolve and mix thoroughly, then store in a -80℃ refrigerator for later use. Dilute to the required concentration when using: when the concentration is 4ng / mL, add 0.24μL of stock solution to every 30mL system; when the concentration is 250ng / mL, add 2.5μL of stock solution to every 5mL.

[0079] 4. Preparation of BMP4 (Peprotech, AF-120-05ET) stock solution: Instantly remove the tube containing BMP4. Dissolve 100 μg BMP4 in 1 mL 5 mM HCl. Dissolve thoroughly and mix well, then divide into aliquots and store in a -80°C refrigerator for later use. When using, add 0.05 μL of stock solution per 1 mL of culture system.

[0080] 5. Preparation of LDN-193189 (R&D, 6053 / 10) stock solution: Instantly separate the tube containing LDN-193189. Dissolve 10 mg of LDN-193189 in 5 mL of DMSO and operate in a dark place. Store in a -80°C ultra-low temperature refrigerator after aliquoting. When using, add 0.25 μL of stock solution to every 1 mL of culture system.

[0081] 6. Preparation of organoid maturation medium (OMM): OMM was prepared by mixing Advanced DMEM / F12 (Gibco, 12634010) and Neurobasal medium (Gibco, 356230) in a 1:1 ratio, and adding 1×GlutaMax (Gibco, 35050061), 0.5×B-27minus vitamin A (Gibco, 12587010) and 0.5×N-2 supplement (Gibco, 17502048), 0.1 mM 2-mercaptoethanol (Gibco, 21985023) and 100 μg / mL Normocin (Invitrogen, ant-nr-1).

[0082] 7. Thawing and aliquoting of Matrigel (Corning, 354277 / 356230): Place Matrigel in a foam plastic box filled with crushed ice and dissolve overnight at 4°C. Aliquot the next day and store in a -30°C refrigerator.

[0083] 8. Preparation of Gelma: Use OMM culture medium to prepare Gelma (methacryloyl gelatin, Huaxia Siyin, 10527C) and blue light initiator (Huaxia Siyin, 20601A) to make their concentrations of 7.5% and 1.5%, respectively. Prepare about 2-3 mL each time. After preparation, filter with a filter head and divide into small EP tubes, 70 μL for one tube of Gelma and 40 μL for one tube of blue light initiator (mix 1 tube of Gelma and 1 tube of blue light initiator when using). Inoculate the mixture and skin organoids (whole or after digestion) into the pre-punched holes in the decellularized pig skin. Irradiate with a blue light flashlight for about 10-15 seconds and touch with tweezers until it becomes jelly-like.

[0084] 2. Experimental Methods

[0085] (I) hiPSCs recovery and culture

[0086] Before cell recovery, the culture plate was coated with Matrigel Matrix (20×) and incubated in a cell culture incubator for more than 0.5 h. HiPSCs were taken out of the liquid nitrogen tank, placed in a 37°C water bath until completely thawed, and slowly added to a 15 mL sterile centrifuge tube containing 4 mL mTeSRTM1 medium (mTeSRTM1 medium, STEMCELL, catalog number 85850), centrifuged at 1000 rpm for 5 min, and the supernatant was discarded and 1 mL mTeSRTM1 medium and 10 μM Y-27632 dihydrochloride were added. The plate was inoculated into a well plate coated with Matrigel Matrix (20×) and placed in a cell culture incubator for culture. The medium was changed every day and the cell status was observed under an inverted optical microscope. HiPSCs were subcultured when the clones were too large or the clones were fused.

[0087] (II) Passaging and cryopreservation of hiPSCs

[0088] Aspirate the old culture medium in the well plate and add 0.5 mL (cell dissociation agent, Gibco, A1110501), digested in a cell culture incubator for 2 minutes, added 1 mL of mTeSRTM1 medium to terminate digestion, transferred to a 15 mL sterile centrifuge tube, centrifuged at 1000 rpm for 5 minutes, and seeded in a Matrigel Matrix (20×)-coated cell culture plate at a ratio of 1:6, and cultured in a 37°C, CO2 incubator. After cell digestion and centrifugation, Knock Out TMPrepare cell freezing solution with a volume ratio of SR-Multi-Species:DMSO=9:1 (this cell freezing solution has a higher cell survival rate than the cell freezing solution prepared with a volume ratio of culture medium: serum:DMSO=5:4:1), resuspend the cells with the prepared freezing solution, transfer the suspension to a cell freezing tube, and store it in liquid nitrogen after gradient cooling.

[0089] (III) Immunofluorescence identification of hiPSCs

[0090] When hiPSCs were passaged, the cells were inoculated into a cell culture dish coated with matrix gel in advance. When hiPSCs were close to growing into a monolayer, the coverslip was removed, washed once with PBS, and fixed with 4% paraformaldehyde solution (Solebo, P1110) for 30 minutes. Washed with PBS 3 times, 5 minutes each time. The cells were blocked and permeabilized with a blocking solution containing 10% donkey serum and 3% Triton X-100 (McLean, T824275-500mL), and the incubation conditions were 37°C for 30 minutes. Appropriate concentrations of NANOG (Proteintech, 14295-1-AP), OCT4 (Proteintech, 60242-1-Ig) and SOX2 (BD, 561469) primary antibodies prepared with PBST containing 3% Triton X-100 were added to the slide and incubated overnight at 4°C. Rinse with PBST 3 times the next day, 5 minutes each time. Then, incubate with fluorescent secondary antibody of appropriate concentration at 37℃ for 2h. Rinse with PBS 3 times, 5min each time. Finally, counterstain the cell nucleus with Hoechst33342 (ABCAM, ab228551). Rinse with PBS 3 times, 5min each time. Add 1 drop of anti-fluorescence quenching mounting medium (Solebol, S2100) to each slice, seal the slice, and examine under fluorescence microscope.

[0091] (IV) Construction of skin organoids

[0092] (1) Digest and dissociate hiPSCs in 6-well plates. Then suspend the cells in E8 medium containing 10 μM Y27632. Count the number of live cells by trypan blue staining. Transfer the appropriate number of live cells required for the experiment to E8 medium (Essential 8 medium, Corning, A1517001) containing 20 μM Y27632 and plant them in ultra-low adsorption 96-well U-bottom plates (αplus, WP24-5CCUSH) at a number of 6000 cells (100 μL) per well. Assist cell aggregation by centrifugation at 110 g for 6 minutes. Incubate these cell aggregates in a 37°C, 5% CO2 incubator for 24 hours.

[0093] (2) Add an equal volume of fresh E8 medium (100 μL) to each well to dilute Y27632 and promote cell proliferation and aggregate growth.

[0094] (3) The next day, differentiation induction was initiated. All cell aggregates were collected and transferred to a new 96-well U-bottom plate in a culture volume of 100 μL E6 medium containing 2% Matrigel, 10 μM SB431542, 4 ng / mL bFGF and 2.5 ng / mL BMP4 to initiate non-neural ectoderm formation.

[0095] (4) On day 3 of differentiation, 25 μL of E6 medium containing 200 ng / mL LDN-193189 (BMP inhibitor) and 250 ng / mL bFGF was added to each well to make the final volume 125 μL per well to induce CNC (cranial neural crest) cell formation.

[0096] (5) On day 6 of differentiation, add 75 μL of fresh E6 medium to make the final volume reach 200 μL.

[0097] (6) Replace half of the medium with fresh E6 medium on days 8 and 10.

[0098] (7) On day 12, all aggregates were transferred into individual wells of a 24-well low attachment plate in 500 μL OMM containing 1% Matrigel to induce epidermal self-assembly. To maintain the aggregates in floating culture with constant medium circulation, the 24-well plate was placed on an orbital shaker at 65 rpm in a 37°C incubator containing 5% CO2.

[0099] (8) On day 15 of differentiation, half of the medium in the 24 wells was replaced with OMM containing 1% Matrigel.

[0100] (9) Starting from day 18, perform a half-medium change with fresh OMM without Matrigel every 3 days (from day 18 to day 45) or every other day (from day 45 to day 150 or longer), including a full medium change once a week starting from day 45.

[0101] (10) As aggregates mature and grow larger, it is sometimes necessary to increase the total volume of culture medium per well to 1 mL starting on day 80.

[0102] (11) Observe the growth of organoids under an inverted microscope and take photos every day.

[0103] (V) Organoid Slices

[0104] Skin organoids were fixed with 4% paraformaldehyde at 4°C overnight and then washed three times with PBS for 5 min each time.

[0105] Organoids were embedded in OCT (Sakura, 4583). Slices were made in a cryostat with a thickness of about 20 μm. 15-20 slides were attached to each tissue, and 3-4 slices of tissue were attached to each slide. The slices were dried in a 37°C oven for 30 min and then transferred to a -80°C refrigerator for long-term storage.

[0106] (VI) Analysis of organoid surface markers by immunofluorescence

[0107] Wash the sections three times in PBS. Block with 10% donkey serum and 3% Triton X-100 blocking solution in a 37℃ humidified chamber for 1h. Incubate with primary antibody at 4℃ overnight. Wash with PBS three times, 5min each time. After incubation with secondary antibody for 2h at room temperature and counterstaining with Hoechst 33342, the sections were mounted with anti-fluorescence quenching mounting medium for photography. Negative control samples were incubated with secondary antibody only. Observe fluorescence under a fluorescence microscope. On days 55-75 of organoid culture, observe the formation of epidermal, basal, and dermal markers (CD49f, KRT5, KRT15, ​​Vitmentin, PDGFR-α). After 75 days, observe the formation of hair follicle-related structures such as follicular skin condensates and hair papillae. Observe the formation of skin appendage structures such as sensory neuron markers for more than 120 days.

[0108] (VII) Analysis of organoid sebaceous glands and adipocyte clusters by Oil Red O staining

[0109] After the frozen sections are rewarmed, wash them with PBS three times, 5 minutes each time. Shake the slides dry, mark the tissue block with an immunohistochemical pen, rinse the slides with 60% isopropanol for 20 seconds and then wash with water. Stain with Oil Red O dye at room temperature for 10 minutes. Place the sections in a humidified box to prevent them from drying out. Discard the Oil Red O dye and differentiate the slides with 60% isopropanol. Rinse with pure water. Seal the slides with neutral gum and observe under an optical microscope.

[0110] (VIII) HE staining

[0111] (1) Frozen sections were baked in a 37°C oven for 30 min, then washed with PBS three times, 5 min each time. The sections were fixed with 95% ethanol for 1 min. Hematoxylin staining was performed for 30 s-2 min, and then rinsed with running water for 1 min. The nuclear staining was observed under a microscope, and the sections were differentiated with 1% hydrochloric acid alcohol for 1 s, and then rinsed with running water for 3 min. Soaked in 80% ethanol for 30 s, and then rinsed with running water for 1 min. The sections were stained with eosin for 1 min, and then rinsed with running water for 1 min.

[0112] (3) Dehydration and sealing: Soak the slices in 75% ethanol for 20 seconds, 80% ethanol for 20 seconds, 95% ethanol for 20 seconds, anhydrous ethanol for 1 minute, xylene I for 10 minutes, and xylene II for 10 minutes. Take the slices out of xylene, spin dry, and finally seal with cell preservation solution. Store at room temperature.

[0113] 3. Experimental Results

[0114] (I) Culture and identification of hiPSCs

[0115] Resuscitate hiPSCs at a density of about 50%, replace fresh hiPSCs culture medium every day, and perform cell passaging when cells form large clones or clones begin to fuse. Figure 1 This is a diagram of the hiPSCs culture process under a phase contrast microscope. The hiPSCs cells are of uniform size, growing in clusters and forming clones. The clones have clear boundaries, and the cells are closely arranged without obvious gaps.

[0116] NANOG and OCT4 are transcription factors expressed in pluripotent stem cells, and are essential for maintaining the pluripotency of embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs). NANOG promotes the self-renewal of iPSCs by acting synergistically with other transcription factors such as OCT4. SOX2 positive expression is necessary for the induction of hiPSCs into neural epithelium. In the process of iPSCs differentiating into neural cells, the expression pattern and regulatory network of SOX2 are essential for guiding cell fate decisions. SOX2 is essential for the self-renewal and differentiation of neural stem cells and neural progenitor cells. It regulates the expression of neural development-related genes by binding to the promoter and enhancer regions of a variety of target genes. The expression of SOX2 in neural stem cells is closely related to the pluripotency and self-renewal ability of the cells, while in neural progenitor cells, the expression of SOX2 is related to the differentiation and maturation process of the cells. Immunofluorescence results showed ( Figure 2-3 ), NANOG, OCT4 and SOX2 were highly expressed in hiPSCs.

[0117] (II) Skin organoid induction

[0118] Figure 4 Diagram of the skin organoid formation process.

[0119] First, embryoid bodies with a diameter of about 500 μm were formed in an ultra-low attachment 96-well plate, and the embryoid bodies were washed three times with E6 medium before subsequent induction. Figure 5-6The results showed that on the third day of induction, a thin and transparent epithelial layer formed on the surface of the skin organoids; on the 6th to 9th day, a capsule was formed, which contained dark nuclei and radial traces of mesenchymal cell migration from the nucleus to the peripheral epithelium. On days 12 to 21, the surface of the capsule was lightly covered with interstitial cells, and interstitial cell clusters were formed at one pole of the capsule. Subsequently, the maturation medium OMM for maintaining organoid growth and differentiation was replaced every 3 days or every other day to promote subsequent differentiation and maturation. At about 120 days, an organoid structure with a transparent spherical ...

[0120] 3. Identification of skin organoids

[0121] 1. HE staining observation of skin organoids in the middle stage of differentiation

[0122] The skin organoids induced to day 88 were fixed, sliced, and stained with HE. Figure 7 shown. Figure 7 The differentiating skin organoids show clear keratinocytes, basal layer structures, and dermis, among which hair follicle structures have begun to form.

[0123] 2. Identification of the basic structures of the epidermis, basal layer and dermis during differentiation.

[0124] After 75 days of organoid induction, the epidermis, basal layer and dermis of skin organoids can be identified.

[0125] Figure 8 This is an immunofluorescence identification image of skin organoids induced for about 84 days. It can be seen that the embryoid bodies have differentiated into skin organoids containing epidermis (KRT15) and dermis (PDGFR-α, SOX2), as well as hair primordium (PCAD) structures visible in the dermis.

[0126] 3. Observation of the morphology of differentiated skin organoids using scanning electron microscopy

[0127] The skin organoids on day 79 were fixed, dehydrated, dried and conductively coated before being scanned. Fig. 9 The SEM images can clearly show the surface texture and microstructure of skin organoids, among which the morphology and density of hair follicles of skin organoids are clearly visible.

[0128] 4. HE staining observation of differentiated and mature skin organoids

[0129] The skin organoids induced for 120 days were fixed, sectioned and HE stained. Fig.10 The light microscopy shows a more mature hair follicle structure. HE staining shows keratinocytes and keratinized layer and even shed dead keratinocytes.

[0130] 5. Identification of the basic structures of the epidermis, basal layer, and dermis of differentiated mature skin organoids

[0131] After fixation, dehydration, sectioning, and immunofluorescence staining of mature skin organoids induced for more than 120 days, the expression of various maturation markers of skin organoids was observed under a laser confocal microscope. Fig.11 It can be seen that mature skin organoids have structures such as hair follicles (KRT5), sebaceous gland structures (SCD-1), sensory neurons (NEFH), Merkel cells (KRT20) and melanocytes (MITF).

[0132] 6. Oil Red O Staining of Sebaceous Gland Structure in Differentiated Mature Skin Organoids

[0133] After the mature skin organoids induced for more than 120 days were fixed, dehydrated, sliced, and stained with oil red, the oil red staining of the skin organoids was observed under an ordinary light microscope. Fig.12 It can be seen that the hair follicles of mature skin organoids can be stained orange-red by oil red, indicating that the hair follicles contain sebaceous glands or fat structures.

[0134] Example 2 Preparation of decellularized pig skin

[0135] The normal pigskin used in this example was purchased from Shiqi Slaughterhouse in Panyu, Guangzhou; the decellularized pigskin matrix was purchased from Jiangsu Youchuang Biomedical Technology Co., Ltd. (DC-ADM-C model).

[0136] 1. Preparation of main reagents

[0137] Preparation of 1.2% SDS: Pipette 10 mL of 20% SDS aqueous solution (McLean, S885172-250 mL), add sterile water for injection to make the volume to 100 mL, and then filter and sterilize with a 0.22 μm needle filter for use.

[0138] Preparation of 2.4% sodium deoxycholate aqueous solution: accurately weigh 4 g of sodium deoxycholate powder (McLean, H854437-25g), add sterile water for injection to make up to 100 mL, and then filter and sterilize with a 0.22 μm needle filter for standby use.

[0139] Preparation of 3.3.4M NaCl: Accurately weigh 19.8706 g NaCl crystalline powder (McLean, S805275-500g), add sterile water for injection to make up to 100 mL, and then filter and sterilize with a 0.22 μm needle filter for later use.

[0140] 4. Preparation of DNase (20 μg / mL): Quickly separate the tube containing DNase (Thermo Fisher Scientific, DN25-100 mg). Accurately weigh 1 mg of DNase powder, dilute to 50 mL of sterile water for injection, and filter with a 0.22 μm needle filter to sterilize for later use.

[0141] 5. Preparation of RNase (10μg / mL): Quickly separate the tube containing RNase (Thermo Fisher Scientific, EN0531). Pipette 50μL of 10mg / mL RNase aqueous solution and add it to 49.95mL sterile water for injection to obtain 10μg / mL RNase solution. Before use, mix 20μg / mL DNase aqueous solution and 10μg / mL RNase solution in a 1:1 ratio.

[0142] 2. Experimental Methods

[0143] (I) Preparation of decellularized pig skin

[0144] 1. Take the whole layer of pig skin, rinse it with distilled water for 3 times, then soak it in alcohol for 30 seconds and then wash it with saline for 2 times. Remove the hair with scissors and tweezers, scrape off the fat with a blade, and then wash it with sterile injection water for 3 times. Then soak it in ddH2O containing 2% penicillin-streptomycin (Gibco, 15140122) + 10μg / mL gentamicin (Thermo Fisher, G1272) + 2.5μg / mL soluble amphotericin B (Solerbo, IA0320) at 4℃ overnight.

[0145] 2. On the second day, rinse repeatedly with sterile water for injection, cut into 5*2cm tissues, freeze at -80℃ for 4h, and thaw at room temperature 10 times.

[0146] The decellularization treatment was performed alternately with 3.2% SDS at 350 rpm and room temperature for 36 h, and 1% Triton X-100 (containing 2% penicillin-streptavidin-glucopyranoside) at 350 rpm and room temperature for 12 h.

[0147] 4. Use 4% sodium deoxycholate aqueous solution at 200 rpm and shake at room temperature for 2 hours. Wash with distilled water and cut 0.5*0.5 cm full-thickness pig skin for frozen section and DAPI staining.

[0148] 5. After observing the cell-free structure, wash with 3.4M NaCl to remove protein, and remove nucleic acid with DNase (10μg / mL) and RNase (5μg / mL) solution. Finally, freeze-dry the decellularized pig skin, sterilize it with ultraviolet irradiation, and store it in a -80℃ refrigerator for later use.

[0149] (ii) DAPI nuclear staining:

[0150] Untreated pig skin (normal pig skin), decellularized pig skin prepared in this example (hereinafter referred to as "non-crosslinked decellularized pig skin"), and commercially available decellularized pig skin were fixed and dehydrated in a conventional manner, then embedded in OCT and sliced. The slides were washed with PBS for 3 times, 5 minutes each time, and then the edge of the tissue was circled with an immunohistochemical pen, and DAPI staining solution was added to the tissue. After incubation at room temperature for 10 minutes, the slides were washed with PBS and sealed for observation under a microscope.

[0151] (III) Masson staining

[0152] Masson staining was performed using a Masson staining kit (Solabo, G1340).

[0153] Place the frozen sections to be stained in a 37°C oven for 30 minutes. Wash with PBS 3 times, 5 minutes each time. Stain with the prepared Weigert iron hematoxylin staining solution for 5-10 minutes, then differentiate with acidic ethanol differentiation solution and rinse with tap water. Re-blue with Masson blueing solution and wash with water. Wash with distilled water for 1 minute. Stain with Ponceau fuchsin staining solution for 5-10 minutes. Prepare weak acid working solution in a ratio of distilled water: weak acid solution = 2:1, and wash with weak acid working solution for 1 minute. Wash with phosphomolybdic acid solution for 1-2 minutes. Wash with weak acid working solution for 1 minute. Directly place in aniline blue staining solution for staining for 1-2 minutes. Wash with weak acid working solution for 1 minute. Dehydrate with 95% ethanol and dehydrate with anhydrous ethanol 3 times, 10 seconds each time. Transparent with xylene 3 times, 2 minutes each time. Finally, seal with sealing agent.

[0154] (IV) Observation of pig skin morphology using scanning electron microscopy

[0155] The pig skin was placed in a freeze dryer and freeze-dried for 72 hours, sprayed with gold, and observed under a scanning electron microscope.

[0156] (V) DNA Residue Detection

[0157] The pig skin was placed in a freeze dryer and freeze-dried for 72 hours. Use scissors to take appropriate amounts of tissue from the three groups of samples and weigh them. Take 3 samples from each group, each about 20 mg, and use a DNA extraction kit (Novozyme, DC102) to extract DNA. Cut the tissue into pieces, add 230μL buffer GA and 20μL proteinase K, and incubate in a 55℃ incubator until the tissue is completely dissolved. Add 250μL buffer GB, vortex mix, and incubate in a 70℃ incubator for 10 minutes. On this basis, add 180μL of anhydrous ethanol and mix by blowing, then transfer to the adsorption column for centrifugation. The adsorption column is treated with deproteinization, deionization, and removal of ethanol residues. Finally, 50μL of preheated Elution Buffer is added to elute the adsorption column. The extracted DNA is quantified on Nanodrop 2000. The DNA content (ng / mg) in the sample is converted according to the test results.

[0158] 3. Experimental Results

[0159] (1) Macroscopic morphology and DAPI staining of decellularized pig skin

[0160] Non-cross-linked decellularized pig skin and purchased decellularized pig skin are lighter in color and have less pores and texture than normal tissue. Non-cross-linked decellularized pig skin is more elastic than commercially available decellularized pig skin. DAPI staining of frozen sections shows ( Fig.13 ), compared with the full layer of normal pig skin tissue, blue fluorescent nuclei could be found, a small number of nuclei could be seen in the non-cross-linked decellularized pig skin, while no obvious blue fluorescent nuclei were found in the commercially available decellularized pig skin.

[0161] (2) Changes of decellularization on the histological morphology of pig skin stained with HE

[0162] HE staining showed ( Fig.14 ), blue-stained nuclei and abundant collagen and elastin fibers can be seen in normal pig skin tissue. No blue-stained nuclei were found in the cross-section and longitudinal sections of non-cross-linked acellular pig skin, and the compactness of dermal collagen did not change significantly, the distribution was normal, and no loss was found. Compared with the normal pig skin group and the non-cross-linked acellular pig skin group, the color of commercially available acellular pig skin collagen was significantly lighter, which may be related to the degree of pig skin cross-linking, or there may be aging and degeneration.

[0163] (3) Morphological changes of decellularized pig skin under scanning electron microscopy

[0164] Scanning electron microscopy results showed that ( Fig.15 ), both normal pig skin tissue and decellularized pig skin tissue are rich in collagen fibers, including thick collagen fibers, thin branched reticular collagen fibers, etc.; compared with the pig skin in other groups, the fiber structure of non-cross-linked decellularized pig skin is looser and more porous.

[0165] (4) Observation of changes in collagen density by Masson staining of decellularized pig skin

[0166] After Masson staining, collagen appears blue and cell nuclei appear red when observed under bright field. Fig.16 As shown in the figure, the texture of non-cross-linked decellularized pig skin and commercial decellularized pig skin is loose, and there is no significant change in the collagen distribution between non-cross-linked decellularized pig skin and normal pig skin. The area occupied by collagen was calculated using FUJI software, and the data were analyzed using SPSS26.0. There was no significant change in the collagen distribution between non-cross-linked decellularized pig skin and normal pig skin, indicating that the change of collagen before and after decellularization was not obvious; the collagen distribution area of ​​commercial decellularized pig skin was reduced compared with that of normal pig skin (P=0.041), and the difference was statistically significant.

[0167] (5) Determination of DNA content in dry weight of decellularized pig skin

[0168] The DNA dry weight of decellularized scaffolds is an important indicator for evaluating the decellularization effect. Low DNA content scaffold materials can reduce immunogenicity and improve biocompatibility. After decellularization of pig skin, DNA still remains. DNA quantification results show ( Fig.17 ), the DNA content of normal pig skin tissue was (99.43673±16.41099) ng / mg, the DNA content of commercially available decellularized pig skin decellularized scaffold and non-cross-linked decellularized pig skin were 12.58642±9.06713 and 4.54443±4.49308 ng / mg, respectively, all <50 ng / mg, compared with normal pig skin tissue, P <0.001, the difference was statistically significant.

[0169] Example 3 Construction of tissue engineered skin organoids

[0170] The steps include:

[0171] (1) The decellularized pig skin prepared in Example 2 was sliced ​​to a thickness of about 100 μm.

[0172] (2) The skin organoids cultured to day 100 in Example 1 were dissected. The dissection diagram is shown in the following figure. Fig.18 As shown, during dissection, the tail of the skin organoid, which is composed of a dense, opaque mass of cells, is removed ( Fig.18 The part enclosed by the red solid circle in the middle), and its transparent saccular structure was cut open ( Fig.18The orange dotted line in the middle is the schematic line for the anatomy), and then the transparent spherical structure of the skin organoid is inoculated on the decellularized pig skin with the inner side facing up and the outer side facing down. Gelma is dropped between the skin organoid and the decellularized pig skin slices. After irradiation with blue light for 15 seconds, the Gelma is lightly touched to form a jelly. The pig skin and organoid are then transferred to the upper layer of the Transwell 6-well plate for culture. 800 μL OMM is added to ensure that the surface of the skin organoid is not submerged in the culture medium (air-liquid culture interface), and the medium is changed every 3 days.

[0173] (3) After 10-21 days of culture, the organoid-decellularized porcine skin culture was removed, fixed and dehydrated according to routine procedures, and then frozen and sectioned for identification.

[0174] Fig.19 The HE staining results and immunofluorescence identification results of the tissue-engineered skin organoids prepared in this example.

[0175] HE staining results showed that the epidermis and dermis of the tissue-engineered skin organoids prepared in this example were clearly stratified, with the epidermis located above the dermis. The epidermis of the skin organoids cultured at the air-liquid interface was thickened, and a red-stained stratum corneum was visible. The openings of the dermal hair follicles were facing upward.

[0176] Immunofluorescence results showed that hair follicles (KRT5), sebaceous gland structures (SCD-1), sensory neurons (NEFH) and melanocytes (MITF) were visible in the skin organoids, indicating that the tissue-engineered skin organoids cultured by the method of the present invention are more in line with the physiological structure.

[0177] Comparative Example 1

[0178] (1) The decellularized pig skin prepared in Example 2 was sliced ​​into slices with a thickness of about 1 mm.

[0179] (2) Take the skin organoids cultured to day 85-100 in Example 1 and cut them into pieces with a size of 1 mm. 3 Then inoculate it on the decellularized pig skin, add Gelma glue on the upper layer, irradiate with blue light for 15 seconds, and lightly touch the Gelma glue to turn it into a jelly-like state. Then the pig skin and organoids can be transferred to a 24-well plate for culture. After culturing to D120 or above, take out the organoid-decellularized pig skin culture, fix and dehydrate it routinely, and perform frozen sections for identification.

[0180] HE staining and immunofluorescence results showed that ( Fig. 20), infiltrating and growing cell nuclei can be seen on the decellularized pig skin, which has good tissue compatibility with the skin organoids after digestion and inoculation. Keratinocytes, keratinocyte clusters (white arrows in HE images), basal layer (KRT5 and KRT15), and basal layer melanocyte structure (MITF) can be seen in the epidermis. The dermis structure (PDGFR-α) is obvious, and the sebaceous gland structure can be seen (red arrows in HE images, SCD-1 fluorescence). However, the structure of the skin organoids is scattered and cannot reflect the physiological and anatomical structure of human skin.

[0181] Comparative Example 2

[0182] (1) The decellularized pig skin prepared in Example 2 was sliced ​​to a thickness of about 100 μm.

[0183] (2) Take the skin organoids cultured to day 85-100 in Example 1 and place them head-down on the decellularized pig skin. Gelma is dripped on the contact point between the organoid and the pig skin. After irradiation with blue light for 15 seconds, the organoids are gently touched with the Gelma to form a jelly-like state. Then, a piece of decellularized pig skin of the same size and thickness is covered on it. The pig skin and organoids are transferred to a 24-well plate for culture, and the medium is changed once every 3 days. When the organoid-decellularized pig skin culture is cultured to D120 or above, the organoid-decellularized pig skin culture is taken out, and frozen sections are made and identified after conventional fixation and dehydration.

[0184] HE and immunofluorescence results showed that ( Fig.21 ), infiltrating cell nuclei can be seen on the decellularized porcine skin scaffold, and there is a tendency for downward growth and infiltration. It has good tissue compatibility with the inoculated skin organoids. The epidermis of the skin organoids is relatively thin, and the epidermis (KRT15), epidermal stem cells (CD49f), dermis structure (Vimentin) and hair follicle structure can be seen.

[0185] Example 4 Construction of UVB-induced skin organoid aging model

[0186] The steps include:

[0187] Take the differentiated and mature tissue-engineered skin organoids obtained by dissecting and inoculating in Example 3 and culturing for 20 days, add 1 mL of PBS to each well, and then place the tissue-engineered skin organoids in a UVB radiometer and irradiate them at a wavelength of 302 nm for 5 min, with an irradiation intensity of 900 μW / cm 2 , then add skin organoid maturation medium and continue culturing for 24 hours.

[0188] Identification of UVB-induced skin organoid aging models

[0189] 1. Experimental Methods

[0190] The experimental subjects were the UVB-induced skin organoid aging model (UVB group) constructed in Example 4 and the tissue-engineered skin organoids (Contrl group) that were not irradiated with UVB and served as a normal control group.

[0191] (I) Organoid slices

[0192] Immerse the skin organoids in 4% paraformaldehyde and fix them at 4°C overnight. Wash them with PBS three times the next day, 5 minutes each time. Dehydrate with 30% sucrose for 3 days, embed the organoids with OCT, and slice them in a freezing microtome (set the slice thickness to 20μm). Attach 15-20 slides to each tissue, and 3-4 slices of tissue to each slide. Bake the slices in a 37°C oven for 30 minutes and transfer them to a -80°C refrigerator for long-term storage.

[0193] (ii) β-galactosidase staining

[0194] The staining was performed using a β-galactosidase staining kit (Solebio, G1580). The steps included:

[0195] (1) Wash organoid slices three times with PBS, 5 min each time.

[0196] (2) Use an immunohistochemistry pen to circle the edge of the tissue. Add an appropriate volume of β-galactosidase staining fixative to the slices to fully cover the tissue, and fix at room temperature for no less than 15 minutes (in a wet box).

[0197] (3) Wash the tissue three times with PBS, 5 min each time.

[0198] (4) Aspirate PBS and add an appropriate amount of staining working solution. The preparation method for 1 mL of staining working solution is as follows:

[0199] 10 μL β-galactosidase staining solution A, 10 μL β-galactosidase staining solution B, 930 μL β-galactosidase staining solution C, and 50 μL X-Gal solution are mixed evenly to obtain the product.

[0200] (5) Incubate in a 37°C wet box overnight and cover with plastic wrap to prevent evaporation. Wash with PBS three times the next day, 5 min each time.

[0201] (6) Observe under an ordinary optical microscope. If observation cannot be made immediately, seal the slides with sealing fluid and store at 4°C for a period of time.

[0202] (III) Immunofluorescence staining

[0203] The organoid sections were washed 3 times in PBS. Blocked with 10% donkey serum in a humidified chamber at 37°C for 1 h. Incubated with primary antibody at 4°C overnight. Washed with PBS 3 times, 5 min each time. Incubated with secondary antibody at room temperature for 1 h and counterstained with Hoechst 33342, the sections were mounted with anti-fluorescence quenching mounting medium for photography. Negative control samples were incubated with secondary antibody only. Fluorescence was observed under a fluorescence microscope.

[0204] (IV) Skin organoid protein extraction

[0205] The organoids were washed three times with pre-cooled PBS. RIPA cell lysis buffer was added and the organoids were minced with scissors. After lysis on ice for 30 minutes, the cell proteins were transferred to a 1.5 mL EP tube with a pipette, vortexed and continued to incubate on ice for 30 minutes, vortexing once every 10 minutes. The EP tube was centrifuged at 4°C 16000 rcf for 30 minutes, and the supernatant was aspirated and stored in a -80°C refrigerator.

[0206] (V) Protein quantification, electrophoresis, membrane transfer, and development

[0207] The expression levels of MMP-2 and cycle-related proteins p16 / p21 / p-p53 in organoids were detected.

[0208] 1. Protein Quantification

[0209] Protein quantification was performed using the BCA protein quantification kit (Biyuntian, P0012). The steps included:

[0210] (1) Add 0.5 mg / mL standard to a 96-well plate at 0, 1, 2, 4, 8, 12, 16, or 20 μL. Add PBS to make up to 20 μL per well. Set up two or more replicate wells.

[0211] (2) Take 1-2 μL of protein supernatant and dilute it 10-20 times with PBS to make the volume of each well reach 20 μL. Set up 2 replicate wells for each sample.

[0212] (3) Add 200 μL of BCA working solution to each well, mix well, and incubate at 37°C for 20-30 min.

[0213] (4) Read the OD value at 562 nm using an ELISA reader. Draw a standard curve and calculate the protein concentration.

[0214] 2. SDS-PAGE gel electrophoresis

[0215] (1) Prepare SDS-PAGE gel of appropriate concentration according to the molecular weight of the target protein and store it in a refrigerator at 4°C for future use. The manufacturer of the SDS-PAGE gel preparation kit is Bio-Tech, and the product number is P0012A.

[0216] (2) Remove the sample from -80℃ and thaw at 4℃. Vortex to mix before loading.

[0217] (3) 10 μL of sample was loaded into each group (protein concentration: 1 μg / μL). An equal volume of prestained marker (Thermo Fisher, 26616) was added on both sides of the sample lane.

[0218] (4) Run electrophoresis at a constant voltage of 80 V for about 20-30 min to allow the protein to enter the separation gel, then adjust the voltage to 100 V and continue electrophoresis. Stop electrophoresis when the marker reaches the bottom of the separation gel.

[0219] 3. Transfer

[0220] (1) Cut the membrane to the size of PVDF membrane > filter paper > gel. Activate the PVDF membrane with methanol for 10 seconds until it is transparent, then soak it in the transfer solution together with the filter paper. The soaking time is preferably about 5 minutes.

[0221] (2) Place filter paper, PVDF membrane, gel, and filter paper from bottom to top on a semi-dry transfer apparatus. Use a glass rod to remove bubbles from the middle of the filter paper to both sides, and finally connect the power supply. The transfer voltage and time are approximately 25V and 20min.

[0222] 4. Immunoblotting of Target Protein

[0223] (1) Place the membrane with the front side facing up in TBST containing 5% skim milk powder / BSA and block for 1-2 hours at room temperature.

[0224] (2) Wash the blocked membrane three times with TBST, 5 min each time. Cut the membrane and mark it according to the size of the pre-stained marker and target protein.

[0225] (3) Transfer the membrane to the primary antibody incubation box for incubation (primary antibody concentration 1:1000) at 4°C overnight.

[0226] (4) The next day, remove the strips and wash with TBST three times, 10 min each time.

[0227] (5) Add horseradish peroxidase (HRP)-labeled secondary antibody at an appropriate concentration (1:5000), incubate at room temperature for 1-2 h, and gently shake on a decolorization shaker.

[0228] (6) Wash with TBST three times (10 min / time).

[0229] (7) The ECL luminescence colorimetric method was used, and the ratio of luminescent solution A to solution B was 1:1. The PVDF membrane was drained with filter paper and then placed in a developer for development.

[0230] (8) Use image-J for quantitative analysis.

[0231] (VI) Detection of superoxide dismutase (SOD) in organoids

[0232] The protein supernatant was thawed at 4°C, and the protein concentration was determined by the BCA method and then detected according to the instructions of the SOD detection kit (Nanjing Jiancheng, A001-3-2).

[0233] When the inhibition rate of SOD reaches 50%, the corresponding enzyme amount is 1 SOD activity unit (U). 对照 -A 对照空白 )-(A 测定 -A 测定空白 )÷(A 对照 -A 对照空白 )

[0234] SOD activity (U / mgprot) = SOD inhibition rate ÷ 50% × reaction system dilution factor ÷ protein concentration of the sample to be tested (mgprot / mL)

[0235] (VII) RT-PCR detection of changes in IL6 / IL8 / TNFα in each group of organoids

[0236] The steps include:

[0237] (1) The organoids were washed three times with pre-cooled PBS. The organoids were minced with scissors, and RNA was extracted using the Novozymes FastPure Cell / Tissue Total RNA Isolation Kit (RC101) and stored in a -80°C refrigerator.

[0238] (2) Take out 10 μL of RNA from each sample and use NanoDrop 2000 for nucleic acid quantification, using RNase free ddH2O as a blank control.

[0239] (3) Using the kit Novozyme III RT SuperMix for qPCR (+gDNA wiper) for RNA reverse transcription. According to the results of nucleic acid quantification of each sample, add about 500ng of RNA to each tube, RNA+RNasefree ddH2O to make a volume of 16μL, then add 4μL gDNA wiper mix and mix with a pipette, 42℃2min. Take 16μL of the reaction solution in the previous step, add 4μL Hiscript qRT supermix to form a 20μL system. Perform reverse transcription reaction: 37℃15min, 85℃5sec. Store the reverse transcription product at -80℃.

[0240] (4) Dilute cDNA 5 times, take out 8μL of cDNA from each tube, add 32μL ddH2O, and the total volume is 40μL. Prepare the reaction system: SYBR qPCR master mix 10μL, forward primer 0.6μL, reverse primer 0.6μL, each set of primers is prepared into 40 tubes and then dispensed into each well, and then add 8.8μL of the corresponding diluted cDNA to each well. Reaction conditions: 95℃30 seconds; 95℃10 seconds, 60℃30 seconds; 40 cycles; 95℃15 seconds, 60℃60 seconds, 95℃15 seconds. Detection on the machine.

[0241] (5) Use PrimerBank to design internal reference primers and target primers. The following table shows the primer sequences of the genes.

[0242] Table 1 Primer sequences of target genes

[0243] Gene Name Forward Primer (5′ to 3′) Reverse Primer (5′ to 3′) GAPDH GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG IL-6 ACTCACCTCTTCAGAACGAATTG CCATCTTTGGAAGGTTCAGGTTG TNF-α CCTCTCTCTAATCAGCCCTCTG GAGGACCTGGGAGTAGATGAG IL-8 TTTTGCCAAGGAGTGCTAAAGA AACCCTCTGCACCCAGTTTTC

[0244] 8. Statistical analysis

[0245] SPSS26.0 statistical software was used to analyze the data, and the experimental results were expressed as mean ± standard error (± SEM). When the data conformed to the normal distribution and the variance was equal, the data between the groups were compared using One way-ANOVA, and the LSD test was used for the comparison between the two groups. When the data did not conform to the normal distribution or the variance was unequal, nonparametric tests were used. The Kruskal-Wallis test was used for the comparison between the two groups. When P < 0.05, the difference was considered statistically significant. Graphpad Prism 8.0 was used to plot and represent the data.

[0246] 2. Experimental Results

[0247] 1. Effect of UVB irradiation on β-galactosidase activity in tissue-engineered skin organoids

[0248] β-galactosidase is a biomarker of senescent cells, and changes in β-galactosidase activity reflect the dynamic process of cell aging.

[0249] The tissue-engineered skin organoids treated with UVB irradiation were fixed, sliced, stained with β-galactosidase and observed under an optical microscope. Fig. 22 The results showed that there was almost no blue staining in the control group. The keratinocyte layer and basal layer in the UVB group were blurred and unclear compared with the control group, and the blue staining increased.

[0250] 2. Effects of UVB irradiation on the expression of TNF-α, IL-6, and IL-8 in tissue-engineered skin organoids

[0251] The tissue-engineered skin organoids treated with UVB were fixed, sliced, and immunofluorescence stained. The expression of TNF-α, IL-6, and IL-8 was observed under a confocal microscope. The immunofluorescence results showed that ( Fig.23 ), TNF-α, IL-6, and IL-8 were rarely expressed or even almost not expressed in the control group, but their expressions increased in the UVB group.

[0252] In addition, RNA extraction, quantification, reverse transcription, and RT-PCR were performed on the organoids, and the ΔCt values ​​of each group were compared. The results showed that ( Figures 24-26 ), the mRNA levels of TNF-α, IL-6, and IL-8 in the UVB-treated group were higher than those in the control group.

[0253] 3. Effects of UVB irradiation on the expression of MMP-2 and cycle-related proteins p16 / p21 / p-p53 in tissue-engineered skin organoids

[0254] The organoids were subjected to protein extraction, quantification, electrophoresis, transfer, development and quantification, and the relative grayscale values ​​of the organoid proteins in each group were compared.

[0255] The results show that Figures 27-28 ), the expression levels of MMP-2 and cycle-related proteins p16 / p21 / p-p53 in the UVB-treated group were significantly increased compared with those in the control group.

[0256] 4. Effect of UVB irradiation on SOD production in tissue-engineered skin organoids

[0257] The results are as follows Fig.29 As shown, the production of SOD was decreased in the UVB group compared with the control group.

[0258] 3. Experimental Conclusion

[0259] After UVB irradiation, tissue-engineered skin organoids showed increased aging-related secretory phenotypes of TNF-α, IL-6, IL-8, and MMP-2, suppressed SOD production, and upregulated expression of cycle-related proteins p16 / p21 / p-p53, which can be used as a skin organoid photoaging model.

[0260] The above are only some embodiments of the present invention. For those skilled in the art, several modifications and improvements can be made without departing from the inventive concept of the present invention, which all belong to the protection scope of the present invention.

Claims

1. A method for constructing tissue engineered skin organoids, characterized in that: The steps include: (1) iPSCs were induced to differentiate and further cultured to days 85 to 100 to construct primary skin organoids; (2) Slicing the decellularized pig skin to a thickness of 90 to 110 μm to obtain decellularized pig skin slices; (3) After dissecting the primary skin organoid, the transparent spherical structure is taken out and inoculated on the decellularized pig skin slice with the inner surface facing up and the outer surface facing down to obtain a composite; (4) The complex is cultured at an air-liquid interface for 10 to 21 days to obtain tissue-engineered skin organoids.

2. The construction method according to claim 1, characterized in that: Step (1) comprises the following steps: S1. iPSCs cells were suspended in E8 medium containing 20 μM Y27632, and then inoculated on a cell culture device. After centrifugation at 110 g for 6 min, the cells were placed in a 37°C, 5% CO2 incubator for 24 h; then E8 medium was added and cultured for another 24 h to obtain cell aggregates; S2. On day 0 of differentiation induction, cell aggregates were collected and induced to differentiate using E6 medium containing 2% Matrigel, 10 μM SB431542, 4 ng / mL bFGF, and 2.5 ng / mL BMP4; S3, on the third day of differentiation induction, add E6 medium containing 200 ng / mL LDN-193189 and 250 ng / mL bFGF; S4. On the 6th day of differentiation induction, add E6 medium, and change the medium by half on the 8th and 10th days; S5. On the 12th day of differentiation induction, the cell aggregates were collected, and skin organoid maturation medium containing 1% Matrigel was added, and the cells were placed on a shaker and cultured at 5% CO2, 37°C, and 65rpm. On the 15th day, half of the medium was replaced with skin organoid maturation medium containing 1% Matrigel; S6. From day 18 to day 45 of differentiation induction, replace half of the medium with skin organoid maturation medium every 3 days; S7. Starting from the 45th day of induction of differentiation, change half of the medium with skin organoid maturation medium every 2 days, and change the medium completely with skin organoid maturation medium once a week. Culture until the 85th to 100th day to obtain primary skin organoids.

3. The construction method according to claim 1 or 2, characterized in that: The method of culturing the complex at the air-liquid interface in step (4) comprises the following steps: The complex was added into the Transwell chamber, and then the skin organoid maturation medium was added to form an air-liquid culture interface. During the culture process, the whole medium was replaced every 3 days.

4. The construction method according to claim 3, characterized in that: The skin organoid maturation medium comprises: basal medium, 1×GlutaMax, 0.5×B-27minus vitamin A, 0.5×N-2 supplement, 0.1 mM 2-mercaptoethanol and 100 μg / mL normocin, wherein the basal medium is composed of advanced DMEM / F-12 and neurobasal medium in a volume ratio of 1:

1.

5. The construction method according to claim 4, characterized in that: The preparation method of the decellularized pig skin comprises the following steps: (A1) Pig skin was washed and sterilized, then frozen at -80°C for 4 h, thawed at room temperature, and the freezing and thawing process was repeated 10 times; (A2) The pig skin after the last thawing was placed in 2% SDS and shaken at 350 rpm at room temperature for 36 h; then the pig skin was taken out and placed in 1% Triton X-100 containing 2% penicillin-streptomycin double antibody and shaken at 350 rpm at room temperature for 12 h; (A3) The pig skin was removed and placed in a 4% sodium deoxycholate aqueous solution, and shaken at 200 rpm at room temperature for 2 hours. The pig skin was removed and washed with distilled water, deproteinized with a 3.4 M NaCL solution, and denucleic acid with a solution containing 10 μg / mL DNase and 5 μg / mL RNase, and then dried and sterilized.

6. Tissue-engineered skin organoids prepared according to the construction method according to any one of claims 1 to 5.

7. Application of the tissue engineered skin organoid according to claim 6 in disease model construction, drug screening and toxicity testing, and skin injury and repair and regeneration.

8. A method for preparing a UVB-induced skin organoid aging model, characterized in that: The steps include: The tissue engineered skin organoid according to claim 6 is taken, added to a PBS buffer, irradiated with UVB for 5 to 10 minutes, and then added with a skin organoid maturation culture medium and cultured for 24 hours to obtain the tissue engineered skin organoid.

9. The preparation method according to claim 8, characterized in that: The wavelength of the UVB irradiation is 302 nm and the intensity is 900 μW / cm 2 .

10. The UVB-induced skin organoid aging model prepared according to the preparation method of claim 8 or 9.

Images