Trunc-DDX46 fusion protein and preparation method thereof

Abstract

The invention belongs to the field of biological medicines, and relates to a Trunc-DDX46 fusion protein and a preparation method thereof. The amino acid sequence of the Trunc-DDX46 fusion protein is as shown in SEQ ID NO: 1. The method provided by the invention comprises the following steps: 1) amplifying a nucleic acid sequence of a coding Trunc-DDX46 fusion protein; 2) cloning the nucleic acid sequence to a prokaryotic expression vector; (3) transforming the prokaryotic expression vector into an E.coli strain; (4) inducing the expression of the Trunc-DDX46 fusion protein; and (5) purifying the Trunc-DDX46 fusion protein. The Trunc-DDX46 fusion protein has ATP hydrolase activity and helicase activity, the method is easy for large-scale production and can be used for high-throughput screening of a DDX46 enzyme activity inhibitor, and a protein expression system of the Trunc-DDX46 fusion protein is simple.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to a fusion protein of RNA helicase DDX46 and a preparation method and application thereof. Background Art

[0002] DDX46 is an RNA helicase belonging to the DEAD box protein family. It mainly functions in the cell nucleus and participates in the splicing process of mRNA precursors. DDX46 regulates RNA-RNA or protein-RNA interactions in an ATP-dependent manner, thereby affecting gene expression and cell function.

[0003] Studies have shown that the expression level of DDX46 is significantly upregulated in a variety of malignant tumors, such as colorectal cancer, esophageal squamous cell carcinoma, gastric cancer, and osteosarcoma. In addition, overexpression of DDX46 can promote the proliferation, invasion, and migration of tumor cells, and resist cell apoptosis, so it may become a potential anti-tumor drug target. There is evidence that DDX46 is overexpressed in glioblastoma, esophageal squamous cell carcinoma, breast cancer, gastric cancer, colorectal cancer, osteosarcoma, ovarian cancer, and skin squamous cell carcinoma. In esophageal squamous cell carcinoma cell lines, silencing of DDX46 can inhibit cell proliferation and induce apoptosis. The more aggressive tumor phenotype in breast cancer patients with high expression of DDX46 is significantly associated with high-grade histological grade and lymph node metastasis.

[0004] In addition, DDX46 is also involved in antiviral immune responses. It removes mRNAs from interferon transcripts by binding to the RNA demethylase ALKBH5. 6 A modification, thereby inhibiting the expression of IFN-β, thereby affecting the body's natural immune response, and playing an important role in regulating antiviral immune response. In terms of cell cycle regulation, silencing of DDX46 can block the cell cycle in the G1 phase, and may regulate cell proliferation by affecting the cell cycle process. In addition, DDX46 also affects the proliferation and migration of trophoblast cells through the PI3K / Akt / mTOR signaling pathway.

[0005] DDX46 plays an important role in many biological processes and may become a potential anti-tumor drug target and marker. Unfortunately, most studies are still in the early stages, still at the level of in vitro cell and animal experiments, and further exploration of the various mechanisms of DDX46 is needed before it can be applied in anti-tumor treatment.

[0006] The existing technology is to transiently transfect HEK293T cells with an expression plasmid carrying the DDX46 ORF sequence to overexpress and produce DDX46 protein. Its construction is complex, the process is difficult, the cost is high, the yield is low, and there is no purified protein production, which is not suitable for high-throughput inhibitor screening. Summary of the invention

[0007] The present invention expresses recombinant human RNA helicase DDX46 fusion protein Trunc-DDX46 through an E. coli expression system. The growth cycle of E. coli is fast and the efficiency is high. A sufficient amount of soluble and active fusion protein can be prepared in a short time, which is suitable for high-throughput screening of DDX46 inhibitors. Therefore, the purpose of the present invention is to overcome the shortcomings of the prior art, and to provide an easily accessible RNA helicase DDX46 gene cloning method and fusion protein preparation method using the cDNA sequence of human skin fibroblast HSF as a library template. The prepared fusion protein has good solubility in E. coli and has good ATP hydrolase activity and helicase activity.

[0008] In one aspect, the present invention provides a Trunc-DDX46 fusion protein having both ATP hydrolase and helicase activities, wherein the amino acid sequence of the fusion protein is shown in SEQ ID NO:1.

[0009] Compared with the natural human RNA helicase DDX46 protein, the N-terminus of the Trunc-DDX46 fusion protein lacks 191 amino acids, and a fusion tag, thioredoxin (TrxA), is added to the N-terminus, and a purification tag, histidine tag (His-Tag), is added to the C-terminus.

[0010] Therefore, in an embodiment of the present invention, the N-terminus of the Trunc-DDX46 fusion protein has a fusion tag, namely, thioredoxin (TrxA).

[0011] In a second aspect, the present invention provides a nucleic acid encoding a Trunc-DDX46 fusion protein.

[0012] In an embodiment of the present invention, the nucleotide sequence of the nucleic acid is as shown in SEQ ID NO:2.

[0013] In a third aspect, the present invention provides an expression vector comprising a nucleic acid encoding a Trunc-DDX46 fusion protein.

[0014] In a preferred embodiment of the present invention, the expression vector is a prokaryotic expression vector, and the prokaryotic expression vector is preferably pET32M.3C.

[0015] In a fourth aspect, the present invention provides a strain containing the expression vector described in the third aspect.

[0016] In a preferred embodiment, the strain contains the expression vector. In a specific embodiment, the strain is an E. coli strain, such as Rossette DH5α, BL21 (DE3) or BL21 pLysS.

[0017] In a fifth aspect, the present invention provides a method for preparing a Trunc-DDX46 fusion protein, comprising the following steps:

[0018] 1) Amplifying the nucleic acid sequence encoding the Trunc-DDX46 fusion protein;

[0019] 2) Cloning the nucleic acid sequence into a prokaryotic expression vector;

[0020] 3) Transforming the prokaryotic expression vector into the E. coli strain;

[0021] 4) Induce the expression of Trunc-DDX46 fusion protein, and

[0022] 5) Purification of Trunc-DDX46 fusion protein.

[0023] In a specific embodiment of the present invention, the prokaryotic expression vector is pET32M.3C.

[0024] In a specific embodiment of the present invention, the E. coli strain is Rossette DH5α, BL21(DE3) or BL21pLysS.

[0025] In a specific embodiment of the invention, purification can be performed, for example, by affinity chromatography.

[0026] In a sixth aspect, the present invention provides the use of the Trunc-DDX46 fusion protein in:

[0027] 1) preparing a preparation for unwinding the double-stranded structure of oligonucleic acid;

[0028] 2) RNA modification and processing, preferably pre-mRNA splicing; or

[0029] 3) High-throughput screening of inhibitors of DDX46 helicase or ATP hydrolase activity.

[0030] Compared with the prior art, the present invention has the following beneficial effects. The invention expresses the core functional fragment of RNA helicase DDX46 through the E. coli expression system, which overcomes the problem that natural DDX46 cannot be obtained by genetic engineering methods due to its large molecular weight and complex spatial structure. The present invention intercepts the CDS fragment of natural human RNA helicase DDX46 through genetic engineering technology, and expresses the fusion protein in prokaryotic form. It has strong biological safety, high expression level, stable purification process, and low cost, which is conducive to the large-scale production of DDX46 and the subsequent high-throughput screening of inhibitors. Compared with the system of overexpressing and producing DDX46 protein by HEK293T cells (human embryonic kidney 293 cells integrated with SV40 large T antigen gene) used in existing studies, the present invention overcomes the shortcomings of complex construction, difficult process, high cost and low yield. The E. coli expression system used in the present invention is easy to culture, has a shorter growth cycle, and a fast passage speed. The recombinant fusion protein Trunc-DDX46 expressed has a higher yield and stronger activity, and is easier to achieve large-scale and expanded protein production (see Table 1). The recombinant fusion protein Trunc-DDX46 prepared by the present invention has good biological activity. It is determined by in vitro detection that it also has good ATP hydrolase and helicase enzyme activities, and can be used for physiological and biochemical operations such as DDX46 activity analysis, high-throughput screening of inhibitors, intermolecular interactions, antibody and detection kit preparation. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 Sequence comparison between Trunc-DDX46 and natural DDX46 (schematic diagram);

[0032] Figure 2 is the nucleotide sequence alignment of Trunc-DDX46 and natural DDX46;

[0033] Figure 3 This is the construction map of the prokaryotic expression plasmid pET32M.3C-DDX46;

[0034] Figure 4 The induced expression of Trunc-DDX46 fusion protein in E. coli BL21 (DE3), where + indicates induction with the addition of inducer, and - indicates the group without the addition of inducer;

[0035] Figure 5 This is the result of Trunc-DDX46 affinity purification;

[0036] Figure 6 The results of the Trunc-DDX46 ATP hydrolysis activity assay;

[0037] Figure 7 The results of Trunc-DDX46 DNA helicase activity assay. DETAILED DESCRIPTION

[0038] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the examples are all performed according to conventional experimental conditions, such as those described in Sambrook et al. Molecular Cloning: a Laboratory Manual (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2012), or according to the conditions recommended by the manufacturer's instructions; the materials, reagents, etc. used, unless otherwise specified, can all be obtained through commercial channels.

[0039] Example 1. Gene cloning

[0040] In order to obtain the target gene fragment of Trunc-DDX46, the present invention cultured human skin fibroblasts (HSF, purchased from Shanghai Boersen Biotechnology Co., Ltd.), and amplified the full-length human DDX46 wild-type target gene fragment using the cDNA library of HSF as a template. Referring to the natural DDX46 protein sequence and nucleotide sequence (NCBI reference sequence: NP_001287789.1 and NM_001300860.2), the N-terminus of DDX46 was purposefully truncated by 191 amino acid residues, retaining the core enzyme activity region, and obtaining the amino acid sequence of Trunc-DDX46, and the corresponding primers were designed accordingly. The target gene fragment was obtained by PCR polymerase chain reaction, and a high concentration fragment solution was obtained by gel DNA recovery kit (Hangzhou Xinjing Biological Reagent Development Co., Ltd., gel DNA recovery kit, 2001050). The DDX46 truncated target gene fragment and vector pET32M.3C (purchased from BioVector plasmid vector strain cell protein antibody gene storage center) were double-digested with restriction endonucleases (MSCI, NotI) (New England Biotechnology (Beijing) Co., Ltd., R0534V, R3189V), and the truncated DDX46 gene fragment and the enzyme digestion product of the vector pET32M.3C were connected, and the connection product was transformed into E. coli DH5α (Shanghai Angyu Biotechnology Co., Ltd., DH5α, G6016), and the recombinant plasmid with correct sequencing was obtained by screening positive clones.

[0041] HSF were cultured until the cell density reached 90%, and RNA was extracted using an RNA extraction kit (Yisheng Biotechnology (Shanghai) Co., Ltd., TRIeasy TMPlus Total RNA Kit, 19211ES60) was used to extract total RNA from HSF cells; the concentration of the extracted RNA was measured to be 266 ng / μL, and the extracted RNA was reverse transcribed with 500 ng system to obtain a cDNA library. The reverse transcription system is shown in Table 1:

[0042] Table 1: Reverse transcription system

[0043]

[0044] Add the corresponding reagents according to the system and mix well, then heat at 37°C for 15 min and 80°C for 15 s, and dilute to obtain 500 ng / μL cDNA.

[0045] The full-length DDX46 was designed and amplified using the online primer design of Snap Gene software; the full-length DDX46 was truncated to obtain the amino acid sequence and nucleotide sequence of the truncated DDX46, and the primers were designed as follows:

[0046] DDX46-F:atgggtcggggagtcacgcca

[0047] DDX46-R: ctataagactttgtatcttcctttatttgttggttggtat

[0048] DDX46-F / MSCI:TTCTGGTTCTGGCCATATGAAACAAGGGAAA

[0049] DDX46-R / NotI:TTTCCCTTGTTTCATATGGCCAGAACCAGAA

[0050] The target gene fragment was obtained by PCR polymerase chain reaction, and a high concentration fragment solution was obtained by rapid purification kit (Beijing Quanshijin Biotechnology Co., Ltd., #S20513). The specific PCR reaction conditions are shown in Table 2.

[0051] Table 2: PCR amplification reaction system

[0052]

[0053] The PCR amplification program was as follows: pre-denaturation at 94°C for 1 min; denaturation at 98°C for 10 s, annealing at 55-65°C for 15 s, extension at 68°C for 3 min, 33 cycles; extension at 68°C for 10 min, and termination at 4°C.

[0054] The PCR product amplified by primers DDX46-F and DDX46-R is the CDS fragment of DDX46 in the cDNA of human skin fibroblast HSF. After 1% agarose gel electrophoresis, a product of 3096 bp was recovered.

[0055] The PCR product amplified by primers DDX46-F / MSCI and DDX46-R / NotI was a 2520 bp truncated fragment of DDX46, and the product of 2520 bp was recovered by 1% agarose gel electrophoresis.

[0056] The DDX46 truncated type and the vector pET32M.3C were double-digested with restriction endonucleases (MSCI, NotI) (New England Biotechnology (Beijing) Co., Ltd., R0534V, R3189V). The double-digestion systems are shown in Tables 3 and 4, respectively:

[0057] Table 3: Truncated DDX46 double enzyme digestion system

[0058]

[0059] Table 4: Double restriction enzyme digestion system of vector pET32M.3C

[0060]

[0061] Reagents were added according to the system, mixed and heated at 37°C for 2 h, and 1% nucleic acid gel was prepared for electrophoresis. After gel cutting and recovery, T4 ligase (New England Biotechnology (Beijing) Co., Ltd., T4 DNA ligase, M0202V) was used for ligation reaction. The ligation system is shown in Table 5:

[0062] Table 5: Ligation reaction system

[0063]

[0064]

[0065] After adding and mixing according to the ligation reaction system in Table 5, the ligation was carried out overnight at room temperature, and the ligation product was transformed into E. coli DH5α. The specific steps of the transformation are as follows:

[0066] 1) Take out the E. coli DH5α competent cells from the -80℃ refrigerator and place them on ice until they are completely thawed;

[0067] 2) Add 5 μL of the obtained ligation product to the competent cells, gently pipette to mix, and continue to place on ice for 30 minutes;

[0068] 3) Place the mixture after ice bath in a 42°C water bath for heat shock for 1 min;

[0069] 4) After heat shock, quickly place the competent cells back on ice and place them in an ice bath for 3 minutes;

[0070] 5) Add 700 μL LB liquid culture medium to the competent cells after ice bath, and place them in a 37°C constant temperature shaker for shaking culture and recovery for 45 to 60 minutes;

[0071] 6) The revived bacterial solution was centrifuged at 12000 rpm for 1 min, 100 μL of the supernatant was retained, the precipitate was blown evenly, and spread on an LB plate containing 100 mg / mL Amp (ampicillin), and incubated inverted at 37°C overnight.

[0072] 5-10 monoclonal colonies were picked up respectively, placed in 3 mL LB liquid medium supplemented with Amp, shaken to the logarithmic phase, centrifuged at 8000 rpm for 2 min to obtain strains, and plasmids were extracted using a plasmid mini-extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., plasmid mini-extraction kit, DP103-03). The obtained plasmid was digested again with restriction endonucleases (MSCI, NotI) and then sequenced to obtain the correct DDX46 truncated plasmid, i.e., plasmid pET32M.3C-DDX46. Its construction map is shown in Figure 3 shown.

[0073] Example 2: Protein induced expression and affinity purification

[0074] The correctly sequenced plasmid pET32M.3C-DDX46 was transformed into E.coli BL21 (DE3) (Shanghai Biotech Co., Ltd., BL21 (DE3) super competent cells, D1013S) expressing the protein. The specific steps of transformation are as follows:

[0075] Take out E.coli BL21 (DE3) competent cells from the -80℃ refrigerator and place them on ice until they are completely thawed; take 30μL competent cells and add 2μL of correctly sequenced plasmid to them, gently blow and mix, and continue to place on ice for 30 minutes; put the mixture after ice bath into a 42℃ water bath for heat shock for 1 minute; quickly put the competent cells after heat shock back on ice and place them on ice for 3 minutes; add 700μL LB liquid culture medium to the competent cells after ice bath, place them in a 37℃ constant temperature shaker for shaking culture and recovery for 45-60 minutes; centrifuge the recovered bacterial solution at 12000rpm for 1 minute, retain 100μL supernatant, blow the precipitate evenly, spread it on an LB plate containing 100mg / mL Amp, and invert and culture at 37℃ overnight.

[0076] Pick 4 monoclones with good growth and place them in 3mL LB liquid culture medium containing Amp and shake them to the logarithmic phase. Add 20% glycerol to 1mL of the bacterial solution and store it at -80°C. Add 10μL of 100mM IPTG inducer (Shanghai Aladdin Biochemical Technology Co., Ltd., isopropyl-β-D-thiogalactoside, I104812) to 1mL of the bacterial solution and induce it at low temperature for 4-6h. 1mL of the bacterial solution was used as the control. The control group and the induced bacterial solution were collected and centrifuged at 8000rpm for 2min. 250μL PBS ((1% protease inhibitor (Kailian Gene Technology Co., Ltd., protease inhibitor Cocktail (EDTA-Free, 100x in DMSO), HY-K0010) was added and mixed, then ultrasonically broken. Centrifuge at 4°C, 10000rpm for 10min, take the supernatant as the protein solution, add 20μL 5× protein loading buffer [1M Tris-HCl (pH: 6.8) 25% (w / v) + SDS (sodium dodecyl sulfate) 10% (w / v) + bromophenol blue 0.5% (w / v) + glycerol 50% (w / v) + β-mercaptoethanol 5% (w / v)] were mixed and the protein was denatured at 95°C for 5 minutes; a 10% SDS-page gel was prepared, and 30 μL of the protein induction group and the control group were loaded respectively. After running the gel, Coomassie brilliant blue stain (Shanghai Biyuntian Biotechnology Co., Ltd., Coomassie brilliant blue rapid staining solution, P0017) was used for rapid staining for 2 hours, and the Coomassie brilliant blue solution was recovered and decolorized with water until the bands can be clearly seen. The induction efficiency can be judged according to the size of the bands. Figure 4 As shown, a specific target protein band was observed at around 107 kDa, indicating that the Trunc-DDX46 fusion protein was expressed in a soluble form and had a significant induction efficiency.

[0077] Example 3: Large-scale protein expression and affinity purification

[0078] After obtaining the strain with the induced target protein, expand the culture to 500mL LB medium, collect the bacterial solution; 81mL 0.5M Na2HPO4 and 19mL 0.5M NaH2PO4 are mixed and fixed to 1L, and 50mM PBS is prepared. 100mL 50mM PBS is added with 0.15M NaCl, 2mM β-mercaptoethanol, 25mM imidazole, 1% TritonX-100, and 20% glycerol to prepare the lysis solution. Add 30mL of lysis solution to the bacterial solution, ultrasonically break it until it is completely lysed, centrifuge it at low temperature for 30min, take the supernatant, add His tag protein purification medium (Yisheng Biotechnology (Shanghai) Co., Ltd., His tag protein agarose purification resin, 20502ES50) and shake for 1 hour to make the protein hang on the purification medium. 0.15M NaCl, 1mM β-mercaptoethanol, 25mM imidazole, 0.1% TritonX-100 were dissolved in 1L 50mM PBS to prepare washing solution 1. 0.5M NaCl, 1mM β-mercaptoethanol, 25mM imidazole, 0.1% TritonX-100 were dissolved in 1L 50mM PBS to prepare washing solution 2. Wash the beads 5 times by inverting with 10mL each of washing solution 1 and washing solution 2, and then elute the target protein with 250mM imidazole concentration (0.5M NaCl, 1mM β-mercaptoethanol, 250mM imidazole, 0.1% TritonX-100 dissolved in 1L 50mM PBS).

[0079] The eluted protein samples were identified by SDS-PAGE. Figure 5 As shown: A specific target protein band was observed at about 107 kDa. The concentration of the purified protein in the eluate 1 after purification was determined by using a protein quantitative reagent to reach 2.1 mg / mL. That is, the total yield of DDX46 fusion protein that can be extracted from 0.5 L of bacterial culture system is 3-5 mg (purity greater than 60%).

[0080] The experimental results showed that the induction efficiency of Trunc-DDX46 fusion protein was obvious, and Trunc-DDX46 fusion protein with higher purity and concentration could be obtained.

[0081] Example 4: ATPase activity assay

[0082] Firefly luciferase (also called luciferase) catalyzes luciferin to produce fluorescence, which requires ATP to provide energy. When both firefly luciferase and luciferin are in excess, the generation of fluorescence is proportional to the concentration of ATP within a certain concentration range. In this way, the ATP concentration in the solution can be detected with high sensitivity. DDX46 is an ATP-dependent RNA helicase, which consumes ATP significantly when unwinding double-stranded DNA. Generally, the more the chemiluminescent signal is reduced, the stronger the ATP hydrolysis activity of the Trunc-DDX46 protein. Referring to this method, the ATPase activity of the Trunc-DDX46 fusion protein in this embodiment is determined as follows:

[0083] 1) Preparation of DNA substrates. Design and synthesize two DNA primers containing different substrate labels, namely, biotin-labeled DNA: 5'-biotin-GCTGACCCTGCTCCCAATCGTAATCTATAGTGTCACCTA-3'; digoxigenin-labeled DNA: 5'-DIG-CGATTGGGA GCAGGGTCAGC-3'. Resuspend the two DNA oligomers containing different labels at a molar ratio of 1:1 and mix them in an annealing reaction solution (2mM HEPES (N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid), pH 7.0, 0.05M NaCl, 0.1mM EDTA (ethylenediaminetetraacetic acid) and 0.01% (w / v) SDS). Heat the reaction system to 100°C for 5 minutes, then cool to 65°C and keep the reaction for 30 minutes. The DNA annealing reaction was set at 22°C for 4 hours. The final obtained double-stranded DNA molecules were diluted with deionized water to a DNA substrate solution with a final concentration of 2.5 ng / μL, and stored at -20°C after aliquoting for later use.

[0084] 2) Prepare enzyme reaction solution (25mM 4-MOPS, 5μM ATP, 2mM DTT, 3mM MnCl2, 100μg / mL BSA), add 90μL enzyme reaction solution, 2ng DNA, and 4μL extracted Trunc-DDX46 protein to each well. Place in a 37℃ incubator for 1h.

[0085] 3) Preparation of detection reagents: Prepare ATP detection solution: Mix ATP detection reagent and diluent (Shanghai Biotech Biotechnology Co., Ltd., ATP detection kit, S0026-1, S0026-2) at a ratio of 1:9. Add ATP detection solution to 96-well plate at 100 μL / well and let stand at room temperature for 5 minutes.

[0086] 4) ATP detection: 40 μL of ATP reaction solution was added to the wells, mixed evenly, and then the plate was shaken at 600 rpm for 1 min using a multifunctional microplate reader (VICTOR Nivo 3S, Shanghai, China). The chemiluminescence function was used to read the value of 700 nm IR Blocker, and the reading time for each well was 5 s / well.

[0087] The experimental results show that Trunc-DDX46 has significant ATPase activity. Figure 6 ,Depend on Figure 6 It can be seen that the luminescent signal of the experimental group with Trunc-DDX46 is significantly lower than that of the control group (without enzyme), and the reading value difference is obvious. It can be judged that the Trunc-DDX46 protein consumes a large amount of ATP in the enzyme reaction solution, proving that Trunc-DDX46 has obvious ATPase activity.

[0088] See Table 6 for ATPase activity data. By comparing the average light signal values ​​of the control group and the Trunc-DDX46 protein group in the data, it can be seen that Trunc-DDX46 has ATP hydrolysis activity; the p value between samples is much less than 0.0001, and the difference between the two groups of data is obvious. Trunc-DDX46 has obvious ATPase activity; its Z factor is 0.89, indicating that the signal of the Trunc-DDX46 group has a high degree of distinction from the background, and the data has high reliability and repeatability, which is suitable for further analysis and research.

[0089] Table 6: ATPase activity data

[0090] Control group (no enzyme) Trunc-DDX46 6316214 1816101 6438784 1833944 6706861 1846532 average value 6487286.333 1832192.333 variance 163126.9994 12484.99612 P-value 0.000 Z factor 0.89

[0091] Example 5: Helicase activity assay

[0092] The biotin-labeled oligo DNA molecule is annealed and paired with another digoxigenin-labeled oligo DNA molecule to form a double-stranded DNA molecule with a 3'-protruding part. The double-stranded DNA molecule can be adsorbed by the neutral avidin spread on the bottom of the 96-well plate. After the helicase undergoes a depolymerization reaction, the digoxigenin-labeled single-stranded DNA molecule will fall off due to depolymerization. Then, alkaline phosphatase-labeled anti-digoxigenin secondary antibody and alkaline phosphatase substrate CSPD are added to the 96-well plate in turn, and the light signal intensity generated by each well on the plate is analyzed to identify the activity of the helicase. Generally, the more the chemiluminescent signal intensity decreases, the stronger the activity of the helicase. Referring to this method, the helicase activity of the Trunc-DDX46 fusion protein is determined as follows:

[0093] The helicase activity assay was performed using a white 96-well plate. The following example was used to detect the DDX46 truncated protein Trunc-DDX46. Three replicates were performed. 12 mL of Na2CO3 was added with 185 μL of 1 mg / mL neutravidin (Thermo Fisher Scientific-CN, Thermo Scientific TMNeutrAvidin protein, 31000), dilute 1mg / mL avidin to a final concentration of 15μg / mL, and plate at a volume of 100μL / well, seal with sealing film and store at 4℃ overnight. The next day, wash the plate 3 times with 10mM PBS 200μL / well, pat dry and let it air dry for 15min. Weigh 0.04g BSA and dissolve it with 40mL 10mM PBS, prepare 1mg / mL BSA (bovine serum albumin) as blocking solution, add 100μL / well, cover the plate and block it for 1h at room temperature, wash the plate 3 times with 10mM PBS 200μL / well, pat dry and let it air dry for 15min. Take 1mL 1M PBS and NaCl, add 14μL of 2ng / μLa oligo-DNA (DNA substrate prepared in Example 4) to prepare 2ng of DNA per well, add 75μL / well and cover the plate and incubate at room temperature for 2h, wash the plate twice with 10mM PBS 200μL / well, wash once with 50mM Tris-HCl-NaCl 200μL / well, take 1200μL 25mM MOPS (3-morpholinepropanesulfonic acid), 600μL 5mM ATP, 24μL 2mM DTT (DL-dithiothreitol), 120μL 3 mM MnCl2, 120μL 100μg / mL BSA to prepare the reaction solution, add 95μL to each well, and add 4μL / well of Trunc-DDX46 fusion protein, react at 37℃ for 1h, wash twice with 150mM NaCl, pat dry and let dry for 15min, take 3mL pH 9 μL of Tween-20 was added to 0.1 M maleic acid and 0.15 M NaCl at pH = 7.5 to prepare a cleaning solution, 200 μL / well, let it stand for 5 min, weigh 400 mg of BSA, take 4 mL of 0.1 M maleic acid and 0.15 M NaCl at pH = 7.5 to dissolve, prepare a blocking solution, 300 μL / well blocked for 30 min, take 5 mL of the blocking solution and add 1 μL anti-DIG antibody (Beckman Coulter Life Sciences (Shanghai) Co., Ltd., Ms mAb to Digoxigenin [21H8] (AP), ab119345) 20 μL / well added, incubate at room temperature for 30 min, recover the antibody and wash twice with 100 μL / well of Tris-NaCl at pH 9.5 and 0.1 mM, take 2 mL of Tris-NaCl at pH 9.5 and 0.1 mM, add 20 μL of CSPD (Thermo Fisher Scientific Scientific-CN, CSPD TM Substrate (0.25 mM ready-to-use, T2141), after mixing, add 20 μL of color development to each well, let it stand for 5 min, and use a multifunctional microplate reader at 10 s / well to read the RLU (relative light unit) value of each well to determine the enzyme activity.

[0094] The experimental results show that Trunc-DDX46 has significant helicase activity. Figure 7 .Depend on Figure 7 It can be seen that the luminescent signal of the experimental group with Trunc-DDX46 is significantly lower than that of the control group (without enzyme), and the reading value difference is obvious. It can be judged that the Trunc-DDX46 protein catalyzes a large number of aoligo-DNA depolymerization reactions, proving that Trunc-DDX46 has obvious helicase activity.

[0095] Referring to the raw data of helicase activity in Table 7, by comparing the average light signal values ​​of the control group and the Trunc-DDX46 protein group in the raw data, it can be seen that Trunc-DDX46 has helicase activity; the p value between the samples is much less than 0.0001, and the difference between the two groups of data is obvious, and Trunc-DDX46 has obvious helicase activity; its Z factor is 0.42, indicating that there is a clear distinction between the signal and the background of the Trunc-DDX46 group, and the data reliability and repeatability are stable, which can be further optimized for high-throughput screening and research of DDX46 inhibitors.

[0096] Table 7: Helicase activity data

[0097] Control group (no enzyme) Trunc-DDX46 4785 2491 6456 2823 5312 2725 5759 2731 5032 3155 5257 2907 average value 5433.5 2805.333333 variance 596.5107711 220.771073 P-value 0.000 Z factor 0.42

[0098] Based on the above data, compared with the mammalian cell expression system, the purification of DDX46 recombinant protein through the E. coli expression system has more prominent advantages, as shown in Table 8:

[0099] Table 8: Comparison of DDX46 protein production systems

[0100]

Claims

1. Trunc-DDX46 fusion protein, characterized in that The amino acid sequence of the Trunc-DDX46 fusion protein is shown in SEQ ID NO:

1.

2. The Trunc-DDX46 fusion protein according to claim 1, characterized in that The N-terminus of the Trunc-DDX46 fusion protein carries thioredoxin A (TrxA).

3. A nucleic acid, characterized in that The nucleic acid encodes the Trunc-DDX46 fusion protein of claim 1.

4. The nucleic acid according to claim 3, characterized in that The nucleotide sequence of the nucleic acid is shown in SEQ ID NO:

2.

5. An expression vector, characterized in that The expression vector contains the nucleic acid encoding claim 3, and preferably the expression vector is a prokaryotic expression vector, such as pET32M.3C.

6. A strain characterized in that The strain contains the expression vector according to claim 5, and preferably the strain is an E. coli strain, such as Rossette DH5α, BL21 (DE3) or BL21 pLysS.

7. A method for preparing a Trunc-DDX46 fusion protein, characterized in that: The method comprises the following steps: 1) Amplifying the nucleic acid sequence encoding the Trunc-DDX46 fusion protein; 2) cloning the nucleic acid sequence into a prokaryotic expression vector; 3) transforming the prokaryotic expression vector into an E. coli strain; 4) inducing the expression of the Trunc-DDX46 fusion protein, and 5) purifying the Trunc-DDX46 fusion protein, Among them, the preferred prokaryotic expression vector is pET32M.3C, And wherein, preferably the E. coli strain is Rossette DH5α, BL21 (DE3) or BL21 pLysS.

8. Use of the Trunc-DDX46 fusion protein according to claim 1 in: 1) preparing a preparation for unwinding the double-stranded structure of oligonucleic acid; 2) RNA modification and processing, preferably pre-mRNA splicing; or 3) High-throughput screening of inhibitors of DDX46 helicase or ATP hydrolase activity.

Images