DHX8 fusion protein and preparation method thereof

Abstract

The invention belongs to the field of biological medicine, and relates to DHX8 fusion protein and a preparation method thereof. The amino acid sequence of the DHX8 fusion protein is as shown in SEQ ID NO: 1. The method provided by the invention comprises the following steps: 1) amplifying a nucleic acid sequence encoding DHX8 fusion protein; 2) cloning the nucleic acid sequence into a prokaryotic expression vector; (3) transforming the prokaryotic expression vector into an E.coli strain; 4) inducing expression of the DHX8 fusion protein; and 5) purifying the DHX8 fusion protein. The DHX8 fusion protein disclosed by the invention has ATP hydrolase activity and helicase activity, the method disclosed by the invention is easy for large-scale production and can be used for high-throughput screening of DHX8 helicase inhibitors, and an expression system of the DHX8 fusion protein is simple.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to an RNA helicase DHX8 fusion protein and a preparation method and application thereof. Background Art

[0002] DHX8 (DEAH-Box Helicase 8) is a protein-coding gene that belongs to the DEAH box helicase family. It is involved in the RNA splicing process and plays a key role in releasing mature mRNA. This protein helps release the spliced ​​RNA from the spliceosome by binding to the spliceosome so that it can be translated into protein.

[0003] The structure of DHX8 includes a highly variable N-terminal domain and a conserved C-terminal helicase domain, similar to other DEAH-box RNA helicases. In the C-terminal helicase domain, two RecA domains (RecA1 and RecA2) are contained, which form the core of the helicase and are involved in the binding and hydrolysis of ATP, the binding of RNA, and the helicase activity. In addition, DHX8 also contains a winged helix, a ratchet-like structure, and an oligonucleotide binding (OB) folding structure. Studies have also found that DHX8 has a preference for adenine-rich RNA and triggers ATP hydrolysis after RNA binding, leading to the release of ADP. In addition, specific structural regions of DHX8, such as the DEAH motif, the "hook loop" and the "hook" regions, are essential for its function. These regions are believed to be key to regulating the directional movement of RNA through the RNA binding channel.

[0004] Abnormal regulation of alternative splicing is also associated with various human diseases, such as cancer. The full-length DHX8 protein has a large and complex structure. The human DHX8 protein contains more than 1220 amino acids and includes multiple domains, which are widely involved in the binding of other proteins in the spliceosome and the recognition of specific substrates. In view of this, the expression study of DHX8 protein is extremely important.

[0005] Studies have shown that DHX8 protein may be required for the replication of human immunodeficiency virus type 1 (HIV-1). In addition, abnormal expression of the DHX8 gene is associated with a variety of diseases, including Cakut (congenital kidney and urinary tract anomalies) and human immunodeficiency virus type 1 (Human ImmunodeficiencyVirus Type 1). DHX8 affects 95% of human genes in cells by participating in alternative splicing processes, and its abnormal function may be closely related to the development of cancer. Therefore, in-depth research on DHX8 and its structure and function is of great significance for understanding the complex mechanisms of cancer and developing new treatment strategies. For example, Novobiocin was found to act as an inhibitor of DHX8, inhibiting its activity by forming hydrogen bonds and Pi-Pi interactions with the DHX8 protein.

[0006] In cancer research, DHX8 has been mentioned as a prognostic marker for adenocarcinoma and has low cancer specificity in multiple cancer types. Detection of DHX8 protein in plasma showed that it was not detected in immunoassays, mass spectrometry, and proximity extension assays. Studies have shown that circDHX8 expression is elevated in gastric cancer (GC), and its overexpression can significantly enhance the proliferation, invasion, and migration of gastric cancer cells while inhibiting apoptosis. In contrast, knockdown of circDHX8 significantly reduced these effects and inhibited tumor growth in xenograft tumor models.

[0007] Existing technology adopted The baculovirus expression system expresses DHX8 recombinant protein, and its construction process is complex, time-consuming, labor-intensive, and costly, and the purified protein is not suitable for high-throughput inhibitor screening. Summary of the invention

[0008] In view of this, the object of the present invention is to provide a DHX8 fusion protein and a preparation method thereof to solve the problems existing in the prior art.

[0009] The purpose of the present invention and the solution to its technical problems can be achieved through the following implementation schemes.

[0010] In one aspect, the present invention provides a DHX8 fusion protein having ATP hydrolase and helicase activities, wherein the amino acid sequence of the fusion protein is shown in SEQ ID NO:1.

[0011] Compared with the full-length human RNA helicase DHX8 protein, the N-terminus of the DHX8 fusion protein lacks 234 amino acids, but has an additional fusion tag, namely, thioredoxin; the C-terminus lacks 263 amino acids, but has an additional purification tag, namely, histidine tag (His-Tag).

[0012] Therefore, in an embodiment of the present invention, the N-terminus of the DHX8 fusion protein has a fusion tag, thioredoxin A (TrxA).

[0013] In a second aspect, the present invention provides a nucleic acid encoding a DHX8 fusion protein.

[0014] In an embodiment of the present invention, the nucleotide sequence of the nucleic acid is shown in SEQ ID NO:2.

[0015] In a third aspect, the present invention provides an expression vector comprising a nucleic acid encoding a DHX8 fusion protein.

[0016] In a preferred embodiment of the present invention, the expression vector is a bacterial expression vector, such as pET.32m.3c.

[0017] In a fourth aspect, the present invention provides a strain containing the above expression vector.

[0018] In a preferred embodiment, the strain may be an E. coli strain, such as Rosetta (DE3) or BL21 (DE3), or BL21 pLysS.

[0019] In a fifth aspect, the present invention provides a method for preparing a DHX8 fusion protein, comprising the following steps:

[0020] 1) Amplifying the nucleic acid sequence encoding DHX8 fusion protein;

[0021] 2) cloning the nucleic acid sequence into a prokaryotic expression vector;

[0022] 3) transforming the prokaryotic expression vector into an E. coli strain;

[0023] 4) inducing the expression of the DHX8 fusion protein, and

[0024] 5) purifying the DHX8 fusion protein,

[0025] In a specific embodiment of the present invention, the prokaryotic expression vector may be a bacterial expression vector, such as pET.32m.3c.

[0026] In a specific embodiment of the present invention, the E. coli strain may be Rosetta (DE3), BL21 (DE3) or BL21pLysS.

[0027] In a specific embodiment of the invention, purification can be performed, for example, by affinity chromatography.

[0028] In a sixth aspect, the present invention provides use of DHX8 fusion protein in preparing a preparation for unwinding a double-stranded structure of an oligonucleic acid.

[0029] In a seventh aspect, the present invention provides the use of DHX8 fusion protein in RNA modification and processing, preferably in participating in mRNA shearing.

[0030] In an eighth aspect, the present invention provides the use of DHX8 fusion protein in high-throughput screening of DHX8 helicase or ATP hydrolase activity inhibitors.

[0031] Compared with the prior art, the present invention has the following beneficial effects. Specifically, the DHX8 fusion protein of the present invention has ATP hydrolase and helicase activities, can be used for DHX8 activity analysis, and is particularly beneficial for high-throughput screening of DHX8 protein inhibitors, intermolecular interactions, antibody and detection kit preparation and other physiological and biochemical operations. At the same time, it has strong solubility, high expression efficiency, and simple purification process. The present invention expresses the DHX8 fusion protein through the E. coli expression system. Since the growth cycle of bacterial culture is fast and efficient, a sufficient amount of DHX8 fusion protein can be prepared in a short time, which is suitable for high-throughput screening of DHX8 enzyme activity inhibitors. It overcomes the problem that the natural DHX8 has a large molecular weight (total length of 1221 amino acids) and a complex spatial structure and cannot be prepared by genetic engineering methods; the present invention selects a partial region of the natural human RNA helicase DHX8 through genetic engineering fusion protein technology, and supplemented with thioredoxin to express the fusion protein in prokaryotic form; compared with the insect expression system used in the prior art The baculovirus expression system overcomes the shortcomings of complex construction, difficult purification process and high cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 is the DHX8 gene map, wherein DHX8 is the full-length gene sequence, DHX8 truncation is the gene truncation sequence of the present invention, and DHX8 truncation △547 is the truncation gene sequence in existing literature;

[0033] Figure 2 and Figure 3 This is the construction map of the E. coli recombinant plasmid pET.32m.3c-DHX8;

[0034] Figure 4 This is the double enzyme digestion verification diagram of the recombinant plasmid pET.32m.3c-DHX8;

[0035] Figure 5 The induced expression of DHX8 fusion protein in Rosetta (DE3), + indicates induction; - indicates no induction;

[0036] Figure 6 The nickel column purification of DHX8 fusion protein;

[0037] Figure 7The results of the ATP helicase activity assay of DHX8 fusion protein;

[0038] Figure 8 The results of the helicase activity assay of DHX8 fusion protein;

[0039] Fig. 9 The amino acid sequence of DHX8 fusion protein is aligned with that of natural DHX8. DETAILED DESCRIPTION

[0040] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the examples are all based on conventional experimental conditions, such as Sambrook et al. Molecular Cloning Laboratory Manual (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2012), or the conditions recommended by the manufacturer's instructions, or the conditions recommended by the manufacturer's instructions; the materials, reagents, etc. used, unless otherwise specified, can all be obtained through commercial channels.

[0041] Example 1: Gene fragment amplification of DHX8 protein

[0042] Search the gene library GenBank to obtain the wild-type nucleotide (NM_004941.3) and amino acid sequence (NP_004932.1) of human DHX8. Use the Snap Gene software to design online primers and use the cDNA library of human skin fibroblasts (HSF, purchased from Shanghai Bolson Biotechnology Co., Ltd.) as a template to amplify the full-length wild-type human DHX8 gene fragment. The N-terminus and C-terminus of the DHX8 protein were purposefully truncated, with 234 amino acids truncated at the N-terminus and 263 amino acids truncated at the C-terminus, retaining the core enzyme activity region, and obtaining the corresponding amino acid sequence and nucleotide sequence. The amino acids after truncation are compared with the full length as shown below. Figure 2 As shown (DHX8 truncated). According to the nucleotide sequence, primers containing restriction sites after truncation were designed, and the full-length human DHX8 wild-type target gene fragment was used as a template, and PCR amplification was performed to obtain the truncated DHX8 target gene fragment.

[0043] The primers are shown in Table 1:

[0044] Table 1: Primer sequences

[0045] DHX8-F ATGCAGTTTGGTTGCTTTGTGCAGC DHX8-R TCAGCGCCGTCGGAAAGCTC DHX8 / BamHI-F GGGCCCGGATCCATGCGGAAGGACCGGGACAAATA DHX8 / NotI-R GAGTGCGGCCGCCATGGCTGTGATCAAAGTTT

[0046] The target gene fragment was obtained by PCR polymerase chain reaction, and a high concentration fragment solution was obtained by rapid purification kit (Beijing Quanshijin Biotechnology Co., Ltd., #S20513). The PCR amplification reaction system is shown in Table 2:

[0047] Table 2: PCR amplification reaction system

[0048]

[0049] The PCR amplification program was as follows: pre-denaturation at 94°C for 1 min; denaturation at 98°C for 10 s, annealing at 55-65°C for 15 s, extension at 68°C for 3 min, 33 cycles; extension at 68°C for 10 min, and termination at 4°C.

[0050] Example 2: Construction and identification of expression plasmid

[0051] The vector pET.32m.3c (purchased from BioVector plasmid vector strain cell protein antibody gene storage center) was double-digested with restriction endonucleases BamHl / Notl (NEB, New England Biotechnology (Beijing) Co., Ltd.), and the gel DNA recovery kit (SimGen, Hangzhou Xinjing Biological Reagent Development Co., Ltd., 2001050) was used to cut the gel to recover the purified vector fragment; at the same time, the gene fragment of the truncated protein DHX8 was double-digested with restriction endonucleases BamHl / Notl (NEB, New England Biotechnology (Beijing) Co., Ltd.), and the gel DNA recovery kit (SimGen, Hangzhou Xinjing Biological Reagent Development Co., Ltd., 2001050) was used to cut the gel to recover the purified gene fragment. The purified and recovered gene fragment was connected to the purified pET.32m.3c vector fragment by T4 DNA ligase (NEB, New England Biotechnology (Beijing) Co., Ltd., M0202V), and the connection was carried out at room temperature overnight. The specific reaction system is shown in Table 3. The prokaryotic expression plasmid construction map is shown in Figure 2 and Figure 3 The connection system is as follows:

[0052] Table 3: Ligation reaction system

[0053] Reaction system 20μL T4 DNA Ligase Buffer (10X) 2μL VectorDNA(5.8kb) 50ng InsertDNA (2.1kb) 93ng Nuclease-freewater to20μL T4DNALigase 1μL

[0054] Transformation: 5 μL of overnight ligation product was mixed with DH5α competent cells (Shanghai Angyu Biotech Co., Ltd.), incubated on ice for 30 min → 42°C for 1 min → on ice for 3 min, then mixed with 900 μL LB medium without antibiotics, incubated on a shaker at 37°C at 200 rpm for 1 h, centrifuged to collect bacteria, concentrated, resuspended and plated. Incubated overnight at 37°C incubator.

[0055] The next day, a single colony was picked and cultured to the logarithmic phase, and the recombinant plasmid was extracted using a plasmid extraction kit (Tiangen Biochemical Technology Co., Ltd., DP103). The recombinant plasmid was identified by double enzyme digestion with BamHl / Notl, and the correct recombinant plasmid was sequenced to confirm the correct insertion of the target gene sequence and ensure that the reading frame was completely correct.

[0056] The results of enzyme digestion identification are as follows Figure 4 As shown, BamH1 / Not1 double enzyme digestion identification showed that 8-1 to 8-6 all carried the correct gene fragment (2.1k).

[0057] Example 3: Protein expression and purification

[0058] Small amount of inducible expression

[0059] Transformation: 1 μL of recombinant plasmid was mixed with 30 μL E.coli Rosetta-(DE3) competent cells (Beyotime, Shenzhen Aidu Technology Co., Ltd., D1067S) for transformation (ice bath for 30 min-42°C heat shock for 1 min-ice bath for 3 min); the product of the previous step was mixed with 700 μL LB medium without antibiotics, shaken at 37°C 200 rpm for 1 h, centrifuged at 4000 rpm for 1 min to collect bacteria, and 100 μL of resuspended bacteria was reserved and plated, and the plate was inverted and cultured in a 37°C incubator overnight;

[0060] Induction by picking bacteria: select a single clone with large and easy-to-pick strains and add it to 3 mL of LB medium containing 100 μg / mL ampicillin and 34 μg / mL chloramphenicol, shake at 290 rpm and 37°C until the logarithmic phase, take 1 mL and add it to 250 μL of glycerol, and store it at -80°C; 1 mL is used for the control group; 1 mL is added with 10 μL of 100 mM IPTG (Shanghai Aladdin Biochemical Technology Co., Ltd., isopropyl-β-D-thiogalactoside, I104812), and continue to induce protein expression; 25°C, induce for 3-5 hours;

[0061] Protein extraction: collect the bacterial solution by centrifugation, add 250 μL of PBS solution (add 1% protease inhibitor, Kailian Gene Technology Co., Ltd., HY-K0010), resuspend and mix; ultrasonically disrupt until a translucent bacterial solution is formed; and centrifuge at 4°C for 10 min to collect the supernatant;

[0062] Take 20 μL of sample and mix with loading buffer (250 mM Tris-HCL pH = 6.8, 10% SDS, 0.5% bromophenol blue, 50% glycerol, 5% β-mercaptoethanol and ddH2O), then boil at 95℃ for 5 min, then load on gel and stain with Coomassie brilliant blue for 1 hour before decolorization. Small amount induction. The results are shown in Figure 5 As shown, it was shown that the DHX8 fusion protein was expressed in a soluble form.

[0063] Example 4: Large-scale protein expression

[0064] The E. coli Rosetta (DE3) strain with higher induction efficiency was expanded to 500 mL LB medium. After the logarithmic phase, IPTG (isopropyl-β-D-thiogalactoside, I104812, Shanghai Aladdin Biochemical Technology Co., Ltd.) was added with a final concentration of 1 mM. Protein expression was continued at 25°C for 4-5 hours, and then the bacterial liquid was collected by centrifugation.

[0065] The expressed truncated DHX8 protein was purified using a nickel affinity chromatography column. E. coli cells were resuspended with a lysis buffer (composition shown in Table 4), broken with 15% ultrasonic power for 15-25 minutes until the bacterial solution was transparent, centrifuged at 10000rpm4℃ for 30 minutes, and the supernatant was collected. The supernatant was mixed with the His-tagged protein agarose purification resin (Yisheng Biotechnology (Shanghai) Co., Ltd., 20502ES50) activated in an ice bath for 1 hour by inversion for 1 hour to allow the resin to fully bind to the protein. The protein was washed 5 times on the nickel column with 5 times the volume of wash solution 1 (composition shown in Table 4) and wash solution 2 (composition shown in Table 4), and the protein was eluted using a nickel column. The composition of the eluent is shown in Table 4.

[0066] The eluted protein samples were identified by SDS-PAGE. Figure 6 As shown: A specific target protein band was observed at around 97 kDa. The concentration of the DHX8 fusion protein in the E1 tube eluted after purification was determined by using a protein quantitative reagent to reach 1.5 mg / mL, and the total yield of the DHX8 fusion protein that can be extracted in a 0.5 L bacterial culture system is 1-3 mg.

[0067] Table 4: Solutions required for nickel column affinity chromatography

[0068] name Phosphate buffer (mM) Sodium chloride (mM) Imidazole (mM) Triton100 β-ME(mM) Lysis buffer 50 150 25 1％ 2 Lotion 1 50 150 25 0.1％ 1 Lotion 2 50 500 25 0.1％ 1 Eluent 50 / 250 / 1

[0069] Example 5: ATPase activity detection

[0070] Biotin-labeled oligo DNA molecules are annealed and paired with another oligo DNA molecule labeled with digoxigenin to form a double-stranded DNA molecule with a 3'-protruding portion. This double-stranded DNA molecule is mixed with the reaction solution and spread in a 96-well plate, and the corresponding enzyme protein is added to produce an enzyme reaction with it, thereby consuming ATP, and the detection reagent in the ATP detection kit (Shanghai Biyuntian Biotechnology Co., Ltd., S0026) needs to be based on the principle that luciferase catalyzes luciferin to produce fluorescence and requires ATP to provide energy, thereby detecting the ATP concentration consumed by the enzyme reaction. Generally, the more the chemiluminescent signal is reduced, the stronger the activity of the ATP enzyme is. With reference to this method, the ATP enzyme activity of the DHX8 fusion protein is detected as follows:

[0071] 1. Preparation of DNA substrates. Design and synthesize two DNA primers containing different substrate labels, namely: biotin-labeled DNA: 5'-biotin-GCTGACCCTGCTCCCAATCGTAATCTATAGTGTCACCTA-3'; and digoxigenin-labeled DNA: 5'-DIG-CGATTGGGAGCAGGGTCAGC-3'. The two single-stranded DNA oligomers containing different labels were resuspended at a molar ratio of 1:1 and mixed in the annealing reaction solution (2mM HEPES, pH7.0, 0.05MNaCl, 0.1mM EDTA and 0.01% (w / v) SDS). The reaction system was heated to 100℃ for 5min, then cooled to 65℃ and the reaction was maintained for 30min. The DNA annealing reaction was set at 22℃ and reacted for 4h. The final DNA double-stranded molecule was diluted with deionized water to a final concentration of 2.5ng / μL DNA substrate solution, and stored in aliquots at -20℃ for later use.

[0072] 2. Sample reaction solution: Prepare enzyme reaction solution (25mM4-MOPS, 5μMATP, 2mM DTT, 3mM MnCl2, 100μg / mLBSA). Add 90μL of enzyme reaction solution, 2ng DNA and 4μL of helicase DHX8 (i.e. DHX8 fusion protein) to each well. Place in a 37℃ incubator for reaction for 1h.

[0073] 3. Prepare ATP detection working solution: Use the ATP detection solution in the ATP detection kit (Shanghai Biotech Biotechnology Co., Ltd., S0026) and mix it with the ATP detection reagent diluent at a ratio of 1:9. Add ATP detection working solution to a 96-well plate at 100 μL / well and let it stand at room temperature for 5 minutes.

[0074] 4. Detection: Then take 40 μL of sample reaction solution (step 2) and add it to the ATP detection working solution and mix well. Use PerkinElmer multifunctional microplate reader (VictorNivo 3S, Ruifudi Biomedical (Shanghai) Co., Ltd.) to shake the plate for 1 minute, and then use PerkinElmer multifunctional microplate reader with chemiluminescence function (VictorNivo 3S, Ruifudi Biomedical (Shanghai) Co., Ltd.) to detect RLU value and analyze the signal. The reading time is 5s / well.

[0075] The results showed that the purified DHX8 fusion protein had significant ATPase activity. Figure 7 .Depend on Figure 7It can be seen that the luminescent signal of the experimental group of DHX8 fusion protein is significantly lower than that of the control group (without enzyme), and the reading value difference is obvious. It can be judged that the DHX8 fusion protein consumes a large amount of ATP in the enzyme reaction solution, proving that the DHX8 fusion protein has obvious ATPase activity.

[0076] The data in Table 5 show that the luminescent signal of the group with DHX8 fusion protein was significantly reduced compared with the control group, and the P value was <0.001, indicating that the DHX8 fusion protein has significant ATP hydrolase activity. Its Z factor is 0.59, indicating that the signal and background of the DHX8 fusion protein group are clearly distinguished, and the data reliability and repeatability are stable, which can be further optimized for high-throughput screening and research of DHX8 inhibitors.

[0077] Table 5: ATPase activity data of DHX8 fusion protein

[0078] Control group DHX8 fusion protein 4983143 2252117 4900723 2228959 5009650 2866680 Mean 4964505 2449252 Standard Deviation 46381 295318 P-value 0.0003 Zfactor 0.59

[0079] Example 6: Helicase activity detection

[0080] The biotin-labeled oligo DNA molecule is annealed and paired with another digoxigenin-labeled oligo DNA molecule to form a double-stranded DNA molecule with a 3'-protruding part. This double-stranded DNA molecule is spread on a 96-well plate with a neutral avidin link at the bottom. After the helicase reaction, the single-stranded DNA molecule containing the digoxigenin label will dissociate from the plate. Then, by adding an anti-digoxigenin secondary antibody with an alkaline phosphatase label and the alkaline phosphatase substrate CSPD to the 96 plate, the chemiluminescent signal generated by each well on the plate is analyzed to identify the activity of the helicase. Generally, the more the chemiluminescent signal decreases, the stronger the activity of the helicase. Referring to this method, the helicase activity of the DHX8 fusion protein is detected as follows:

[0081] 1. Dilute avidin (Thermo Fisher Scientific, 31000) to 15 μg / mL with 0.5 M Na2CO3 (pH = 9.3), add 100 μL to each well, and incubate at 4°C overnight.

[0082] 2. Pour out the avidin incubated overnight, wash with PBS buffer three times, pat dry the residual buffer on a paper towel, and dry at room temperature for 15 minutes.

[0083] 3. Incubate each well with 100 μL 0.1% BSA (bovine serum albumin, dissolved in PBS) at room temperature for 1 hour.

[0084] 4. After washing three times with PBS buffer, pat dry the residual buffer on a paper towel and dry at room temperature for 15 minutes.

[0085] 5. The annealed DNA (prepared in Example 5) was dissolved in 1 M PBS / 1 M NaCl, 4 ng DNA (75 μL) was added to a 96-well plate per well, and incubated at room temperature for 2 h.

[0086] 6. Wash twice with PBS buffer and once with 200 μL of 50 mM Tris-HCl (pH 7.5) containing 50 mM NaCl.

[0087] 7. Prepare reaction solution (25mM 4-MOPS (pH 7.0), 5mM ATP, 2mM DTT, 3mM MnCl2, and 100μg / mL BSA), add 95μL reaction solution and 5μL helicase DHX8 (i.e., DHX8 fusion protein) to each well, and add no enzyme to the control group; react at 37°C for 60min.

[0088] 8. After the enzyme reaction is completed, wash twice with 150 mM NaCl (200 μL / time), and then dry at room temperature for 15 minutes.

[0089] 9. Each well was washed again for 5 min with washing solution (0.1 M maleic acid, 0.15 M NaCl, 0.3% Tween 20 (pH 7.5)), 200 μl per well.

[0090] 10. Blocking: Add 300 μL of 10% BSA (dissolved in a mixture of 0.1 M maleic acid and 0.15 M NaCl, pH 7.5) to each well and block for 30 min.

[0091] 11. Remove the blocking solution, add 20 μL of anti-digoxigenin secondary antibody-AP (Ms mAb to Digoxigenin[21H8](AP), Beckman Coulter Life Sciences (Shanghai) Co., Ltd., diluted 1:5000 with blocking solution) to each well, and incubate at room temperature for 30 min.

[0092] 12. Wash twice with buffer (containing 0.1 M Tris-HCl and 0.1 M NaCl, pH 9.5), 100 μL each time.

[0093] 13. Add 20 μL of detection solution to each well and let stand for 5 minutes. Detection solution configuration: Mix buffer (containing 0.1 M Tris-HCl, 0.1 M NaCl, pH 9.5) and 25 mM chemiluminescent substrate CSPD at a ratio of 20:1 TM Substrate (Thermo Fisher Scientific, T2141).

[0094] 14. Use a PerkinElmer multifunctional microplate reader with chemiluminescence function (VictorNivo 3S, Ruifudi Biomedical (Shanghai) Co., Ltd.) to detect the RLU value and analyze the signal. The reading time is 10 s / well.

[0095] The experimental results showed that the purified DHX8 fusion protein had obvious helicase activity, such as Figure 8 As shown. Figure 8 It can be seen that compared with the control group, the luminescent signal of the experimental group of DHX8 fusion protein was significantly reduced, which can be judged that Trunc-DDX46 protein catalyzes a large number of aoligo-DNA depolymerization reactions, proving that Trunc-DDX46 has obvious helicase activity.

[0096] The data in Table 6 show that the luminescent signal of the group with DHX8 fusion protein was significantly reduced compared with the control group, and the P value was <0.001. The difference between the two groups of data was significant, indicating that the DHX8 fusion protein had significant helicase activity. Its Z factor was 0.45, indicating that the signal and background of the DHX8 fusion protein group were clearly distinguished, and the data reliability and repeatability were stable, which could be further optimized for high-throughput screening and research of DHX8 protein inhibitors.

[0097] Table 6: Helicase activity data of DHX8 fusion protein

[0098] Control group DHX8 fusion protein 5865 2526 5160 2403 6076 2659 5606 2601 6253 2787 5475 2852 average value 5739.17 2638.00 Standard Deviation 404.05 165.88 P-value 0.0000 Zfactor 0.45

[0099] Based on the above experimental results, it can be seen that the insect expression system Compared with the baculovirus expression system, the purification of DHX8 recombinant protein through the E. coli expression system has more prominent advantages, as shown in Table 7.

[0100] Table 7: DHX8 fusion protein production cost

[0101]

Claims

1. A DHX8 fusion protein having ATP hydrolase and helicase activities, characterized in that: The amino acid sequence of the DHX8 fusion protein is shown in SEQ ID NO:

1.

2. The DHX8 fusion protein expressed according to claim 1, characterized in that: The N-terminus of the DHX8 fusion protein has a fusion tag thioredoxin A (TrxA).

3. A nucleic acid encoding the DHX8 fusion protein of claim 1.

4. The nucleic acid according to claim 3, characterized in that The nucleotide sequence of the nucleic acid is shown in SEQ ID NO:

2.

5. An expression vector, characterized in that The expression vector contains the nucleic acid according to claim 3, and preferably the expression vector is a bacterial expression vector, such as pET.32m.3c.

6. A strain characterized in that The strain contains the expression vector according to claim 5, and preferably the strain is an E. coli strain, such as Rosetta (DE3), BL21 (DE3) or BL21 pLysS.

7. A method for preparing DHX8 fusion protein, characterized in that: The method comprises the following steps: 1) Amplifying the nucleic acid sequence encoding DHX8 fusion protein; 2) cloning the nucleic acid sequence into a prokaryotic expression vector; 3) transforming the prokaryotic expression vector into an E. coli strain; 4) inducing the expression of the DHX8 fusion protein, and 5) purifying the DHX8 fusion protein, Wherein, it is preferred that the prokaryotic expression vector is a bacterial expression vector, such as pET.32m.3c, Furthermore, preferably, the E. coli strain is Rosetta (DE3), BL21 (DE3) or BL21pLysS.

8. Use of the DHX8 fusion protein according to claim 1 in preparing a preparation for unwinding the double-stranded structure of oligonucleic acid.

9. Use of the DHX8 fusion protein according to claim 1 in RNA modification and processing, preferably in participating in mRNA shearing.

10. Use of the protein according to claim 1 in high-throughput screening of DHX8 helicase or ATP hydrolase activity inhibitors.

Images