Application of ZmPHR1 protein and its coding gene in regulating drought resistance of plants
By overexpressing or inhibiting the ZmPHR1 protein, regulating the transpiration rate and stomatal conductance of plant leaves, and using gene editing technology to cultivate drought-resistant corn, the problem of insufficient drought resistance of corn was solved, and efficient growth and water utilization under drought conditions were achieved.
Patent Information
- Application Number
- CN202311408469.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-10-27
- Publication Date
- 2025-10-17
- Estimated Expiration
- 2043-10-27
AI Technical Summary
How to regulate plant drought resistance, cultivate drought-resistant plant varieties, especially improve the drought resistance of corn to cope with drought stress, reduce water loss, and improve water use efficiency.
By overexpressing or inhibiting ZmPHR1 protein or its related genes, the transpiration rate, stomatal conductance and stomatal aperture of plant leaves can be regulated, and gene editing can be performed using genetic engineering methods such as CRISPR/Cas9 technology to cultivate transgenic plants.
Under drought conditions, transgenic plants showed higher drought resistance, reduced leaf wilting, transpiration rate and stomatal conductance, increased leaf water content, significantly shortened the breeding cycle and improved breeding efficiency.
Smart Images

Figure HDA0004517367150000011 
Figure HDA0004517367150000012 
Figure HDA0004517367150000013
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of biotechnology, and particularly relates to application of ZmPHR1 protein and a coding gene thereof in regulating drought resistance of plants. BACKGROUND
[0002] Drought is a major abiotic stress affecting crop yield and quality, and is one of the major problems faced by global agricultural production. Water stress can inhibit the vegetative growth and reproductive growth of crops, cause plant height to become short, leaf wilting, photosynthesis to decrease, organic matter accumulation and seed setting rate to decrease, and grain or fruit to be underfilled, thereby seriously affecting the yield and quality of crops. Corn is one of the three major food crops in the world, and is widely planted. Corn originated from the hot and humid tropical regions and is not drought-tolerant. Corn requires a large amount of water supply during growth and development, and drought stress affects all aspects of corn growth and development, and is the most important environmental factor causing corn yield reduction. In addition, drought stress also seriously reduces the quality of corn kernels.
[0003] Corn is the largest food crop in China, accounting for 42% of the grain planting area, and is planted in all parts of China, especially in the northeast, north and southwest regions. Cultivating new drought-resistant varieties can effectively cope with yield loss caused by drought stress and improve water use efficiency. How to use new technologies and methods to improve the drought resistance of corn through genetic modification of important genes and ultimately obtain new stress-resistant varieties is one of the common goals of modern basic biology and agricultural breeding. Through genetic engineering, overexpression and mutation of important genes are important parts of modern molecular breeding. In crops, the commonly used method is to overexpress one or several genes involved in important physiological processes, or to mutate the genes through CRISPR / Cas9 gene editing technology to obtain new stress-resistant varieties. SUMMARY
[0004] The problem to be solved by the present application is how to regulate the drought resistance of plants and cultivate drought-resistant plant varieties.
[0005] To solve the above technical problems, the present application first provides a new use of ZmPHR1 protein or biological material related to ZmPHR1 protein.
[0006] The present application provides application of ZmPHR1 protein or biological material related to ZmPHR1 protein in any one of the following S1) to S6):
[0007] S1) regulating the drought resistance of plants;
[0008] S2) regulating the transpiration rate and / or stomatal conductance of plant leaves;
[0009] S3) regulating the stomatal aperture of plant leaves;
[0010] S4) modulating stomata movement in plant leaves;
[0011] S5) use in transgenic plants with increased drought tolerance and / or decreased transpiration rate and / or decreased stomatal conductance and / or decreased stomatal aperture;
[0012] S6) genetic breeding of plants or improvement of plant germplasm;
[0013] said ZmPHR1 protein is a1) or a2) or a3) or a4):
[0014] a1) the amino acid sequence is the protein shown in SEQ ID NO: 3;
[0015] a2) a fusion protein obtained by linking a tag to the N-terminus or / and C- terminus of the protein shown in SEQ ID NO: 3;
[0016] a3) a protein related to drought tolerance in plants obtained by substitution and / or deletion and / or addition of one or several amino acid residues of the amino acid sequence shown in SEQ ID NO: 3;
[0017] a4) a protein related to drought tolerance in plants having 90% identity with the amino acid sequence shown in SEQ ID NO: 3, derived from Zea mays;
[0018] said biological material is any one of A1) to A8) below:
[0019] A1) a nucleic acid molecule encoding a ZmPHR1 protein;
[0020] A2) an expression cassette comprising the nucleic acid molecule of A1);
[0021] A3) a recombinant vector comprising the nucleic acid molecule of A1);
[0022] A4) a recombinant vector comprising the expression cassette of A2);
[0023] A5) a recombinant microorganism comprising the nucleic acid molecule of A1);
[0024] A6) a recombinant microorganism comprising the expression cassette of A2);
[0025] A7) a recombinant microorganism comprising the recombinant vector of A3);
[0026] A8) a recombinant microorganism comprising the recombinant vector of A4).
[0027] The tag in the protein of a2) is a polypeptide or protein fused to the protein of interest by DNA recombination technology in vitro to facilitate the expression, detection, tracking and / or purification of the protein of interest. The tag can be a Flag tag, a His tag, an MBP tag, an HA tag, a MYC tag, a GST tag and / or a SUMO tag, etc.
[0028] The substitution and / or deletion and / or addition of one or several amino acid residues in the protein of a3) is a substitution and / or deletion and / or addition of no more than 10 amino acid residues, or no more than 9 amino acid residues, or no more than 8 amino acid residues, or no more than 7 amino acid residues, or no more than 6 amino acid residues, or no more than 5 amino acid residues, or no more than 4 amino acid residues, or no more than 3 amino acid residues, or no more than 2 amino acid residues, or no more than 1 amino acid residue.
[0029] The identity in the protein of a4) refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using the homology search site on the Internet, such as the BLAST page of the NCBI homepage. For example, the identity of one pair of amino acid sequences can be calculated by using blastp as the program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as the Matrix, setting Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively and performing a search in Advanced BLAST 2.1, and then the value of the identity (%) can be obtained. The identity includes an amino acid sequence having 90% or more, or 91% or more, or 92% or more, or 93% or more, or 94% or more, or 95% or more, or 96% or more, or 97% or more, or 98% or more, or 99% or more homology with the amino acid sequence shown in SEQ ID NO: 4 of the present application.
[0030] The protein of a1) or a2) or a3) or a4) can be artificially synthesized, or the encoding gene thereof can be synthesized first and then expressed biologically.
[0031] In the above A1), the nucleic acid molecule can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA, etc.
[0032] The nucleic acid molecule can be specifically a gene as shown in the following B1) or B2) or B3):
[0033] B1) a DNA molecule as shown in Sequence 1;
[0034] B2) a DNA molecule as shown in Sequence 2;
[0035] B3) a DNA molecule having 75% or more identity with the nucleotide sequence defined in B1) or B2), and encoding ZmPHRl protein.
[0036] Those skilled in the art can easily mutate the nucleotide sequence encoding ZmPHRl protein of the present application by using known methods, such as methods of directed evolution and point mutation. Those artificially modified nucleotides having 75% or more identity with the nucleotide sequence encoding ZmPHRl protein, as long as they encode ZmPHRl protein and have the same function, are derived from the nucleotide sequence of the present application and equivalent to the sequence of the present application.
[0037] The term "identity" used herein refers to sequence similarity with the natural nucleic acid sequence. The "identity" includes nucleotide sequences having 75% or more, or 85% or more, or 90% or more, or 95% or more identity with the nucleotide sequence of the protein consisting of the amino acid sequence shown in Sequence 3 of the present application. The identity can be evaluated by naked eyes or computer software. Using computer software, the identity between two or more sequences can be expressed in percentage (%), which can be used to evaluate the identity between related sequences.
[0038] The 75% or more identity mentioned above can be 80%, 85%, 90% or 95% or more identity.
[0039] In the above A2), the expression cassette (ZmPHRl gene expression cassette) refers to DNA capable of expressing ZmPHRl protein in host cells, which can include not only a promoter to initiate transcription of ZmPHRl, but also a terminator to terminate transcription of ZmPHRl. Further, the expression cassette can also include enhancer sequences. The promoters that can be used in the present application include, but are not limited to, constitutive promoters; tissue-, organ- and development-specific promoters; and inducible promoters. Suitable transcription terminators include, but are not limited to, Agrobacterium nopaline synthase terminator (NOS terminator), CaMV 35S terminator of cauliflower mosaic virus, tml terminator, pea rbcS E9 terminator and nopaline and octopine synthase terminators.
[0040] In the above A3) and A4), the vector can be a plasmid, cosmid, bacteriophage or viral vector. The recombinant vector can be a vector containing the above nucleic acid molecule or the above expression cassette constructed using an existing plant expression vector. The plant expression vector includes a binary Agrobacterium vector and a vector useful for plant microprojectile bombardment, etc. Such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb, etc. The plant expression vector can also contain a 3' untranslated region of the foreign gene, i.e. containing a polyadenylation signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylation signal can guide the addition of polyadenylate to the 3' end of the mRNA precursor, such as the 3' untranslated region of the Agrobacterium crown gall inducing (Ti) plasmid gene (such as nopaline synthase gene Nos), plant gene (such as soybean storage protein gene). When using the gene of the present application to construct a plant expression vector, enhancers, including translation enhancers or transcription enhancers, can also be used. These enhancer regions can be ATG start codon or adjacent regions start codon, etc., but must be in the same reading frame as the coding sequence to ensure correct translation of the entire sequence. The source of the translation control signal and the start codon is wide, which can be natural or synthetic. The translation initiation region can be from the transcription initiation region or the structural gene. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as adding genes that can be expressed in plants to produce color-changing enzymes or luminescent compounds (GUS gene, luciferase gene, etc.), marker genes of antibiotics (such as nptll gene conferring resistance to kanamycin and related antibiotics, bar gene conferring resistance to herbicide phosphine, hph gene conferring resistance to antibiotic hygromycin, dhfr gene conferring resistance to methotrexate, and EPSPS gene conferring resistance to glyphosate), or anti-chemical agent marker genes (such as herbicide-resistant genes), mannose-6-phosphate isomerase genes that provide the ability to metabolize mannose. For the safety of transgenic plants, no selective marker gene can be added, and the transformed plants can be directly screened under stress.
[0041] In the above A5) to A8), the microorganism can be yeast, bacteria, algae or fungi, such as Agrobacterium. The recombinant microorganism can be a microorganism containing the above nucleic acid molecule or the above expression cassette or the above recombinant vector.
[0042] The drought resistance of the plant in the S1) is improved, and specifically, the higher the content and / or activity of the ZmPHR1 protein in the plant or the higher the expression of the ZmPHR1 gene, the better the growth and development of the plant under drought conditions, the lower the wilting degree of the leaf, the higher the water content of the leaf, and the higher the survival rate.
[0043] The transpiration rate of the plant leaf in the S2) is reduced, and the stomatal conductance of the plant leaf is reduced.
[0044] The stomatal aperture of the plant leaf in the S3) is reduced.
[0045] The stomatal movement of the plant leaf in the S4) is inhibited or promoted.
[0046] The purpose of the genetic breeding of the plant or the improvement of the plant germplasm resource in the S6) is to cultivate a drought-resistant plant variety.
[0047] In order to solve the above technical problems, the application further provides a new use of a substance for inhibiting the ZmPHR1 protein.
[0048] The application provides an application of the substance for inhibiting the ZmPHR1 protein in any one of the following T1) to T6):
[0049] T1) reducing the drought resistance of the plant;
[0050] T2) increasing the transpiration rate and / or the stomatal conductance of the plant leaf;
[0051] T3) increasing the stomatal aperture of the plant leaf;
[0052] T4) promoting the stomatal movement of the plant leaf;
[0053] T5) application in a transgenic plant with reduced drought resistance and / or increased transpiration rate and / or increased stomatal conductance and / or increased stomatal aperture;
[0054] T6) genetic breeding of the plant or improvement of the plant germplasm resource.
[0055] The purpose of the genetic breeding of the plant or the improvement of the plant germplasm resource in the T6) is to cultivate a transgenic plant with reduced drought resistance and / or increased transpiration rate and / or increased stomatal conductance and / or increased stomatal aperture.
[0056] Further, the substance for inhibiting the ZmPHR1 protein can be a substance for inhibiting the activity of the ZmPHR1 protein, a substance for inhibiting the expression of a gene encoding the ZmPHR1 protein, or a substance for knocking out a gene encoding the ZmPHR1 protein.
[0057] The substance inhibiting the activity of ZmPHR1 protein can be any substance capable of making the ZmPHR1 protein in the plant lose activity, such as a protein, a polypeptide or a small molecule compound (such as a protein activity inhibitor) inhibiting the synthesis of ZmPHR1 protein or promoting the degradation of ZmPHR1 protein or inhibiting the function of ZmPHR1 protein.
[0058] The substance inhibiting the expression of the gene encoding ZmPHR1 protein can be any substance capable of making the gene encoding ZmPHR1 protein in the plant unable to express, such as a substance (such as miRNA, siRNA, dsRNA, shRNA, etc.) silencing the gene encoding ZmPHR1 protein in the plant.
[0059] The substance knocking out the gene encoding ZmPHR1 protein can be any substance achieving that the host cell does not produce a functional protein product of the ZmPHR1 gene in any way, such as removing all or part of the coding gene sequence, introducing a frameshift mutation so that no functional protein is produced, removing or changing the regulatory components (for example, promoter editing) so that the coding gene sequence is not transcribed, preventing translation by binding to mRNA, etc. Generally, the knockout is carried out at the genomic DNA level, so that the offspring of the cell also permanently carry the knockout. Further, the substance knocking out the gene encoding ZmPHR1 protein can be any substance capable of making the gene encoding ZmPHR1 protein in the plant mutate (the mutant form can be a deletion mutation and / or an insertion mutation and / or a base substitution) so as to lose activity, such as a zinc finger protein ZFN gene editing system or a TALENs gene editing system or a CRISPR / Cas9 gene editing system, etc.
[0060] Further, the substance knocking out the gene encoding ZmPHR1 protein is a vector knocking out the gene encoding ZmPHR1 protein.
[0061] In order to solve the above technical problems, the present application further provides a method for cultivating a transgenic plant with improved drought resistance and / or reduced transpiration rate and / or reduced stomatal conductance and / or reduced stomatal aperture.
[0062] The method for cultivating a transgenic plant with improved drought resistance and / or reduced transpiration rate and / or reduced stomatal conductance and / or reduced stomatal aperture provided by the present application comprises the following steps: increasing the content and / or activity of ZmPHR1 protein in a recipient plant to obtain a transgenic plant; the drought resistance of the transgenic plant is higher than that of the recipient plant, and the transpiration rate and / or stomatal conductance and / or stomatal aperture is lower than that of the recipient plant.
[0063] Further, the method for increasing the content and / or activity of ZmPHR1 protein in the recipient plant is overexpressing ZmPHR1 protein in the recipient plant.
[0064] The drought resistance of the transgenic plant is higher than that of the receptor plant, which is embodied in any one of the following X1) to X4):
[0065] X1) The growth of the transgenic plant is better than that of the receptor plant under drought conditions;
[0066] X2) The wilting degree of the leaves of the transgenic plant is lower than that of the receptor plant under drought conditions;
[0067] X3) The water content of the leaves of the transgenic plant is higher than that of the receptor plant under drought conditions;
[0068] X4) The survival rate of the transgenic plant is higher than that of the receptor plant under drought conditions.
[0069] Further, the overexpression method is to introduce the coding gene of the ZmPHR1 protein into the receptor plant.
[0070] To solve the above technical problems, the present application finally provides a method for cultivating a transgenic plant with reduced drought resistance and / or increased transpiration rate and / or increased stomatal conductance and / or increased stomatal aperture.
[0071] The method for cultivating a transgenic plant with reduced drought resistance and / or increased transpiration rate and / or increased stomatal conductance and / or increased stomatal aperture provided by the present application comprises the following steps: reducing the content and / or activity of the ZmPHR1 protein in the receptor plant to obtain a transgenic plant; the drought resistance of the transgenic plant is lower than that of the receptor plant, and the transpiration rate and / or stomatal conductance and / or stomatal aperture is higher than that of the receptor plant.
[0072] Further, the method for reducing the content and / or activity of the ZmPHR1 protein in the receptor plant is to introduce the above-mentioned substance for inhibiting the activity of the ZmPHR1 protein or the substance for inhibiting the expression of the gene coding the ZmPHR1 protein or the substance for knocking out the gene coding the ZmPHR1 protein into the receptor plant.
[0073] Further, the substance for knocking out the gene coding the ZmPHR1 protein is a vector for knocking out the gene coding the ZmPHR1 protein.
[0074] In any of the above-mentioned applications or methods, the transgenic plant is understood to not only include the first generation transgenic plant obtained by transforming the ZmPHR1 gene into the receptor plant, but also its offspring. For the transgenic plant, the gene can be propagated in the species, and the gene can also be transferred into other varieties of the same species by conventional breeding techniques, especially including commercial varieties. The transgenic plant includes seeds, callus, whole plants and cells.
[0075] In any of the above described uses or methods, the plant can be a dicot or a monocot, including but not limited to corn, rice, wheat, cotton, or soybean. Preferably, the monocot is a grass. More preferably, the grass is corn.
[0076] The present application finds that, in normal watering, the growth of the ZmPHR1 overexpression corn line is similar to that of the wild type, and there is no significant difference, and under drought conditions, the growth of the ZmPHR1 overexpression corn line is significantly better than that of the wild type, the leaf water content is significantly higher than that of the wild type (increased by 38%-62%), and the leaf wilting degree, transpiration rate (reduced by 28.57%), stomatal conductance (reduced by 32.21%) and stomatal aperture (reduced by 15.87%) are all significantly reduced, especially in the presence of ABA, the stomatal aperture of the ZmPHR1 overexpression corn line is reduced by 42.42% compared with the wild type corn plant, and the transpiration rate, stomatal conductance and stomatal aperture of the zmphr1 mutant are all significantly higher than those of the wild type. It is shown that the ZmPHR1 protein can positively regulate the drought resistance of plants, can regulate the resistance of corn to drought stress through the ABA signal pathway, can effectively reduce the water loss of plants and improve the drought resistance of plants by increasing the expression amount of the ZmPHR1 gene. The cultivation method of the drought-resistant plant provided by the present application has the advantages of short breeding time, strong purpose, etc. compared with the traditional breeding method, significantly shortens the breeding period and improves the breeding efficiency. The discovery of the drought resistance function of ZmPHR1 not only provides a new gene target and resource for breeding new varieties of drought-resistant plants, but also provides a theoretical basis for elucidating the molecular mechanism of plant drought stress signal response BRIEF DESCRIPTION OF DRAWINGS
[0077] Figure 1 For the detection of the expression amount of the ZmPHR1 gene in the ZmPHR1 overexpression line in Example 2 of the present application (a) and the mutation position and mutation sequence of the ZmPHR1 knockout mutants zmphr1-1 and zmphr1-2 (b); wherein WT represents a wild type corn plant, OE1, OE2 and OE3 represent ZmPHR1 overexpression lines, and zmphr1-1 and zmphr1-2 represent CRISPR / Cas9 method gene editing knockout mutants of ZmPHR1.
[0078] Figure 2 For the plant growth of the ZmPHR1 overexpression corn line in Example 3 of the present application after normal watering and drought treatment; wherein WT represents a wild type corn plant, and the ZmPHR1 overexpression lines are OE1, OE2 and OE3, respectively.
[0079] Figure 3The results of the determination of the leaf water content of the ZmPHR1 overexpression corn lines in Example 3 of the present application; wherein WT represents a wild type corn plant, and the ZmPHR1 overexpression lines are OE1, OE2 and OE3, respectively. The statistical analysis uses the ANOV analysis method, and the capital letter indicates P < 0.01.
[0080] Figure 4 The plant growth of the ZmPHR1 overexpression corn lines in Example 3 of the present application after normal watering and drought treatment and then recovery watering; wherein WT represents a wild type corn plant, and the ZmPHR1 overexpression lines are OE1, OE2 and OE3, respectively.
[0081] Figure 5 The results of the determination of the transpiration rate and stomatal conductance of the ZmPHR1 overexpression corn lines in Example 4 of the present application; wherein (a) is the transpiration rate, and (b) is the stomatal conductance; WT represents a wild type corn plant, ZmPHR1-OE1 and ZmPHR1-OE2 represent the ZmPHR1 gene overexpression corn lines, and zmphr1-1 and zmphr1-2 represent the CRISPR / Cas9 method gene editing knockout mutants of ZmPHR1. The statistical analysis uses the ANOV analysis method, and the capital letter indicates P < 0.01.
[0082] Figure 6 The phenotype and determination results of the stomatal density and stomatal aperture of the ZmPHR1 overexpression corn lines in Example 5 of the present application; wherein (a) is the stomatal density, (b) is the corn stomatal aperture photo, and (c) is the stomatal aperture; WT represents a wild type corn plant, ZmPHR1-OE1 and ZmPHR1-OE2 represent the ZmPHR1 gene overexpression corn lines, and zmphr1-1 and zmphr1-2 represent the CRISPR / Cas9 method gene editing knockout mutants of ZmPHR1. The statistical analysis uses the ANOV analysis method, and the lower case letter indicates P < 0.05, and the capital letter indicates P < 0.01. DETAILED DESCRIPTION
[0083] The present application will be further described in conjunction with the specific embodiments. The embodiments given herein are only to illustrate the present application, and are not intended to limit the scope of the present application. The embodiments provided below can serve as a guide for further improvement by those of ordinary skill in the art, and do not constitute any limitation on the present application in any way.
[0084] The experimental methods in the following examples are all conventional methods, and are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents and the like used in the following examples can be obtained from commercial channels, unless otherwise specified.
[0085] The maize inbred line B73 involved in the following examples is described in the literature “Wei et al. The Physical and Genetic Framework of the Maize B73 Genome. PLoS Genetics 2009, 5: e1000715.” (in the literature named Maize B73).
[0086] The pBCXUN vector in the following examples is a vector obtained by replacing the hygromycin resistance gene hptII (corresponding to positions 9925-10950 of the sequence shown in GenBank FJ905215.1, 06-JUL-2009) in the commercialized vector pCXUN (the nucleotide sequence of the vector is shown in the sequence of GenBank FJ905215.1, 06-JUL-2009) with the herbicide resistance gene bar (encoding phosphinothricin acetyltransferase, the nucleotide sequence of the gene is shown in the sequence of GenBank AYD60114.1, 02-OCT-2018). The pBCXUN vector contains the maize ubiquitin gene Ubi promoter, which can be used to drive the transcription of the downstream overexpression gene.
[0087] The Agrobacterium strain EHA105 involved in the following examples is described in the literature “Nyaboga et al. Agrobacterium-mediated genetic transformation of yam (Dioscorea rotundata): an important tool for functional study of genes and crop improvement. Frontiers in Plant Science 2014, 5: 463.”.
[0088] The main reagents involved in the following examples and their sources are as follows: restriction enzymes, DNA polymerase, T4 ligase from biological companies such as NEB, Toyobo, etc.; reverse transcription kit from Thermo; RNA extraction kit from Magen; quantitative PCR reagent from Taraka; plasmid extraction kit and DNA recovery kit from Tian Gen; MS medium, agar powder, agarose, ampicillin, kanamycin, gentamicine sulfate, rifampicin from sigma; various other chemical reagents are imported or domestic analytical pure reagents.
[0089] The primer synthesis and sequencing involved in the following examples are completed by Yingjun Company.
[0090] Pore conductance in the following examples refers to the ability of a gas (including water vapor) to diffuse through the pores, which can be represented by measuring the size of the pore diameter or measuring the rate of water vapor gas loss.
[0091] Pore opening in the following examples refers to the size of the pore diameter, and the pore opening can affect the pore conductance. The larger the pore opening, the greater the pore conductance.
[0092] Pore movement in the following examples refers to the opening or closing of the pores, and the opening and closing of the pores directly affect the pore conductance.
[0093] Example 1, Construction and Detection of ZmPHR1 Gene Overexpression Vector and CRISPR-Cas9 Knockout Vector
[0094] I. Construction of ZmPHR1 Gene Overexpression Vector
[0095] First, total RNA was extracted from corn (Zea mays L.), and cDNA was obtained by reverse transcription. Then, using cDNA as a template and F and R as primers (primers with enzyme digestion sites), the ZmPHR1 gene was amplified. Finally, the amplified product was digested and connected to the overexpression vector to obtain the ZmPHR1 gene overexpression vector. The specific construction method is as follows:
[0096] 1. Total RNA was extracted from corn inbred line B73 using the RNA extraction kit of Magen Company, and the specific steps were referred to the kit instructions.
[0097] 2. The RNA was reverse transcribed into cDNA using the reverse transcription kit of Thermo Company, and the specific steps were referred to the kit instructions.
[0098] 3. Using cDNA as a template and F and R as primers for PCR amplification, the PCR amplification product (ZmPHR1 gene cDNA) was obtained, and the PCR amplification product was run electrophoresis and gel recovery, and the recovery method was referred to the kit of Tiangen Company. The PCR amplification product was end-repaired with Taq enzyme and A to obtain a PCR amplification product with A sticky ends.
[0099] The primer sequences used for ZmPHR1 gene amplification are as follows:
[0100] F: tataagcttATGAGGAACTTTAATCTGATGCAGT;
[0101] R: gctctagaTTAACTATCTTGCAGTTTGCGC.
[0102] 4. Linearize the vector pBCXUN by restriction enzyme XcmI (NEB) digestion. The linearized vector pBCXUN has T sticky ends.
[0103] 5. Ligate the PCR product with A sticky ends and the linearized vector pBCXUN by TA cloning method. Transform 5 μL reaction system into E. coli competent cells. Screen on LB plates containing 50 μg / mL kanamycin. Identify single clones by colony PCR and select positive clones for sequencing. The obtained recombinant expression vector with correct sequencing is named as pBCXUN-ZmPHR1. The colony PCR and sequencing universal primers are as follows:
[0104] UbiP-seq: ATGAGGAACTTTAATCTGATGCAGT;
[0105] NosR-seq: TTAACTATCTTGCAGTTTGCGC.
[0106] II. Construction of ZmPHR1 gene CRISPR-Cas9 knockout vector
[0107] 1. Design of gRNA target sequence
[0108] Based on the CDS sequence of ZmPHR1, design guide RNA (gRNAs) using CRISPR-P. The final designed gRNA target sequence is as follows: CCAGAGTATACGTCCTGCTATG.
[0109] 2. Preparation of ZmPHR1 gene CRISPR-Cas9 knockout vector
[0110] Replace the gRNA target sequence of pCAMBIA3300-derived CRISPR / Cas9 binary vector pBUE411 in Additional file 2: Methods S1 of the literature “Xing et al. A CRISPR / Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. 2014, 14: 327.” with the gRNA target sequence in step 1, and obtain the ZmPHR1 gene CRISPR-Cas9 knockout vector CRISPR-ZmPHR1 by sequencing verification.
[0111] Example 2, Construction and detection of ZmPHR1 gene overexpression strain and mutant strain
[0112] I. Construction of transgenic plants
[0113] The pBCXUN-ZmPHR1 and CRISPR-ZmPHR1 plasmids constructed in Example 1 were transformed into competent Agrobacterium EHA105, respectively, and positive clones were identified by colony PCR. The correct Agrobacterium single colonies were inoculated into 2 mL liquid medium containing 100 μg / mL kanamycin and 50 μg / mL rifampicin, and cultured at 28°C overnight. The next day, the culture was transferred into a large amount of liquid medium containing antibiotics and shaken, and the bacteria were collected when they grew to the logarithmic phase, resuspended to OD 600 The recombinant Agrobacterium suspension was between 0.8 and 1.0. The corn young embryos of B73 were peeled off under sterile conditions, infected with the recombinant Agrobacterium suspension, and induced to form corn embryo callus and seedlings. The seeds were harvested by self-crossing to obtain T1 generation transgenic plants. After the transgenic plants were self-crossed, T3 generation transgenic plants were obtained for subsequent experiments.
[0114] II. Obtaining ZmPHR1 gene overexpression lines and mutant lines
[0115] 1. Construction of ZmPHR1 gene overexpression lines
[0116] RNA was extracted from the 3 transgenic self-crossing lines (ZmPHR1-OE1, ZmPHR1-OE2 and ZmPHR1-OE3) transformed with the pBCXUN-ZmPHR1 plasmid and the wild-type corn self-crossing line B73, and cDNA was reverse transcribed for quantitative PCR detection of ZmPHR1 gene expression.
[0117] The detection results are shown in Figure 1 (a), which shows that the 3 lines (ZmPHR1-OE1, ZmPHR1-OE2 and ZmPHR1-OE3) are all overexpression lines of the ZmPHR1 gene, and the expression amount of the ZmPHR1 gene in the transgenic plants is about 10-19 times that of the wild-type control plants without transgenics, which is much higher than that of the control plants without transgenics.
[0118] 2. Construction of mutant lines
[0119] DNA was extracted from the 2 mutant self-crossing lines (zmphr1-1 and zmphr1-2) transformed with the CRISPR-ZmPHR1 plasmid and the wild-type corn self-crossing line B73, and PCR amplification and sequencing were performed at the target site.
[0120] The sequencing results are shown in Figure 1 (b), which shows that the 2 mutant lines are both corn mutants in which the ZmPHR1 gene has undergone homozygous mutation (the same mutation has occurred on both chromosomes).
[0121] The difference between the zmphr1-1 mutant strain and the wild-type maize inbred line B73 genome sequence is only that 8 bases CAGAGTAT from 445 to 452 in the gene (sequence 2) encoding the ZmPHR1 protein are deleted. The difference between the zmphr1-2 mutant strain and the wild-type maize inbred line B73 genome sequence is only that a base G is inserted between 449 and 450 in the gene (sequence 2) encoding the ZmPHR1 protein. The mutant forms of the two mutants both cause a frameshift mutation in the mRNA of ZmPHR1 during translation, resulting in loss of protein function.
[0122] Example 3, Detection of drought phenotype of ZmPHR1 gene overexpression maize lines
[0123] A drought treatment experiment was performed on the T3 generation ZmPHR1 gene overexpression maize lines (ZmPHR1-OE1, ZmPHR1-OE2 and ZmPHR1-OE3) constructed in Example 2 and the wild-type maize inbred line B73, according to the following method:
[0124] 1. Seed disinfection and plant growth: The maize seeds of different test materials were disinfected with 75% ethanol for 3 minutes, and then rinsed with pure water to remove residual alcohol. The embryos of the seeds were then placed on a culture dish with forceps, and a layer of absorbent paper was placed on top, sprayed with an appropriate amount of water to keep the absorbent paper moist, and placed in a maize greenhouse for 2-3 days of dark culture. When the radicles grew to about 1 cm, the seeds that had germinated and grown consistently were selected and moved to small pots (10 cm in diameter and 10 cm deep) containing about 150 g of substrate (sifted flower soil, imported nutrient soil and vermiculite mixed in a ratio of 1:1:1 as the substrate for maize culture). Each pot contained 4 seeds, and a tray was placed at the bottom of each pot to allow the substrate to absorb water. The pots were then placed in a greenhouse under light conditions for further culture. The greenhouse culture conditions were as follows: 27±1°C, light cycle of 16 hours light / 8 hours darkness, and air humidity of about 40%.
[0125] 2. Soil drought treatment: when the seedlings grow to the two-leaf stage, 3 seedlings with the same growth state are selected, 1 L water is added to the tray, and after 8 hours, the water in the tray is poured out to start the drought treatment (continue to cultivate in the 27°C greenhouse, and no water is given during the cultivation process), and normal watering (the normal watering treatment method is as follows: every 3-4 days, 1 L water is added to the tray for potting, and after 8 hours, the water is poured out) is used as a control to observe the growth and leaf wilting degree of different test materials under drought treatment. After about one week of drought treatment, the leaf water content of different test materials is measured. The survival rate experiment is carried out on the 12th day of the treatment, the substrate is soaked with water from the bottom, and then placed in the greenhouse for normal cultivation. After 4-5 days, take photos to count the survival rate. Different test materials are planted in 3-6 pots as biological replicates, and are randomly placed. The position of the pots is adjusted at regular intervals every day to reduce the influence of position effect.
[0126] The above-mentioned leaf relative water content determination method is as follows: the leaves of the materials with phenotypic differences are taken at the same leaf position, cut into appropriate size with scissors, weighed and recorded as w1. The leaves are soaked in distilled water overnight (at least 12 hours) until the leaves are saturated and fully expanded. The surface water of the leaves is wiped off, weighed and recorded as the saturated weight w2. The leaves are placed in an 80°C oven to dry to constant weight, weighed and recorded as the dry weight w3. The relative water content (RWC) is calculated according to the following formula: RWC = (w1-w3) / (w2-w3) x 100%.
[0127] The results show that after one week of drought treatment, the growth of the ZmPHR1 overexpression lines (OE1-OE3) is significantly better than that of the wild type corn plants, and the leaf wilting degree is significantly lower than that of the wild type corn plants Figure 2 ). The leaf water content of the ZmPHR1 overexpression lines (OE1-OE3) is significantly higher than that of the wild type corn plants, and the leaf water content of the ZmPHR1 overexpression lines is increased by 38%-62% compared with that of the wild type corn plants Figure 3 ). After two weeks of drought treatment, the wild type corn plants are basically dead, and the ZmPHR1 overexpression lines basically survive and maintain good growth Figure 4 ). The above results show that the transgenic corn plants overexpressing ZmPHR1 are more drought-resistant than the wild type corn plants.
[0128] Example 4, Measurement of Transpiration Rate and Stomatal Conductance of ZmPHR1 Gene Overexpression Corn Lines
[0129] The transpiration rate and stomatal conductance of the T3 generation of the ZmPHR1 gene overexpression corn lines (ZmPHR1-OE1, ZmPHR1-OE2 and ZmPHR1-OE3) constructed in Example 2, the zmphr1 mutants (zmphr1-1 and zmphr1-2) and the wild-type corn inbred line B73 were determined by the following method:
[0130] Different test materials were respectively planted in the field to grow to the tasseling stage, and the transpiration rate and stomatal conductance were determined at 9:00-11:00 am when the sunlight was directly incident on a sunny and cloudless day, and the PAR was controlled at 1500 μE·m -2 ·s -1 The wild-type corn, the ZmPHR1 gene overexpression corn lines (OE1-OE3) and the zmphr1 mutants (zmphr1-1 and zmphr1-2) with consistent growth vigor were selected, and the determination was performed at the middle position of the ear leaves to avoid the marginal effect on the results. The transpiration rate and stomatal conductance were measured by a Yaxin-1102 portable photosynthesis and transpiration instrument, and the use method was referred to the product instruction.
[0131] The results are shown in Table 2. Figure 5 The results show that compared with the wild-type corn plants, the leaf transpiration rate and stomatal conductance of the ZmPHR1 overexpression lines are reduced by 28.57% and 32.21% respectively, and it can be seen that the transpiration rate and stomatal conductance of the ZmPHR1 overexpression corn plants are significantly lower than those of the wild-type control, which indicates that the transpiration loss of the ZmPHR1 overexpression corn plants is significantly slower than that of the wild-type control, which may be one of the reasons for the drought resistance of the ZmPHR1 overexpression plants.
[0132] Example 5, Measurement of Stomatal Density and Stomatal Aperture of ZmPHR1 Gene Overexpression Corn Lines
[0133] The results of Example 4 show that the transpiration loss of the ZmPHR1 overexpression lines is significantly slower than that of the wild-type control, and the stomatal transpiration is the main way of leaf transpiration. Among them, the ABA-regulated stomatal movement is an important way for plants to respond to drought stress. Therefore, the stomatal density and stomatal aperture of the T3 generation of the ZmPHR1 gene overexpression corn lines (ZmPHR1-OE1, ZmPHR1-OE2 and ZmPHR1-OE3) constructed in Example 2, the zmphr1 mutants (zmphr1-1 and zmphr1-2) and the wild-type corn inbred line B73 were determined by the following method:
[0134] 1. Corn Plant Growth: Each test material was grown in a greenhouse to the V1 stage. Fully expanded, mature leaves (with fully developed stomata) were selected for stomatal density and aperture experiments. Greenhouse culture conditions were: 27 ± 1°C, a photoperiod of 16 h light / 8 h dark, and an air humidity of approximately 40%.
[0135] 2. Determination of maize stomatal density and stomatal aperture: After 2 hours of greenhouse illumination, maize V1 leaves were taken, the leaf tips and leaf bases were removed, and the middle portion of the leaf (about 1 cm in length) was left. The leaves were placed in a stomatal buffer solution (stomatal buffer solution formula: 10 mM KCl, 50 μM CaCl2, 10 mM MES, pH 5.6) with the upper epidermis of the leaves facing upwards and incubated under light for 2 hours (temperature 25°C, light intensity 120 μmol·m -2 ·s -1 ) to fully open the stomata. The cultured leaves were divided into two groups: one (experimental group) was transferred to a stomatal buffer solution containing 10 μM ABA (stomatal buffer formula: 10 mM KCl, 50 μM CaCl2, 10 mM MES, 10 μM ABA, pH 5.6), while the other (control group) was transferred to a stomatal buffer solution containing 0 μM ABA (stomatal buffer formula: 10 mM KCl, 50 μM CaCl2, 10 mM MES, pH 5.6). After a further 2 hours of incubation, the leaves were removed and the epidermis was quickly removed for preparation. Stomatal density and pore size were observed under a color CCD optical microscope. At least four replicates were set up for each treatment, and 12-15 randomly selected fields of view were photographed in each replicate. Stomatal aperture was measured using ImageJ software, and stomatal density and pore size were statistically analyzed.
[0136] The results of pore density determination are as follows Figure 6 As shown in (a), the results showed that the stomatal density of ZmPHR1 overexpression lines (OE1-OE3) and zmphr1 mutants (zmphr1-1 and zmphr1-2) was not significantly different from that of wild-type maize plants ( Figure 6 a), indicating that ZmPHR1 does not regulate the stomatal development of maize; the results of stomatal aperture determination are as follows Figure 6(b)-(c) showed that the stomatal aperture of ZmPHR1 overexpression lines (OE1-OE3) was significantly smaller than that of wild type maize plants (decreased by 15.87%) in the control treatment without ABA, and the stomatal aperture of ZmPHR1 overexpression lines (OE1-OE3) was further reduced in 10 μM ABA treatment, and the stomatal aperture of ZmPHR1 overexpression lines was decreased by 42.42% compared with wild type; the stomatal aperture of zmphr1 mutants (zmphr1-1 and zmphr1-2) had no significant difference with wild type maize plants in the control treatment without ABA, and the stomatal aperture of zmphr1 mutants (zmphr1-1 and zmphr1-2) was significantly larger than that of wild type maize plants in 10 μM ABA treatment. The above results showed that ZmPHR1 could regulate the stomatal movement of plant leaves, especially the ABA-dependent stomatal movement, which might be one of the important ways for ZmPHR1 overexpression plants to enhance drought resistance by reducing transpiration water loss.
[0137] The above has been described in detail. For those skilled in the art, without departing from the purpose and scope of the present application, and without unnecessary experiments, the present application can be implemented in a wider range under the same parameters, concentrations and conditions. Although the present application gives a special example, it should be understood that the present application can be further improved. In general, according to the principle of the present application, the present application is intended to include any change, use or improvement of the present application, including changes made by conventional techniques known in the art, which deviates from the scope disclosed in the present application. Some basic features can be applied within the scope of the following attached claims.
Claims
1. Use of ZmPHR1 protein in any of the following S1)-S5): S1) Improve plant drought resistance; S2) reduce the transpiration rate and / or stomatal conductance of plant leaves; S3) Reduce the stomatal aperture of plant leaves; S4) inhibits stomatal movement in plant leaves; S5) Application in breeding transgenic plants with improved drought resistance and / or reduced transpiration rate and / or reduced stomatal conductance and / or reduced stomatal aperture; The ZmPHR1 protein is a1) or a2): a1) The amino acid sequence is the protein shown in SEQ ID NO: 3; a2) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO: 3; The plant is corn.
2. Use of biomaterials related to the ZmPHR1 protein in any of the following S1)-S5): S1) Improve plant drought resistance; S2) reduce the transpiration rate and / or stomatal conductance of plant leaves; S3) Reduce the stomatal aperture of plant leaves; S4) inhibits stomatal movement in plant leaves; S5) Application in breeding transgenic plants with improved drought resistance and / or reduced transpiration rate and / or reduced stomatal conductance and / or reduced stomatal aperture; The biological material is any one of the following A1) to A8): A1) Nucleic acid molecule encoding ZmPHR1 protein; A2) an expression cassette containing the nucleic acid molecule described in A1); A3) a recombinant vector containing the nucleic acid molecule described in A1); A4) a recombinant vector containing the expression cassette described in A2); A5) a recombinant microorganism containing the nucleic acid molecule described in A1); A6) a recombinant microorganism containing the expression cassette described in A2); A7) a recombinant microorganism containing the recombinant vector described in A3); A8) a recombinant microorganism containing the recombinant vector described in A4); The ZmPHR1 protein is a1) or a2): a1) The amino acid sequence is the protein shown in SEQ ID NO: 3; a2) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO: 3; The plant is corn.
3. The use according to claim 2, characterized in that: A1) The nucleic acid molecule is the gene shown in B1) or B2) or B3) below: B1) DNA molecule shown in Sequence 1; B2) DNA molecule shown in sequence 2; B3) A DNA molecule that has 75% or more identity with the nucleotide sequence defined in B1) or B2) and encodes the ZmPHR1 protein of claim 2.
4. A method for cultivating a transgenic plant having improved drought resistance and / or reduced transpiration rate and / or reduced stomatal conductance and / or reduced stomatal aperture, comprising the following steps: increasing the content and / or activity of a ZmPHR1 protein in a recipient plant to obtain a transgenic plant; wherein the transgenic plant has higher drought resistance than the recipient plant, and the transpiration rate and / or stomatal conductance and / or stomatal aperture of the transgenic plant is lower than that of the recipient plant; The ZmPHR1 protein is a1) or a2): a1) The amino acid sequence is the protein shown in SEQ ID NO: 3; a2) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO: 3; The plant is corn.
5. The method according to claim 4, characterized in that: The method for increasing the content and / or activity of the ZmPHR1 protein in the recipient plant is to overexpress the ZmPHR1 protein in the recipient plant.
6. The method according to claim 5, characterized in that: The overexpression method is to introduce the coding gene of the ZmPHR1 protein into the recipient plant.