Application of OsWRKY76 protein in improvement of phosphorus utilization efficiency and rice yield

Abstract

The invention discloses application of OsWRKY76 protein to improvement of the utilization efficiency of phosphorus and the yield of rice. The amino acid sequence of the OsWRKY76 protein is as shown in SEQ ID NO: 3. Experiments prove that the utilization efficiency of phosphorus can be improved by improving the expression quantity of the protein OsWRKY76 in the Haihi white hair of the rice variety, so that the growth of rice leaves is promoted, the fresh weight of overground parts is improved, and the yield of a single plant is finally improved. Therefore, the protein OsWRKY76 can regulate and control the utilization efficiency of phosphorus, the length of rice leaves, the biomass of the overground part and the yield of a single plant. The method has important application value.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to application of OsWRKY76 protein in improving phosphorus utilization efficiency and rice yield. Background Art

[0002] Phosphorus (P) is one of the macronutrients that limit plant growth and yield. Phosphorus not only constitutes important macromolecules in cells, including DNA, RNA, ATP and phospholipids, but also participates in regulating important physiological and biochemical processes such as signal transduction, energy metabolism and photosynthesis (Steffen Abel, Phosphate sensing in root development, Current Opinion in Plant Biology, 14: 303-309, 2011).

[0003] In recent years, inorganic phosphate starvation stress has been shown to inhibit cell proliferation in rice leaves. Phosphate starvation-induced OsCYCP4s overexpression can compete with other cell cycle proteins and bind to cyclin-dependent kinases, thereby inhibiting growth by reducing cell proliferation (Xu L, Wang F, Li R, Deng M, Fu M, Teng H, Yi K. OsCYCP4 scoordinates phosphate starvation signaling with cell cycle progression in rice. J Integr Plant Biol. 2020 Jul; 62(7): 1017-1033.). NIGT1 inhibits the growth of the aboveground part by inhibiting the expression of growth-related regulatory genes, including the main regulatory gene BZR1 of brassinolide signal transduction, the cell division regulatory gene CYCB1;1 and the DNA replication regulatory gene PSF3 (Zhang Y, Zhang Q, Guo M, Wang X, Li T, Wu Q, Li L, Yi K, Ruan W. NIGT1 represses plant growth and mitigates phosphate starvation signaling to balance the growth response tradeoff in rice. J Integr Plant Biol. 2023Aug; 65(8): 1874-1889). OsMYB110 is a pi-dependent negative regulator, a direct target of OsPHR2, and regulates OsPHR2-mediated suppression of rice plant height, lodging resistance, and grain yield (Wang T, Jin Y, Deng L, Li F, Wang Z, Zhu Y, Wu Y, Qu H, Zhang S, Liu Y, Mei H, Luo L, Yan M, Gu M, Xu G. The transcription factor MYB110 regulates plant height, lodging resistance, and grain yield in rice. Plant Cell. 2024 Jan 30; 36(2): 298-323.). Although so many genes are involved in the regulation of rice leaf size, little is known about their related interactions, so further in-depth research is needed on the genetic network of rice leaf growth regulation.

[0004] Despite the complex mechanisms of phosphate uptake, storage, and assimilation, temporal and spatial fluctuations in phosphate concentrations require farmers to supply phosphorus fertilizers to the soil to ensure optimal crop yields. Therefore, understanding the mechanisms by which phosphorus starvation inhibits the growth of aerial parts of plants is important for breeding crops with efficient phosphorus utilization. Summary of the invention

[0005] The object of the present invention is to improve the utilization efficiency and / or yield of plant phosphorus.

[0006] The present invention firstly protects the application of protein OsWRKY76, which can be at least one of S1)-S8):

[0007] S1) regulates plant leaf length;

[0008] S2) regulating the aboveground biomass of plants;

[0009] S3) regulates plant phosphorus utilization efficiency;

[0010] S4) regulating plant yield;

[0011] S5) cultivating transgenic plants with altered leaf length;

[0012] S6) cultivating transgenic plants with altered aboveground biomass;

[0013] S7) cultivating transgenic plants with altered phosphorus utilization efficiency;

[0014] S8) cultivating transgenic plants with altered yield;

[0015] In the above application, the protein OsWRKY76 can be a1) or a2) or a3):

[0016] a1) the amino acid sequence is the protein shown in SEQ ID NO: 3;

[0017] a2) a fusion protein obtained by connecting a tag to the N-terminus or / and the C-terminus of the protein shown in SEQ ID NO: 3;

[0018] a3) A protein related to plant leaf length and / or aboveground biomass obtained by replacing and / or deleting and / or adding one or more amino acid residues of the protein shown in a1) or a2).

[0019] Among them, SEQ ID NO: 3 consists of 327 amino acid residues.

[0020] In order to facilitate purification of the protein in a1), a tag as shown in Table 1 may be connected to the amino terminus or carboxyl terminus of the protein shown in SEQ ID NO: 3.

[0021] Table 1. Sequences of tags

[0022] Label Residue sequence Poly-Arg 5-6 (usually 5) RRRRR FLAG 8 DYKDDDDK Strep-tagII 8 WSHQ c-myc 10 EQKLISEEDL

[0023] In the protein described in a3) above, the substitution and / or deletion and / or addition of one or several amino acid residues is a substitution and / or deletion and / or addition of no more than 10 amino acid residues.

[0024] The protein in a3) above can be artificially synthesized, or its encoding gene can be synthesized first and then expressed biologically.

[0025] The coding gene of the protein in a3) above can be obtained by deleting one or several codons of amino acid residues in the DNA sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2, and / or performing missense mutation of one or several base pairs, and / or connecting the coding sequence of the tag shown in Table 1 to its 5′ end and / or 3′ end.

[0026] The present invention also protects the use of a nucleic acid molecule encoding any of the above-mentioned proteins OsWRKY76, which may be at least one of S1)-S8):

[0027] S1) regulates plant leaf length;

[0028] S2) regulating the aboveground biomass of plants;

[0029] S3) regulates plant phosphorus utilization efficiency;

[0030] S4) regulating plant yield;

[0031] S5) cultivating transgenic plants with altered leaf length;

[0032] S6) cultivating transgenic plants with altered aboveground biomass;

[0033] S7) cultivating transgenic plants with altered phosphorus utilization efficiency;

[0034] S8) cultivating transgenic plants with altered yield;

[0035] In the above application, the nucleic acid molecule encoding the protein OsWRKY76 may be a DNA molecule as shown in b1) or b2) or b3) or b4) below:

[0036] b1) the coding region is the DNA molecule shown in SEQ ID NO: 2;

[0037] b2) the nucleotide sequence is a DNA molecule shown in SEQ ID NO: 2 or SEQ ID NO: 1;

[0038] b3) a DNA molecule having 75% or more identity with the nucleotide sequence defined in b1) or (b2) and encoding the protein OsWRKY76;

[0039] b4) A DNA molecule which hybridizes with the nucleotide sequence defined in b1) or b2) under stringent conditions and encodes the protein OsWRKY76.

[0040] The nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA.

[0041] Among them, SEQ ID NO: 1 consists of 1782 nucleotides, SEQ ID NO: 2 consists of 984 nucleotides, and the nucleotides shown in SEQ ID NO: 1 or SEQ ID NO: 2 encode the amino acid sequence shown in SEQ ID NO: 3.

[0042] Those skilled in the art can easily mutate the nucleotide sequence encoding the protein OsWRKY76 of the present invention by using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides having 75% or higher identity with the nucleotide sequence of the protein OsWRKY76 isolated from the present invention are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the protein OsWRKY76.

[0043] The term "identity" as used herein refers to sequence similarity with a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or more, or 80% or more, or 85% or more, or 90% or more, or 95% or more identity with the nucleotide sequence of the present invention encoding the protein OsWRKY76 consisting of the amino acid sequence shown in SEQ ID NO: 1. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0044] In any of the above applications, regulating the length of plant leaves may be increasing the length of plant leaves or decreasing the length of plant leaves.

[0045] In any of the above-mentioned applications, the regulating the above-ground biomass of the plant may be increasing the above-ground biomass of the plant or decreasing the above-ground biomass of the plant.

[0046] In any of the above applications, regulating the utilization efficiency of plant phosphorus may be to increase the utilization efficiency of plant phosphorus or to reduce the utilization efficiency of plant phosphorus;

[0047] In any of the above applications, regulating plant yield may be increasing plant yield or decreasing plant yield.

[0048] The present invention also protects a method for cultivating transgenic plant A, which may include the following steps: increasing the expression level and / or activity of any of the above-mentioned proteins OsWRKY76 in a starting plant to obtain a transgenic plant A; compared with the starting plant, the transgenic plant A has improved phosphorus utilization efficiency, increased leaf length, increased aboveground biomass and / or increased yield.

[0049] In the above method, the "increasing the expression level and / or activity of any of the above proteins OsWRKY76 in the starting plant" can be achieved by methods well known in the art such as transgenic, multiple copies, changing promoters, regulatory factors, etc., to increase the expression level and / or activity of any of the above proteins OsWRKY76 in the starting plant.

[0050] In the above method, the "increasing the expression level and / or activity of any of the above proteins OsWRKY76 in the starting plant" can be specifically achieved by introducing a nucleic acid molecule encoding any of the above proteins OsWRKY76 into the starting plant.

[0051] In the above method, the "introducing a nucleic acid molecule encoding any of the above-mentioned proteins OsWRKY76 into the starting plant" can be achieved by introducing a recombinant vector into the starting plant; the recombinant vector can be a recombinant plasmid obtained by inserting a nucleic acid molecule encoding any of the above-mentioned proteins OsWRKY76 into an expression vector.

[0052] The recombinant vector can be specifically a recombinant plasmid pCAMBIA1300-P OsWRKY76 :GFP:OsWRKY76-rbcs. The recombinant plasmid pCAMBIA1300-P OsWRKY76 :GFP:OsWRKY76-rbcs can be a recombinant plasmid obtained by replacing a small DNA fragment between restriction endonucleases KpnI and BamHI of the pCAMBIA1300-rbcs vector with a target DNA fragment with a nucleotide sequence as shown in SEQ ID NO:5.

[0053] The transgenic plants may specifically be Co-6 and Co-15 mentioned in Example 2. In this case, the starting plant is rice, specifically the rice variety Ishikari Shirako.

[0054] The present invention also protects a method for cultivating transgenic plant B, which may include the following steps: reducing the expression level and / or activity of any of the above-mentioned proteins OsWRKY76 in the starting plant to obtain transgenic plant B; compared with the starting plant, the phosphorus utilization efficiency of transgenic plant B is reduced, the leaf length is reduced, the aboveground biomass is reduced and / or the yield is reduced.

[0055] In the above method, the reduction of the expression level and / or activity of any of the above proteins OsWRKY76 in the starting plant can be achieved by methods well known in the art such as DNA insertion, RNA interference, homologous recombination, and gene site editing to reduce the expression level and / or activity of any of the above proteins OsWRKY76 in the starting plant.

[0056] Specifically, reducing the expression level and / or activity of any of the above-mentioned proteins OsWRKY76 in the starting plant can be achieved by mutating the gene encoding any of the above-mentioned proteins OsWRKY76 in the starting plant.

[0057] The gene encoding any of the above-mentioned proteins OsWRKY76 may be a DNA molecule as shown in b1) or b2) or b3) or b4) below:

[0058] b1) the coding region is the DNA molecule shown in SEQ ID NO: 2;

[0059] b2) the nucleotide sequence is a DNA molecule shown in SEQ ID NO: 2 or SEQ ID NO: 1;

[0060] b3) a DNA molecule having 75% or more identity with the nucleotide sequence defined in b1) or (b2) and encoding the protein OsWRKY76;

[0061] b4) A DNA molecule which hybridizes with the nucleotide sequence defined in b1) or b2) under stringent conditions and encodes the protein OsWRKY76.

[0062] The nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA.

[0063] Among them, SEQ ID NO: 1 consists of 1782 nucleotides, SEQ ID NO: 2 consists of 984 nucleotides, and the nucleotides shown in SEQ ID NO: 1 or SEQ ID NO: 2 encode the amino acid sequence shown in SEQ ID NO: 3.

[0064] Those skilled in the art can easily mutate the nucleotide sequence encoding the protein OsWRKY76 of the present invention by using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides having 75% or higher identity with the nucleotide sequence of the protein OsWRKY76 isolated from the present invention are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the protein OsWRKY76.

[0065] The term "identity" as used herein refers to sequence similarity with a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or more, or 80% or more, or 85% or more, or 90% or more, or 95% or more identity with the nucleotide sequence of the present invention encoding the protein OsWRKY76 consisting of the amino acid sequence shown in SEQ ID NO: 1. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0066] In the above method, the coding gene of the protein OsWRKY76 in the mutant plant can be obtained by mutating the OsWRKY76 gene shown in SEQ ID No: 2 to OsWRKY76 / +1bp. The OsWRKY76 / +1bp is a DNA molecule obtained by inserting one nucleotide between the 17th and 18th positions from the 5' end of SEQ ID No: 2, while keeping the other nucleotide sequences of SEQ ID No: 2 unchanged. Preferably, the inserted one nucleotide can be nucleotide A or nucleotide T.

[0067] In the above method, the coding gene of the protein OsWRKY76 in the mutated starting plant is achieved by introducing the CRISPR / Cas9 system into the starting plant. The CRISPR / Cas9 system may include a recombinant expression vector; the recombinant expression vector contains a DNA molecule expressing a gRNA targeting the coding gene of the protein OsWRKY76.

[0068] In the above method, the target sequence of the gRNA may be as shown in SEQ ID No: 2, positions 1 to 20 from the 5' end.

[0069] The present invention also protects the use of a substance encoding a gene of any of the above-mentioned proteins OsWRKY76 in a mutant plant, which may be at least one of S1)-S8):

[0070] S1) regulates plant leaf length;

[0071] S2) regulating the aboveground biomass of plants;

[0072] S3) regulates plant phosphorus utilization efficiency;

[0073] S4) regulating plant yield;

[0074] S5) cultivating transgenic plants with altered leaf length;

[0075] S6) cultivating transgenic plants with altered aboveground biomass;

[0076] S7) cultivating transgenic plants with altered phosphorus utilization efficiency;

[0077] S8) Cultivating transgenic plants with altered yield.

[0078] In the above application, the gene encoding any of the above proteins OsWRKY76 in the mutant plant can be a gene of OsWRKY76 shown in SEQ ID No: 2 mutated to OsWRKY76 / +1bp. The OsWRKY76 / +1bp is a DNA molecule obtained by inserting one nucleotide between the 17th and 18th positions from the 5' end of SEQ ID No: 2, while keeping the other nucleotide sequences of SEQ ID No: 2 unchanged. Preferably, the inserted one nucleotide can be nucleotide A or nucleotide T.

[0079] In the above application, the substance of the gene encoding any of the above-mentioned proteins OsWRKY76 in the mutant plant can be a CRISPR / Cas9 system. The CRISPR / Cas9 system can include a recombinant expression vector; the recombinant expression vector contains a DNA molecule expressing a gRNA targeting the gene encoding any of the above-mentioned proteins OsWRKY76. Preferably, the target sequence of the gRNA can be shown in SEQ ID No: 2 from the 1st to the 20th position from the 5' end.

[0080] Any of the above leaves may be at least one of a mature rice plant leaf, a flag leaf, an L3 leaf, an L4 leaf, an L5 leaf and an L6 leaf.

[0081] The L3 leaf may be the third leaf counting from the bottom to the top of the plant root.

[0082] The L4 leaf may be the fourth leaf counting from the bottom to the top of the plant root.

[0083] The L5 leaf may be the fifth leaf counting from the bottom to the top of the plant root.

[0084] The L6 leaf may be the sixth leaf counting from the bottom to the top of the plant root.

[0085] Any of the above plants may be any one of the following c1) to c5): c1) dicotyledonous plants; c2) monocotyledonous plants; c3) grass plants; c4) rice; c5) rice variety Ishikari Shirako.

[0086] Any of the above-ground biomass can be the fresh weight of the above-ground part.

[0087] Any of the above-mentioned yields may be the yield per plant.

[0088] Experiments have shown that the OsWRKY76 gene can be edited by transforming the rice variety Ishikari Shirako using a recombinant Agrobacterium containing an OsWRKY76 gene knockout vector (i.e., a recombinant plasmid pYL CRISPR / Cas9-OsWRKY76). After the OsWRKY76 gene is edited by the CRISPR / Cas9 endonuclease, the OsWRKY76 gene can cause a mutation in the OsWRKY76 gene. When the OsWRKY76 genes of the two homologous chromosomes are mutated, the activity of the protein OsWRKY76 can be lost; the loss of the activity of the protein OsWRKY76 causes the transgenic rice to have a reduced leaf length, a reduced aboveground biomass, a reduced phosphorus utilization efficiency, and a reduced yield. At the same time, increasing the expression of the protein OsWRKY76 in the rice variety Ishikari Shirako can improve the phosphorus utilization efficiency, increase the rice leaf length, increase the aboveground biomass, and increase the yield. It can be seen that the protein OsWRKY76 can regulate the phosphorus utilization efficiency, the rice leaf length, the aboveground biomass, and the yield. The present invention has important application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0089] Figure 1 Statistical results of leaf length of OsWRKY76 homozygous mutant strains.

[0090] Figure 2 Statistical results of fresh weight of aboveground parts of OsWRKY76 homozygous mutant strains.

[0091] Figure 3 qRT-PCR was used to detect the relative expression level of OsWRKY76 gene in transgenic positive seedlings.

[0092] Figure 4 The statistical results of flag leaf length of OsWRKY76 transgenic rice.

[0093] Figure 5 Statistical results of fresh weight of aboveground parts of transgenic OsWRKY76 rice.

[0094] Figure 6 The relative expression level of OsWRKY76 gene in rice variety Ishikari Shirako under different phosphorus concentration conditions was detected by qRT-PCR.

[0095] Figure 7 The WRKY76 gene is inhibited by phosphorus deficiency.

[0096] Figure 8 Statistics of the leaf length, above-ground fresh weight, yield per plant, and phosphorus use efficiency of transgenic OsWRKY76 rice and homozygous OsWRKY76 mutant plants; among them, ns means P>0.05, * means 0.01<P<0.05, ** means 0.001<P<0.01, *** means P<0.001. Specific implementation manners

[0097] The present invention will be further described in detail below in conjunction with specific implementation manners. The examples given are only for clarifying the present invention, rather than limiting the scope of the present invention. The following examples can be used as a guide for those of ordinary skill in the art to make further improvements, and do not limit the present invention in any way.

[0098] The experimental methods in the following examples are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following examples can be obtained from commercial sources unless otherwise specified.

[0099] In the following examples, all quantitative tests are set with three repeated experiments, and the results are averaged.

[0100] The formula of the standard nutrient solution for rice in the following examples is shown in Table 2.

[0101] Table 2

[0102] Reagents Concentration (g / 10L) <![CDATA[NH4Cl]]> 395.83 <![CDATA[Ca(NO3)2·4H2O]]> 873.76 <![CDATA[KNO3]]> 181.98 <![CDATA[CaCl2]]> 886 <![CDATA[MgSO4·7H2O]]> 3240 <![CDATA[K2SO4]]> 156.83 <![CDATA[NaH2PO4·2H2O]]> 403 <![CDATA[Na2EDTA·2H2O]]> 93.15 <![CDATA[FeSO4·7H2O]]> 69.65 <![CDATA[MnCl2·4H2O]]> 15.0 <![CDATA[H3BO3]]> 9.34 <![CDATA[(NH4)6·Mo7O 24 ·4H2O]]> 0.74 <![CDATA[ZnSO4·7H2O]]> 0.35 <![CDATA[CuSO4·5H2O]]> 0.31

[0103] The formula of the complete nutrient solution for rice in the following examples is shown in Table 3. The pH value of the complete nutrient solution for rice is about 5.5.

[0104] Table 3

[0105]

[0106]

[0107] In the rice genome DNA, the nucleotide sequence of the OsWRKY76 gene is shown in SEQ ID NO:1. In the rice cDNA, the nucleotide sequence of the OsWRKY76 gene is shown in SEQ ID NO:2. The OsWRKY76 gene encodes the OsWRKY76 protein. The amino acid sequence of the OsWRKY76 protein is shown in SEQ ID NO:3.

[0108] Example 1: Inhibition of OsWRKY76 protein expression can inhibit rice leaf growth and reduce rice aboveground biomass

[0109] 1. Construction of recombinant plasmid pYL CRISPR / Cas9-OsWRKY76

[0110] The recombinant plasmid pYL CRISPR / Cas9-OsWRKY76 was constructed according to the method described in the reference (Ma X, Zhang Q, Zhu Q, Liu W, Chen Y, Qiu R, Wang B, Yang Z, Li H, LinY, Xie Y, Shen R, Chen S, Wang Z, Chen Y, Guo J, Chen L, Zhao X, Dong Z, Liu YG. (2015) A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants. Mol Plant 8: 1274-1284). The specific steps are as follows:

[0111] 1. Based on the nucleotide sequence of the OsWRKY76 gene shown in SEQ ID NO: 2, primer U3F was designed and artificially synthesized: (The single underline is the linker sequence, and the double underline is the same as the sequence of positions 1 to 20 from the 5' end of SEQ ID No: 2) and primer U3R: AAAC CCGCGCCACGCCGCGTCCAT (linker sequence is underlined).

[0112] 2. Take an RNase-free centrifuge tube, add 10 μL of primer U3F solution and 10 μL of primer U3R solution, anneal, and obtain annealing products.

[0113] The annealing program was: 95°C for 3 min, 22°C for 1 min (0.1°C / sec).

[0114] 3. Prepare reaction system 1, then react to obtain a reaction product.

[0115] The reaction procedure was: 37°C for 5 min, 20°C for 5 min, 4 cycles; and stored at 16°C.

[0116] Reaction system 1 was 10 μL, consisting of 1 μL 10× Cutsmart Buffer (NEB product, catalog number B6004V), 1 μL U3 plasmid DNA sequence (described in the following literature: Ma X, Zhang Q, Zhu Q, Liu W, Chen Y, Qiu R, Wang B, Yang Z, Li H, Lin Y, Xie Y, Shen R, Chen S, Wang Z, Chen Y, Guo J, Chen L, Zhao X, Dong Z, Liu YG. (2015) A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants. Mol Plant 8: 1274-1284), the annealing product obtained in step 2, and 0.5 μL restriction endonuclease. v2, 0.1 μL T4-DNA ligase (a product of NEB, with the catalog number M0202VVIAL), 1 μL T4-DNA ligase Buffer (a product of NEB, with the catalog number B0202SVIAL) and ddH2O.

[0117] 4. Prepare a PCR reaction system 1, and then perform a first round of PCR amplification to obtain a PCR amplification product 1.

[0118] The PCR reaction system 1 is 15 μL, consisting of 7.5 μL 2×KOD Buffer (a product of TOYOBO, catalog number KFX-2B), 0.1 μL KOD-FX (a product of TOYOBO, catalog number KFX-201), 0.25 μL primer UF solution, 0.25 μL primer gRNA solution, 1.3 μL dNTPs, 1 μL reaction product obtained in step 3 and ddH2O.

[0119] Primer UF: 5′-CTCCGTTTTACCTGTGGAATCG-3′.

[0120] Primer gRNA: 5′-CGGAGGAAAATTCCATCCAC-3′.

[0121] 5. Prepare PCR reaction system 2, then perform a second round of PCR amplification, and recover PCR amplification product 2 of about 500 bp.

[0122] PCR reaction system 2 was 30 μL, consisting of 15 μL 2×KOD Buffer, 0.3 μL KOD-FX, 0.45 μL primer B1 solution, 0.25 μL primer B2 solution, 2 μL dNTPs, 1 μL PCR amplification product 1 and ddH2O.

[0123] Primer B1: 5′-TTCAGAggtctcTctcgCACTGGAATCGGCAGCAAAGG-3′.

[0124] Primer B2: 5'-AGCGTGggtctcGtcagGGTCCATCCACTCCAAGCTC-3'.

[0125] 6. Prepare reaction system 2, and then react to obtain a connection product.

[0126] The reaction procedure was: 37°C for 2 min; 10°C for 3 min; 20°C for 5 min; 37°C for 2 min, 14 cycles; and storage at 16°C.

[0127] Reaction system 2 was 15 μL, consisting of 1.5 μL 10× Cutsmart Buffer (NEB product, catalog number B6004V), 1 μL MH vector (from Liu Yaoguang Laboratory) (described in the following literature: Ma X, Zhang Q, Zhu Q, Liu W, Chen Y, Qiu R, Wang B, Yang Z, Li H, Lin Y, Xie Y, Shen R, Chen S, Wang Z, Chen Y, Guo J, Chen L, Zhao X, Dong Z, Liu YG. (2015) A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants. Mol Plant 8: 1274-1284), 2 μL PCR amplification product 2, and 1 μL restriction endonuclease. v2, 0.1μL T4-DNA ligase, 0.5μL T4-DNA ligase Buffer and ddH2O.

[0128] 7. The ligation product obtained in step 6 was transformed into E. coli DH5α to obtain recombinant E. coli. Then, the plasmid of the recombinant E. coli was extracted to obtain the recombinant plasmid pYLCRISPR / Cas9-OsWRKY76.

[0129] 2. Obtaining the homozygous mutant strain of OsWRKY76

[0130] Since rice is a diploid plant, when Cas9 starts to cut a specific gene, both alleles on the two homologous chromosomes in the same cell may be edited, resulting in the same or different types of mutations, so the two alleles in one plant are regarded as two gene editing events. Homozygous mutants refer to plants with the same mutation in the OsWRKY76 genes on both homologous chromosomes. Bi-allelic mutants refer to plants with mutations in the OsWRKY76 genes on both homologous chromosomes but in different forms. Heterozygous mutants refer to plants with mutations in the OsWRKY76 gene on one of the two homologous chromosomes and no mutations in the OsWRKY76 gene on the other homologous chromosome. Wild type refers to plants with no mutations in the OsWRKY76 genes on both homologous chromosomes.

[0131] 1. The recombinant plasmid pYLCRISPR / Cas9-OsWRKY76 was introduced into Agrobacterium tumefaciens EHA105 to obtain recombinant Agrobacterium. Then, the recombinant Agrobacterium was transferred to the rice variety Ishikari Shirako using the Agrobacterium-mediated genetic transformation method (described in the following literature: Deng, M., Hu, B., Xu, L., Liu, Y., Wang, F., Zhao, H., Wei, X., Wang, J., and Yi, K. (2014). OsCYCP1; 1, a PHO80 homologous protein, negatively regulates phosphate starvation signaling in the roots of rice (Oryza sativa L.). Plant Mol Biol 86, 655-669.) to obtain T0 generation transgenic rice.

[0132] 2. Extract genomic DNA from the leaves of T0 transgenic rice and use it as a template to perform PCR amplification using a CRISPR-Cas9 vector-specific primer pair consisting of primer U3F: 5'-ggcaATGGACGCGGCGTGGCGCGG-3' and primer U3R: 5'-aaacCCGCGCCACGCCGCGTCCAT-3' to obtain a PCR amplification product. Then make the following judgment: If the PCR amplification product of a T0 transgenic rice contains a DNA fragment of 500 bp, the T0 transgenic rice is a transgenic positive seedling.

[0133] 3. The transgenic positive seedlings obtained in step 2 are self-pollinated to obtain seeds that are T1 generation seeds, and the plants grown from the T1 generation seeds are T1 generation plants.

[0134] 4. Using the genomic DNA of leaves of T1 plants as templates, PCR amplification was performed using primer pairs consisting of F: 5'-TCTCGCCGCCTATATGTAGC-3' and R: 5'-ATAAGGAGTGTTCGGCCCAA-3' to obtain the corresponding PCR amplification products. The PCR amplification products were sequenced respectively. The sequencing results were compared with the Cas9 target sequence of the OsWRKY76 gene, and the mutation types were counted.

[0135] The results showed that two OsWRKY76 homozygous mutant strains were obtained, named as homozygous mutant strain wrky76-2 and homozygous mutant strain wrky76-6.

[0136] The OsWRKY76 genes on the two homologous chromosomes of the homozygous mutant strain wrky76-2 had the same mutation, specifically, an insertion of a nucleotide "A" occurred in the OsWRKY76 gene on the two homologous chromosomes (i.e., an A was inserted between the 17th and 18th positions from the 5' end of SEQ ID No: 2), which caused a frameshift and the encoded protein terminated prematurely, resulting in the loss of function of the OsWRKY76 protein.

[0137] The OsWRKY76 gene of the two homologous chromosomes of the homozygous mutant strain wrky76-6 had the same mutation, specifically, a nucleotide "T" was inserted in the OsWRKY76 gene on the two homologous chromosomes (i.e., a T was inserted between the 17th and 18th positions from the 5' end of SEQ ID No: 2), which caused a frameshift and the encoded protein terminated prematurely, resulting in the loss of function of the OsWRKY76 protein.

[0138] 3. Phenotypic identification of OsWRKY76 homozygous mutants

[0139] The experiment was repeated three times to obtain the average value. The steps for each repetition were as follows:

[0140] 1. Select full rice seeds (rice variety Ishikari Shirako, homozygous mutant strain wrky76-2 or homozygous mutant strain wrky76-6), shell them, add clean water, soak them at 37°C until they turn white (2-3 days), and change the water in the morning and evening. Sow the white rice seeds on a nylon mesh filled with complete rice nutrient solution, and culture them in light and dark alternation (i.e., 12h light culture and 12h dark culture are alternated, the light intensity is 3000Lux, and the temperature is 30°C) for 7 days to obtain rice seedlings.

[0141] 2. After completing step 1, transfer the rice seedlings with uniform growth to a 10L rice culture tank and continue to culture them in a standard rice nutrient solution for four weeks to obtain rice plants.

[0142] 3. Measure the leaf length (L3 leaf, L4 leaf, L5 leaf or L6 leaf) and the fresh weight of the aboveground part of the rice plant. The data are mean ± SD (n = 3). Among them, the L3 leaf is the third leaf from the bottom of the rice root, the L4 leaf is the fourth leaf from the bottom of the rice root, the L5 leaf is the fifth leaf from the bottom of the rice root, and the L6 leaf is the sixth leaf from the bottom of the rice root.

[0143] The statistical results of leaf length are shown in Figure 1 (SSBM is the rice variety Ishikari Shirako, wrky76-2 is the homozygous mutant strain wrky76-2, and wrky76-6 is the homozygous mutant strain wrky76-6).

[0144] The statistical results of the fresh weight of aboveground parts are shown in Figure 2 (SSBM is the rice variety Ishikari Shirako, Oswrky76-2 is the homozygous mutant strain wrky76-2, and Oswrky76-6 is the homozygous mutant strain wrky76-6).

[0145] The results showed that compared with the rice variety Ishikari Shirako, the leaf length and aboveground fresh weight (i.e. aboveground biomass) of the homozygous mutant strain of OsWRKY76 were significantly reduced. This shows that inhibiting the expression of OsWRKY76 protein can inhibit rice leaf growth and reduce rice aboveground biomass.

[0146] Example 2: OsWRKY76 protein promotes rice leaf growth and increases the biomass of the aboveground part of rice

[0147] 1. Recombinant plasmid pCAMBIA1300-P OsWRKY76 Construction of :GFP:OsWRKY76-rbcs

[0148] 1. Extract genomic DNA from the leaves of rice variety Ishikari Shirako and use it as a template, use the primer pair consisting of 5'-ACGAATTCGAGCTCGGTACCTTTGAAATTTCTTTGAAACTTGCCC-3' and 5'-tcctcgcccttgctcaccatCGAcgacgacgacgaccacg-3' to perform PCR amplification, and use a gel recovery kit (TIANGEN, DP209) to recover the PCR amplification product A of about 2461 bp. PCR amplification product A is the Promoter sequence.

[0149] 2. Genomic DNA from the leaves of rice variety Ishikari Shirako was extracted and used as a template, using 5'-tcggcatggacgagctgtacaagATGGACGCGGCGTGGCG-3' and 5'

[0150] PCR amplification was performed using a primer pair consisting of -CGACTCTAGAGGATCCCTAGAATTCGGGCAGCTTCTGG-3', and a PCR amplification product B of about 1103 bp was recovered using a gel recovery kit.

[0151] 3. Using p35S-GFP vector (novopro, CAS: V009750) as template, 5'

[0152] -cgtggtcgtcgtcgtcgTCGatggtgagcaagggcgagga-3' and 5'

[0153] PCR amplification was performed using a primer pair consisting of -CGCCACGCCGCGTCCATcttgtacagctcgtccatgccga-3', and a PCR amplification product C of about 717 bp was recovered using a gel recovery kit. PCR amplification product C is the GFP sequence.

[0154] 4. Mix PCR amplification products A, B and C and use them as templates, using 5'-ACGAATTCGAGCTCGGTACCTTTGAAATTTCTTTGAAACTTGCCC-3' and 5'

[0155] PCR amplification was performed using a primer pair consisting of -CGACTCTAGAGGATCCCTAGAATTCGGGCAGCTTCTGG-3', and a PCR amplification product D of about 4282 bp was recovered using a gel recovery kit.

[0156] 5. Digest the PCR amplification product D with restriction endonucleases KpnI and BamHI, and recover the digestion product using a gel recovery kit.

[0157] 6. Digest the vector pCAMBIA1300-rbcs with restriction endonucleases KpnI and BamHI, and use a gel recovery kit to recover the vector backbone of about 9586 bp.

[0158] The vector pCAMBIA1300-rbcs is a recombinant plasmid obtained by replacing the DNA fragment between the restriction endonuclease Pst1 and HindIII of the vector pCAMBIA1300 (product of abcam, catalog number ab275754) with the terminator rbcs. The nucleotide sequence of the terminator rbcs is shown in SEQ ID NO:4.

[0159] 7. Use T4 DNA ligase (NEB) to connect the digestion product recovered in step 5 and the vector backbone recovered in step 6 to obtain the recombinant plasmid pCAMBIA1300-P OsWRKY76:GFP:OsWRKY76-rbcs.

[0160] The recombinant plasmid pCAMBIA1300-P OsWRKY76 :GFP:OsWRKY76-rbcs was sequenced. The sequencing results showed that the recombinant plasmid pCAMBIA1300-P OsWRKY76 :GFP:OsWRKY76-rbcs is a recombinant plasmid obtained by replacing the small DNA fragment between the restriction endonucleases KpnI and BamHI of the pCAMBIA1300-rbcs vector with the target DNA fragment with the nucleotide sequence shown in SEQ ID NO:5.

[0161] Recombinant plasmid pCAMBIA1300-P OsWRKY76 :GFP:OsWRKY76-rbcs expresses the OsWRKY76 protein with the amino acid sequence shown in SEQ ID NO:3.

[0162] 2. Obtaining OsWRKY76 Transgenic Rice

[0163] 1. Recombinant plasmid pCAMBIA1300-P OsWRKY76 :GFP:OsWRKY76-rbcs was introduced into Agrobacterium tumefaciens EHA105 to obtain recombinant Agrobacterium. Then, the recombinant Agrobacterium was transferred to the rice variety Ishikari Shirako using the Agrobacterium-mediated genetic transformation method (described in the following literature: Deng, M., Hu, B., Xu, L., Liu, Y., Wang, F., Zhao, H., Wei, X., Wang, J., and Yi, K. (2014). OsCYCP1; 1, a PHO80 homologous protein, negatively regulates phosphate starvation signaling in the roots of rice (Oryza sativa L.). Plant Mol Biol 86, 655-669.) to obtain T0 generation OsWRKY76 gene-transfected rice.

[0164] 2. Extract genomic DNA from leaves of T0 transgenic OsWRKY76 rice and use it as a template to perform PCR amplification using a primer pair consisting of 5'-tccacagcatacacacgtct-3 and 5'-gctgaacttgtggccgttta-3' to obtain a PCR amplification product. Then make the following judgment: If the PCR amplification product of a T0 transgenic OsWRKY76 rice contains a DNA fragment of 485 bp, the T0 transgenic OsWRKY76 rice is a transgenic positive seedling.

[0165] After testing, a total of 15 transgenic positive seedlings were obtained.

[0166] 3. qRT-PCR detection of the relative expression of OsWRKY76 gene in transgenic positive seedlings

[0167] (1) Use Super Total RNA Extraction Kit (Promega, LS1040) was used to extract total RNA from 15 transgenic positive seedlings and the rice variety Ishikari Shirako to obtain RNA samples. Then, ddH2O was added to 1.5 μg of RNA samples to obtain a 10 μL sample, which was then denatured at 70°C for 10 minutes and immediately placed on ice. After that, the reagent for reverse transcription was added and GoScript was used. TM Reverse transcription was performed using the Reverse Transcription System (Promega, A5000) to obtain cDNA.

[0168] The reverse transcription system was 20 μL, including the denatured sample placed on ice, 4 μL MgCl2, 2 μL 10×ReverseTranscriptionbuffer, 2 μL dNTP (10 mM), 1 μL Oligo-dT, 0.5 μL RNAse inhibitor, 0.6 μL M-MuLV Reverse Transcriptase, and ddH2O. 10×Reverse Transcriptionbuffer, Oligo-dT, RNAse inhibitor, and M-MuLV Reverse Transcriptase were all from GoScript TM Components in the ReverseTranscription System.

[0169] The reverse transcription program was: 42°C, 1 h; 95°C, 5 min.

[0170] (2) Using the cDNA obtained in step (1) as a template, qRT-PCR detection was performed using 2×Taq Pro Universal SYBR qPCR Master Mix (Vazyme, Q712-03) to obtain the relative expression level of the OsWRKY76 gene (using the Actin gene as an internal reference).

[0171] The reaction system was 10 μL, including 5 μL 2×Taq Pro Universal SYBR qPCR Master Mix, 1 μL cDNA, 0.2 μL each of the upstream primer and downstream primer of the detection gene, and ddH2O.

[0172] The reaction conditions were: 95°C for 5 minutes; 95°C for 10 seconds, 60°C for 10 seconds, 72°C for 10 seconds, 24 cycles.

[0173] The primers for detecting the OsWRKY76 gene were: 5′-CCTGGTGGTCAAGGACGGGTAC-3′ and 5′-GCTCCGCTGCACCTTCTTCTTC-3′.

[0174] The primers for detecting the Actin gene were 5′-CAACACCCCTGCTATGTACG-3′ and 5′-CAACACCCCTGCTATGTACG-3′.

[0175] Some test results can be found in Figure 3 The results showed that the relative expression of OsWRKY76 gene in 8 of the 15 transgenic positive seedlings was increased by more than 20 times compared with that of the rice variety Ishikari Shirako. Two of the 8 transgenic rice plants were randomly selected and named Co-6 and Co-15, which are transgenic rice plants with OsWRKY76 gene.

[0176] 3. Phenotypic identification of transgenic rice with OsWRKY76 gene

[0177] The experiment was repeated three times to obtain the average value. The steps for each repetition were as follows:

[0178] 1. Select full rice seeds (rice variety Ishikari Shirako, homozygous mutant strain wrky76-2, Co-6 or Co-15), shell them, add clean water, soak them at 37°C until they turn white (2-3 days), and change the water in the morning and evening. Sow the white rice seeds on a nylon mesh filled with complete rice nutrient solution, and culture them in light and dark alternation (i.e., 12h light culture and 12h dark culture are alternated, the light intensity is 3000Lux, and the temperature is 30°C) for 7 days to obtain rice seedlings.

[0179] 2. After completing step 1, transfer the rice seedlings with uniform growth to a 10L rice culture tank and continue to culture them in a standard rice nutrient solution for four weeks to obtain rice plants.

[0180] 3. The length of the flag leaf and the fresh weight of the aboveground part of the rice plants were measured. The data are mean ± SD (n = 3).

[0181] The statistical results of the length of the sword leaf are shown in Figure 4(WT is the rice variety Ishikari Shirako, wrky76-2 is the homozygous mutant strain wrky76-2, and Co-6 and Co-15 are transgenic rice with OsWRKY76 gene).

[0182] The statistical results of the fresh weight of aboveground parts are shown in Figure 5 (WT is the rice variety Ishikari Shirako, wrky76-2 is the homozygous mutant strain wrky76-2, and Co-6 and Co-15 are transgenic rice with OsWRKY76 gene).

[0183] The results showed that compared with the rice variety Ishikari Shirako, the flag leaf length and aboveground fresh weight (i.e., aboveground biomass) of the OsWRKY76 homozygous mutant were significantly reduced, while the flag leaf length and aboveground fresh weight (i.e., aboveground biomass) of transgenic OsWRKY76 rice (such as Co-6 and Co-15) were significantly increased.

[0184] The above results indicate that increasing the expression of OsWRKY76 protein by transferring the OsWRKY76 gene into rice can promote rice leaf growth and increase the aboveground biomass of rice; whereas inhibiting the expression of OsWRKY76 protein in rice can inhibit rice leaf growth and reduce the aboveground biomass of rice.

[0185] Example 3: OsWRKY76 protein can improve phosphorus utilization efficiency

[0186] 1. WRKY67 gene expression is suppressed by phosphorus deficiency

[0187] The experiment was repeated three times to obtain the average value. The steps for each repetition were as follows:

[0188] 1. Select full rice varieties Ishikari Shirako seeds, shell them, add clean water, soak them at 37°C until they turn white (2-3 days), and change the water in the morning and evening. Sow the white rice seeds on a nylon mesh filled with nutrient solution (complete rice nutrient solution, complete rice nutrient solution containing 20μM Pi, or complete rice nutrient solution containing 200μM Pi), and culture them in alternating light and dark (i.e., 12h light culture and 12h dark culture are alternated, the light intensity is 3000Lux, and the temperature is 30°C) for 7 days to obtain rice seedlings.

[0189] 2. After completing step 1, transfer the rice seedlings with uniform growth to a 10L rice culture tank and continue to culture them in the standard rice nutrient solution for three weeks to obtain rice plants.

[0190] 3. Total RNA was extracted from three rice plants respectively, and then reverse transcribed to obtain cDNA. Using cDNA as a template, qRT-PCR was used to detect the relative expression of the OsWRKY76 gene (with Actin gene as an internal reference), and the data are mean ± SD (n = 3).

[0191] The primers for detecting the OsWRKY76 gene were: 5'-CCTGGTGGTCAAGGACGGGTAC-3' and 5'

[0192] -GCTCCGCTGCACCTTCTTCTTC-3'.

[0193] The primers for detecting the Actin gene were 5′-CAACACCCCTGCTATGTACG-3′ and 5′-CAACACCCCTGCTATGTACG-3′.

[0194] Test results see Figure 6 (20 μM Pi is a complete rice nutrient solution containing 20 μM Pi, 200 μM Pi is a complete rice nutrient solution containing 200 μM Pi, and 0 μM Pi is a complete rice nutrient solution.) The results showed that the expression of the WRKY67 gene was inhibited by phosphorus deficiency.

[0195] 2. Phosphorus deficiency inhibits the expression of WRKY76 protein

[0196] 1. Recombinant plasmid P WRKY76 -1300-GUS Construction

[0197] (1) The genomic DNA of the leaves of the rice variety Ishikari Shirako was extracted and used as a template for PCR amplification using a primer pair consisting of a Pro upstream primer: 5′-GTCGACAACCATTATACAATAACACA-3′ and a Pro downstream primer: 5′-CTGCAGATGGCCCAGCGAACATTTAT-3′. A conventional agarose gel DNA recovery kit (TIANGEN, DP209) was then used to recover a PCR amplification product of approximately 2461 bp.

[0198] (2) The PCR amplification product recovered in step (1) is digested with restriction endonucleases SalI and PstI to recover the digestion product.

[0199] (3) The pCAMBIA1300NHGUS-plus vector (abcam, ab275754) was digested with restriction endonucleases SalI and PstI to recover the vector backbone.

[0200] (4) Connecting the enzyme digestion product recovered in step (2) and the vector backbone recovered in step (3) to obtain a recombinant plasmid P WRKY76 -1300-GUS.

[0201] The recombinant plasmid P WRKY76 -1300-GUS was sequenced. The sequencing results showed that the recombinant plasmid P WRKY76-1300-GUS is a recombinant plasmid obtained by replacing the DNA fragment between the restriction endonucleases SalI and PstI of the pCAMBIA1300NHGUS-plus vector with the promoter sequence of the WRKY76 gene in the genome of the rice variety Ishikari Shirako (http: / / rice.plantbiology.msu.edu). The expression of the GUS gene is driven by the promoter of the WRKY76 gene.

[0202] 2. T0 to Pro WRKY76 Obtaining positive seedlings

[0203] (1) The recombinant plasmid P WRKY76 -1300-GUS was introduced into Agrobacterium tumefaciens EHA105 to obtain recombinant Agrobacterium. Then, the recombinant Agrobacterium was transferred to the rice variety Ishikari Shirako using the Agrobacterium-mediated genetic transformation method (described in the following literature: Deng, M., Hu, B., Xu, L., Liu, Y., Wang, F., Zhao, H., Wei, X., Wang, J., and Yi, K. (2014). OsCYCP1; 1, a PHO80 homologous protein, negatively regulates phosphate starvation signaling in the roots of rice (Oryza sativa L.). Plant Mol Biol 86, 655-669.) to obtain T0 generation transgenic Pro WRKY76 Rice.

[0204] (2) Extract T0 and transfer Pro WRKY76 The genomic DNA of rice leaves was used as a template, and a primer pair consisting of a Pro upstream primer: 5′-GTCGACAACCATTATACAATAACACA-3′ and a Pro downstream primer: 5′-CTGCAGATGGCCCAGCGAACATTTAT-3′ was used for PCR amplification to obtain a PCR amplification product. WRKY76 The PCR amplification product of rice contains a DNA fragment of about 2461 bp in size. WRKY76 Rice is T0 generation Pro WRKY76 Positive seedlings.

[0205] 3. GUS staining

[0206] The experiment was repeated three times to obtain the average value. The steps for each repetition were as follows:

[0207] (1) Choose a full T0 generation ProWRKY76 After the seeds of the positive seedlings are peeled, clean water is added and soaked at 37°C until they turn white (2-3 days), and the water is changed in the morning and evening. The white rice seeds are sown on a nylon mesh filled with nutrient solution (complete rice nutrient solution or complete rice nutrient solution containing 200μMPi), and cultured in light and dark alternation (i.e., 12h light culture and 12h dark culture are alternately carried out, the light intensity is 3000Lux, and the temperature is 30°C) for 7 days to obtain rice seedlings.

[0208] (2) After completing step (1), the rice seedlings with uniform growth were transferred to a rice culture tank with a specification of 10 L and cultured in a standard rice nutrient solution for three weeks to obtain rice plants.

[0209] (3) After completing step (2), the leaf meristem of the rice plant is subjected to GUS staining.

[0210] GUS staining results are shown in Figure 7 (+Pi is a complete rice nutrient solution containing 200 μM Pi, -Pi is a complete rice nutrient solution.) The results showed that the WRKY76 gene was inhibited by phosphorus deficiency, that is, phosphorus deficiency inhibited the expression of WRKY76 protein.

[0211] 3. OsWRKY76 protein can improve phosphorus utilization efficiency

[0212] The experiment was repeated three times to obtain the average value. The steps for each repetition were as follows:

[0213] 1. Select full rice seeds (rice variety Ishikari Shirako, homozygous mutant strain wrky76-2, Co-6 or Co-15), shell them, add clean water, soak them at 37°C until they turn white (2-3 days), and change the water in the morning and evening. Sow the white rice seeds on nylon mesh filled with nutrient solution (complete rice nutrient solution, complete rice nutrient solution containing 20 μM Pi, complete rice nutrient solution containing 50 μM Pi or complete rice nutrient solution containing 200 μM Pi), and culture them in light and dark alternation (i.e., 12 h light culture and 12 h dark culture are alternated, the light intensity is 3000 Lux, and the temperature is 30°C) for 7 days to obtain rice seedlings.

[0214] 2. After completing step 1, transfer the rice seedlings with uniform growth to a 10L rice culture tank, and continue to culture them in a standard rice nutrient solution until they mature to obtain rice plants.

[0215] 3. The aboveground fresh weight, leaf length, yield per plant and phosphorus utilization efficiency of rice plants were measured. Data are mean ± SD (n = 3).

[0216] The statistical results are shown in Figure 8(-Pi is complete rice nutrient solution, LP is complete rice nutrient solution containing 20μM Pi, MP is complete rice nutrient solution containing 50μM Pi, HP is complete rice nutrient solution containing 200μM Pi, * indicates significant difference, ** or *** indicates extremely significant difference, ns indicates no significant difference). The results showed that under different phosphorus concentrations, WRKY76 protein can improve phosphorus utilization efficiency, promote rice leaf growth and increase the fresh weight of aboveground parts, and ultimately increase the yield per plant.

[0217] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. Application of protein OsWRKY76, which is at least one of S1)-S8): S1) regulates plant leaf length; S2) regulating the aboveground biomass of plants; S3) regulates plant phosphorus utilization efficiency; S4) regulating plant yield; S5) cultivating transgenic plants with altered leaf length; S6) cultivating transgenic plants with altered aboveground biomass; S7) cultivating transgenic plants with altered phosphorus utilization efficiency; S8) cultivating transgenic plants with altered yield; The protein OsWRKY76 is a1) or a2) or a3): a1) the amino acid sequence is the protein shown in SEQ ID NO: 3; a2) a fusion protein obtained by connecting a tag to the N-terminus or / and the C-terminus of the protein shown in SEQ ID NO: 3; a3) A protein related to plant leaf length and / or aboveground biomass obtained by replacing and / or deleting and / or adding one or more amino acid residues of the protein shown in a1) or a2).

2. Use of a nucleic acid molecule encoding the protein OsWRKY76 of claim 1, which is at least one of S1) to S8): S1) regulates plant leaf length; S2) regulating the aboveground biomass of plants; S3) regulates plant phosphorus utilization efficiency; S4) regulating plant yield; S5) cultivating transgenic plants with altered leaf length; S6) cultivating transgenic plants with altered aboveground biomass; S7) cultivating transgenic plants with altered phosphorus utilization efficiency; S8) Cultivating transgenic plants with altered yield.

3. The use according to claim 1 or 2, characterized in that: The regulating plant leaf length is to increase the plant leaf length or to reduce the plant leaf length; The regulating the aboveground biomass of the plant is to increase the aboveground biomass of the plant or to reduce the aboveground biomass of the plant; The regulating the utilization efficiency of plant phosphorus is to increase the utilization efficiency of plant phosphorus or to reduce the utilization efficiency of plant phosphorus; The regulating plant yield is to increase plant yield or reduce plant yield.

4. A method for cultivating transgenic plant A, comprising the following steps: increasing the expression level and / or activity of the protein OsWRKY76 described in claim 1 in a starting plant to obtain transgenic plant A; compared with the starting plant, the transgenic plant A has improved phosphorus utilization efficiency, increased leaf length, increased aboveground biomass and / or increased yield.

5. The method according to claim 4, characterized in that: The increasing of the expression level and / or activity of the protein OsWRKY76 of claim 1 in the starting plant is achieved by introducing a nucleic acid molecule encoding the protein OsWRKY76 of claim 1 into the starting plant.

6. A method for cultivating transgenic plant B, comprising the following steps: reducing the expression level and / or activity of the protein OsWRKY76 described in claim 1 in a starting plant to obtain transgenic plant B; compared with the starting plant, the phosphorus utilization efficiency of transgenic plant B is reduced, the leaf length is reduced, the aboveground biomass is reduced and / or the yield is reduced.

7. The method according to claim 6, characterized in that: The reducing the expression level and / or activity of the protein OsWRKY76 of claim 1 in the starting plant is achieved by mutating the gene encoding the protein OsWRKY76 in the starting plant; The coding gene of the protein OsWRKY76 in the mutant plant is obtained by mutating the OsWRKY76 gene shown in SEQ ID No: 2 to OsWRKY76 / +1bp; the OsWRKY76 / +1bp is a DNA molecule obtained by inserting one nucleotide between the 17th and 18th positions from the 5' end of SEQ ID No: 2, while keeping the other nucleotide sequences of SEQ ID No: 2 unchanged; Preferably, the inserted nucleotide is nucleotide A or nucleotide T.

8. The method according to claim 7, characterized in that: The coding gene of the protein OsWRKY76 in the mutated starting plant is achieved by introducing the CRISPR / Cas9 system into the starting plant; The CRISPR / Cas9 system includes a recombinant expression vector; the recombinant expression vector contains a DNA molecule expressing a gRNA targeting the gene encoding the protein OsWRKY76; Preferably, the target sequence of the gRNA is shown in SEQ ID No: 2, positions 1 to 20 from the 5' end.

9. The use according to any one of claims 1 to 3 or the method according to any one of claims 4 to 8, characterized in that: The leaf is at least one of a mature rice plant leaf, a flag leaf, an L3 leaf, an L4 leaf, an L5 leaf, and an L6 leaf; The L3 leaf is the third leaf from the bottom to the top of the plant root; The L4 leaf is the fourth leaf from the bottom to the top of the plant root; The L5 leaf is the fifth leaf from the bottom to the top of the plant root; The L6 leaf is the sixth leaf counting from the bottom to the top of the plant root.

10. The use according to claim 1, 2, 3 or 9 or the method according to any one of claims 4 to 9, characterized in that: The plant is any one of the following c1) to c5): c1) a dicotyledon; c2) a monocotyledon; c3) a grass; c4) rice; c5) the rice variety Ishikari Shirako.

Images