Application of feruloyl ceramide in preparation of skin care product

Abstract

The invention provides application of feruloyl ceramide in preparation of a skin care product, and relates to the technical field of biological medicines. The feruloyl ceramide has the effects of promoting tissue healing, resisting aging, resisting inflammation, whitening and enhancing skin immune barrier, and can be used for preparing cosmetics, health care products, medical instruments or medicines and other skin care products. Compared with the traditional ceramide NP, the feruloyl ceramide has more excellent effects in the aspects of promoting collagen expression, resisting light aging, whitening and enhancing skin immune barrier, and particularly has an outstanding effect in the aspect of promoting human beta defensin 2 expression. The feruloyl ceramide has higher stability to light and higher safety, and is more suitable for being used in the field of cosmetics.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedicine, and particularly relates to use of feruloylceramide in preparing skin care products. Background Art

[0002] Ferulic acid is widely found in plants in nature, such as Chinese angelica, Chuanxiong and other traditional Chinese medicines, and also in rice husks, wheat bran and rice bran. Ferulic acid is a type of phenolic acid and a natural phytochemical with strong antioxidant activity. Ferulic acid can significantly increase the content of glutathione and nicotinamide adenine dinucleotide phosphate in irradiated cells, and has a protective effect on irradiated endothelial cells. Ferulic acid can show excellent antioxidant effects in the body by inhibiting the generation of reactive oxygen species (ROS) and removing excessive free radicals. At the same time, it can directly absorb ultraviolet rays of 290-320nm, and has a strong effect of resisting ultraviolet rays and radiation. In addition, ferulic acid is also a tyrosinase inhibitor that can be combined with various strong antioxidants (such as resveratrol, vitamin C, etc.) to enhance the effect. It can not only whiten and resist oxidation, but also protect against sunburn and inflammation. However, there is an instability problem in the application of ferulic acid in cosmetics. Literature research shows ("Analytical Laboratory" November 2001 supplement pages 93-94) that light, pH value, temperature, concentration, etc. will affect its stability. Especially under light conditions, the content of ferulic acid will decrease significantly.

[0003] Ceramide is a type of sphingolipid composed of a sphingosine long-chain base and a fatty acid, wherein the carbon chain length, unsaturation and number of hydroxyl groups of the sphingosine part and the fatty acid part can all be varied. As an important physiological lipid in the skin, ceramide has attracted special attention from researchers for its unique skin care effect. As the main component of intercellular lipids in the stratum corneum of the skin, ceramide not only acts as a second messenger molecule in the sphingomyelin pathway, but also plays an important role in the formation process of the epidermal stratum corneum. Chinese invention patent CN1112916C discloses a composition containing a combination of free sphingosine bases and ceramide and its use. The composition of the present invention is suitable for skin diseases related to damaged barrier function, especially skin diseases related to cell growth and differentiation regulation disorders, inflammatory states and / or infection states, but its effect needs to be further improved.

[0004] Chinese invention patent application CN115433100A discloses ceramide compounds containing conjugated carboxylic acids, preparation methods and applications thereof. The compound formed by the reaction of ferulic acid with different sphingoid bases, namely feruloylceramide, is significantly superior to traditional ceramide NP in terms of ABTS free radical scavenging performance and exhibits excellent antioxidant properties. On this basis, further exploration and mining of other uses of feruloylceramide has important research significance and practical value. Summary of the invention

[0005] The purpose of the present invention is to provide use of feruloylceramide in skin care.

[0006] Feruloylceramide is a product obtained by condensation of ferulic acid and different sphingoid bases. Its structure is:

[0007] R is selected from one of the following structures:

[0008] Feruloylceramide refers in particular to feruloylphytosphingosine (phytosphingosine ferulate), feruloyldihydrosphingosine (dihydrosphingosine ferulate), feruloylsphingosine (sphingosine ferulate), feruloyl-6-hydroxy-sphingosine (sphingosine ferulate).

[0009] The present invention verifies through experiments that feruloylceramide has the effects of tissue healing, anti-aging, anti-inflammatory, whitening, and strengthening the skin immune barrier, and can be used for preparing cosmetics, health products, medical devices, or medicines.

[0010] Preferably, feruloylceramide is used in the preparation of cosmetics, health products, medical devices or medicines for tissue healing and / or repairing skin barriers.

[0011] Preferably, feruloylceramide is used in the preparation of anti-aging cosmetics, health products, medical devices or medicines.

[0012] Aging is the comprehensive result of multiple factors. The anti-aging effect can be measured from a number of different indicators. The present invention tests the effects of feruloylceramide on three indicators: elastase, collagen, and interstitial collagenase.

[0013] Preferably, feruloylceramide is used in the preparation of cosmetics, health products, medical devices or medicines for inhibiting elastase.

[0014] Preferably, feruloylceramide is used in the preparation of cosmetics, health products, medical devices or medicines for promoting collagen expression.

[0015] Preferably, feruloylceramide is used in the preparation of cosmetics, health products, medical devices or medicines for inhibiting photoaging.

[0016] Preferably, feruloylceramide is used in the preparation of cosmetics, health products, medical devices or medicines for inhibiting interstitial collagenase.

[0017] Preferably, feruloylceramide is used in the preparation of anti-inflammatory cosmetics, health products, medical devices or medicines.

[0018] More preferably, feruloylceramide is used in the preparation of cosmetics, health products, medical devices or medicines for inhibiting IL-6.

[0019] Preferably, feruloylceramide is used in the preparation of cosmetics, health products, medical devices or medicines for whitening.

[0020] Further preferably, feruloylceramide is used in the preparation of cosmetics, health products, medical devices or medicines for inhibiting melanin.

[0021] Preferably, feruloylceramide is used in the preparation of cosmetics, health products, medical devices or medicines for enhancing the skin immune barrier.

[0022] More preferably, feruloylceramide is used in cosmetics, health products, medical devices or medicines for promoting the expression of human β-defensin 2.

[0023] The second aspect of the present invention relates to a composition comprising feruloylceramide, wherein the composition has at least one of the effects of tissue healing, anti-aging, anti-inflammatory, whitening, and strengthening the skin immune barrier.

[0024] A third aspect of the present invention relates to a medical device comprising feruloylceramide.

[0025] The "medical device" used herein refers to Class II medical devices, which refer to medical devices whose safety and effectiveness should be controlled, including dressings, wound care materials, hemostatic sponges, medical absorbent cotton, medical absorbent gauze, etc. In a specific embodiment, the Class II medical device is a medical dressing, which refers to a covering for a wound or a material placed near a wound, which has absorbency, adhesion, protection, osmotic regulation, pH regulation or pressure induction. The dressing may be in direct or indirect contact with the wound.

[0026] The present invention has the following beneficial effects: (1) Compared with traditional ceramide NPs, feruloyl ceramide has better effects in promoting collagen expression, anti-photoaging, whitening, and enhancing the skin immune barrier; (2) Ferulic acid ceramide has an outstanding effect in promoting the expression of human β-defensin 2, which is closely related to the skin immune barrier function. This is an effect that has not been studied before for ceramide; (3) Compared with ferulic acid, feruloylceramide has better effects in improving cell vitality, enhancing skin tissue healing ability, inhibiting elastase, promoting collagen expression, and anti-inflammation; (4) Feruloylceramide has stronger stability to light and is more suitable for use in the cosmetics field. The large-scale promotion and application of cosmetic functional raw materials must solve the stability problem. The instability of the chemical properties of the raw materials often leads to problems such as short shelf life, easy inactivation, and easy discoloration in the application of cosmetics.

[0027] In summary, feruloylceramide can be used in the preparation of cosmetics, health products, medical devices and pharmaceuticals with corresponding efficacy or indications. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 : Example 2 Bar graph showing the test results of feruloyl phytosphingosine on the proliferation activity of cells; Figure 2 : Example 2 Bar graph of the test results of feruloylsphingosine on the proliferation activity of cells; Figure 3 : Example 2 Bar graph showing the test results of feruloyl dihydrosphinganine on the proliferation activity of cells; Figure 4 : Example 2 Bar graph of the test results of ferulic acid on cell proliferation activity; Figure 5 : Example 3 Cell scratch test results; Figure 6 : Example 4 Feruloyl phytosphingosine inhibits elastase test results bar graph; Figure 7 : Example 4 Column chart of the test results of feruloylsphingosine inhibition of elastase; Figure 8 : Example 4 Bar graph of the test results of feruloyl dihydrosphingosine inhibiting elastase; Fig. 9 : Example 4 Ferulic acid inhibits elastase test results bar graph; Fig.10 : Example 5 Column chart of the test results of the activity of ceramide NP on collagen Col-I; Fig.11: Example 5 Bar graph of the test results of the activity of feruloylsphingosine on collagen Col-I; Fig.12 : Example 5 Bar graph showing the results of the activity test of feruloyl dihydrosphinganine on collagen Col-I; Fig.13 : Example 5 Bar graph of the test results of ferulic acid on the activity of collagen Col-I; Fig.14 : Example 6 Bar graph of the anti-inflammatory activity test results of feruloyl phytosphingosine; Fig.15 : Example 6 Column chart of the anti-inflammatory activity test results of feruloylsphingosine; Fig.16 : Example 6 Bar graph of the anti-inflammatory activity test results of feruloyl dihydrosphinganine; Fig.17 : Example 6 Column chart of the test results of the anti-inflammatory activity of ferulic acid; Fig.18 : Bar graph showing the results of inhibition of MMP-1 overexpression in UVA model by feruloyl phytosphingosine; Fig.19 : Bar graph showing the results of inhibition of MMP-1 overexpression by feruloylsphingosine in UVA model; Fig. 20 : Bar graph showing the results of inhibition of MMP-1 overexpression in UVA model by feruloyl dihydrosphinganine; Fig.21 : Bar graph showing the results of the inhibition of MMP-1 overexpression in UVA model by feruloyl-6-hydroxy-sphingosine; Fig. 22 :Bar graph showing the results of ceramide NP inhibiting MMP-1 overexpression in UVA model; Fig.23 : Bar graph showing the results of inhibition of MMP-1 overexpression in UVB model by feruloyl phytosphingosine; Fig.24 : Bar graph showing the results of inhibition of MMP-1 overexpression by feruloylsphingosine in UVB model; Fig.25 : Bar graph showing the results of inhibition of MMP-1 overexpression in UVB model by feruloyl dihydrosphinganine; Fig.26 : Bar graph showing the results of the inhibition of MMP-1 overexpression in UVB model by feruloyl-6-hydroxy-sphingosine; Fig. 27 :Bar graph showing the results of ceramide NP inhibiting MMP-1 overexpression in UVB model; Fig.28 :The bar graph of the effect of ceramide NP on the relative expression of melanin; Fig.29: The bar graph of the effect of feruloylsphingosine on the relative expression of melanin; Fig.30 : Bar graph showing the effect of feruloyl dihydrosphinganine on the relative expression of melanin; Fig.31 : The bar graph of the effect of feruloyl-6-hydroxy-sphingosine on the relative expression of melanin; Fig.32 : Example 9 photostability test result curve.

[0029] Figure 1-31 One-way ANOVA was used for statistical analysis. Compared with the other concentrations, the Control group had a P value > 0.05, which was indicated by "ns", indicating no significant difference; a P value < 0.05 was indicated by "*", a P value < 0.01 was indicated by "**", a P value < 0.001 was indicated by "***", and a P value < 0.0001 was indicated by "****", indicating a significant difference. DETAILED DESCRIPTION

[0030] The present invention will be further described below in conjunction with specific embodiments.

[0031] Example 1 Green Synthesis of Feruloylceramide

[0032] One-pot preparation: Add compound methyl ferulate (100 mmol), sphingoid base (50 mmol), and anhydrous magnesium chloride (0.5 mol) into a 250 mL round-bottom flask, connect the flask mouth to a three-way valve, and connect the water pump (water pump pressure: -0.09 MPa), then heat the reaction system to 100 ° C, react for about 10 hours until no more methanol solvent is drawn out of the flask mouth, and TLC monitors the complete reaction of phytosphingosine. The reaction system is cooled to room temperature, ethanol (80 mL) and sodium hydroxide aqueous solution (2N) 40 mL are added, and the reaction system is heated to 50 ° C and reacted for 6 hours until the compound methyl ferulate disappears completely.

[0033] Post-treatment: The reaction system was cooled to room temperature, and dilute hydrochloric acid (2N) was added to adjust the pH value to about 6. About 2 / 3 of the solvent was dried by spin drying. A large amount of gray-white solid precipitated from the reaction system. After filtration, the filter cake was slurried twice with purified water at room temperature and once with ethanol at low temperature (4-8°C). The filter cake was collected and dried to obtain an off-white solid product (35 mol, 70%).

[0034] Feruloyl phytosphingosine

[0035] 1H NMR (400 MHz, Methanol-d 4 ) δ 7.45 (d, J = 15.6 Hz, 1H), 7.12 (d, J= 2.0 Hz, 1H), 7.03 (dd, J = 8.3, 1.9 Hz, 1H), 6.79 (d, J = 8.1 Hz, 1H), 6.53(d, J = 15.7 Hz, 1H), 4.23 (q, J = 5.3 Hz, 1H), 3.88 (s, 3H), 3.80 (qd, J =11.2, 5.0 Hz, 2H), 3.64 (t, J = 5.8 Hz, 1H), 3.56 (ddd, J = 8.9, 5.9, 2.5 Hz,1H), 1.68 (dtd, J = 12.9, 7.2, 6.2, 3.5 Hz, 1H), 1.53 (d, J = 8.4 Hz, 1H), 1.43 (ddd, J = 12.4, 8.1, 3.7 Hz, 1H), 1.36 – 1.16 (m, 23H), 0.89 (t, J = 6.7Hz, 3H).

[0036] Feruloylsphingosine

[0037] 1 H NMR (400 MHz, Methanol-d 4) δ 7.43 (d, J = 15.7 Hz, 1H), 7.12 (d, J= 2.0 Hz, 1H), 7.03 (dd, J = 8.2, 2.0 Hz, 1H), 6.79 (d, J = 8.1 Hz, 1H), 6.50(d, J = 15.7 Hz, 1H), 5.75 – 5.62 (m, 1H), 5.55 – 5.44 (m, 1H), 4.35 (t, J =7.0 Hz, 1H), 4.12 (t, J = 7.4 Hz, 1H), 4.01 – 3.94 (m, 1H), 3.88 (s, 3H),3.78 – 3.68 (m, 1H), 2.54 – 2.45 (m, 1H), 2.30 – 2.16 (m, 1H), 2.02 (p, J =7.2 Hz, 2H), 1.37 – 1.10 (m, 20H), 0.89 (t, J = 6.9 Hz, 3H).

[0038] Feruloyl dihydrosphingosine

[0039] 1 H NMR (400 MHz, Methanol-d 4 ) δ 7.48 (d, J = 15.7 Hz, 1H), 7.16 (d, J = 2.0 Hz, 1H), 7.06 (dd, J = 8.2, 1.9 Hz, 1H), 6.82 (d, J = 8.2 Hz, 1H), 6.55(d, J = 15.7 Hz, 1H), 4.01 – 3.93 (m, 1H), 3.91 (s, 3H), 3.79 (d, J = 5.0 Hz,2H), 3.77 – 3.71 (m, 1H), 1.92 – 1.85 (m, 2H), 1.38 – 1.23 (m, 26H), 0.96 –0.87 (m, 3H).

[0040] Feruloyl-6-hydroxy-sphingosine

[0041] 1 H NMR (400 MHz, Methanol-d 4) δ 7.46 (d, J = 15.7 Hz, 1H), 7.14 (d, J = 2.0 Hz, 1H), 7.05 (dd, J = 8.2, 2.0 Hz, 1H), 6.77 (d, J = 8.2 Hz, 1H), 6.51(d, J = 15.8 Hz, 1H), 5.73 – 5.64 (m, 1H), 5.51 – 5.42 (m, 1H), 4.32 (t, J =7.0 Hz, 1H), 4.10 (t, J = 7.4 Hz, 1H), 4.06 – 3.95 (m, 1H), 3.85 (s, 3H),3.75 – 3.71 (m, 1H), 3.68 – 3.58 (m, 1H), 2.52 – 2.47 (m, 1H), 2.32 – 2.14(m, 1H), 1.35 – 1.14 (m, 20H), 0.85 (t, J = 6.9 Hz, 3H).

[0042] Example 2 MTT assay to detect the effects of compounds on cell proliferation Human keratinocytes HaCaT cells were cultured at 1×10 4 The cells were seeded at a density of 100 μL / well in a 96-well plate and incubated overnight in an incubator. After 24 h, the supernatant was discarded, and 100 μL of samples (feruloyl phytosphingosine, feruloyl sphingosine, feruloyl dihydrosphingosine and ferulic acid) diluted with DMEM medium or blank DMEM medium were added (three groups were set in parallel for each concentration, and the average value was calculated). After incubation for another 24 h, the medium was removed, 100 μL of thiazolyl blue (MTT) was added to each well, and the absorbance at 450 nm was measured to calculate the cell survival rate = A 给药孔 / A 空白孔 × 100%. The results are shown in Tables 1 to 4.

[0043] Table 1: Test results of feruloyl phytosphingosine on cell proliferation activity

[0044] Table 2: Test results of feruloylsphingosine on cell proliferation activity

[0045] Table 3: Test results of feruloyl dihydrosphinganine on cell proliferation activity

[0046] Table 4: Test results of ferulic acid on cell proliferation activity

[0047] The results are as follows Figure 1-4 As shown in Tables 1-4, all samples had no toxic side effects on human keratinocytes and significantly enhanced cell viability. However, at a high concentration of 1000 mg / L, feruloylceramide (feruloyl phytosphingosine 104.3%, feruloyl sphingosine 113.2%, feruloyl dihydrosphingosine 127.10%) had a higher effect on cell viability than ferulic acid (87.57%). Compared with ferulic acid, feruloylceramide can be added and used at higher concentrations in cosmetics.

[0048] Example 3 Cell scratch assay to detect the effect of compounds on promoting cell migration The cell scratch test is an in vitro test method for studying cell migration. When keratinocytes grow to a fused monolayer state, a blank area (scratch) is artificially created on the fused monolayer of cells. The cells at the edge of the scratch will gradually enter the blank area to heal the "scratch", simulating the migration process of epidermal keratinocytes to a certain extent. By observing the state of cells in the scratch area at different times, the migration ability of cells can be judged. It is an important method in in vitro experiments to study skin wound healing and repair.

[0049] Steps: 1. Marking the culture plate. First, use a marker pen and a ruler to evenly mark horizontal lines on the back of the 6-well plate, approximately every 0.5-1 cm, across the holes, with at least 5 lines in each hole.

[0050] 2. Add about 5×10 5 The inoculation principle was to achieve 100% confluence after overnight culture.

[0051] 3. Cell streaking: After 24 hours, use a micropipette tip to scratch the monolayer of adherent cells perpendicular to the cell plane along the line previously scratched on the back of the plate (use the same tip between different wells) to create a scar model.

[0052] 4. Wash the cells. After the scratching is completed, wash the cells three times with sterile PBS to remove the cells that are not attached to the wall, that is, the cells that were scratched during the streaking process, and then replace with fresh serum-free culture medium.

[0053] 5. Cell culture and observation. The samples (feruloyl phytosphingosine, feruloyl sphingosine, feruloyl dihydrosphingosine and ferulic acid) were diluted with DMEM medium (concentration of 15.625 mg / L) and added to the cell culture dish. The cells were placed in a 37°C, 5wt% CO 2The cells were cultured in an incubator and taken out after 24 hours. The scratch area was observed and measured under a microscope and photographed. The control group was a DMEM culture medium without adding samples.

[0054] like Figure 5 As shown (the unit in the figure is mm 2 It does not represent the actual area, but the numbers can represent the relative change of the area). Compared with the control group, the scratch area of ​​the experimental group was reduced, indicating that feruloyl phytosphingosine, feruloyl sphingosine, feruloyl dihydrosphingosine and ferulic acid have the ability to promote the healing of keratinocytes (skin tissue) and have obvious repair effects on cell damage. Compared with ferulic acid, the scratch area of ​​feruloyl phytosphingosine, feruloyl sphingosine and feruloyl dihydrosphingosine is more significantly reduced, and they have a better healing rate for cells. It can be seen that feruloyl ceramide has better potential to enhance the skin barrier and promote wound healing.

[0055] Example 4 Elastase inhibition test Elastase can degrade collagen, elastin and other proteins. The degradation of elastin in skin tissue by elastase is closely related to the occurrence of skin aging. Counteracting the degradation of elastin by elastase and restoring skin elasticity are important ways to delay skin aging.

[0056] The elastase reaction substrate N-succinyl-L-alanyl-L-alanyl-L-alanine 4-nitroanilide was dissolved in 0.1 mol / L Tis-HCl buffer solution at pH 8.0 to a concentration of 1.015 mmol / L as the substrate working solution. 130 μL of substrate working solution and 10 μL of samples of different concentrations (feruloyl phytosphingosine, feruloyl sphingosine, feruloyl dihydrosphingosine and ferulic acid) were added to a 96-well plate, mixed on a shaker, and then 15 μL of 0.5 U of elastase was added. The plate was continued to react at room temperature for 30 min, and then the absorbance at 410 nm was measured. 0.015 mM EGCG was used as a positive control. Elastase inhibition rate = (A 3 -A 1 +A 2 ) / A 3 ×100%. 1 A is the absorbance value of the sample and enzyme system; 2 A is the absorbance value of the system with sample but no enzyme; 3 It is the absorbance value of the enzyme system without sample.

[0057] The results are as follows Figure 6-9As shown, at the concentrations of 3.90625 mg / L, 7.8125 mg / L, 15.625 mg / L and 31.25 mg / L, the inhibition rates of feruloyl phytosphingosine on elastase were 18.87%, 22.02%, 25.93% and 29.31%; the inhibition rates of feruloyl sphingosine on elastase were 23.20%, 28.40%, 30.82% and 33.05%; the inhibition rates of feruloyl dihydrosphingosine on elastase were 22.03%, 24.54%, 27.30% and 31.59%; the inhibition rates of ferulic acid on elastase were 18.48%, 22.71%, 25.51% and 28.0%.

[0058] Feruloyl phytosphingosine, feruloyl sphingosine, feruloyl dihydrosphingosine and ferulic acid all had significant inhibitory effects on elastase at different concentrations. Overall, the inhibitory effect of ferulic acid on elastase was not as good as that of feruloyl ceramide.

[0059] Example 5 Collagen Col-I activity detection HFF-1 cells were cultured at 1×10 6 The cells were seeded at a density of 1000 cells / well in a 6-well plate and in an atmosphere of 5% CO 2 , 37℃ incubator overnight. After 24 h, the supernatant was discarded, and 100 μL of culture medium containing samples of different concentrations (ceramide NP, feruloyl sphingosine, feruloyl dihydrosphingosine and ferulic acid) was added. The blank control group was DMEM culture medium without drugs, and 0.025 mM ECG was used as a positive control. After 24 h of administration, three replicates were set up in each group, and the expression of Col-I was detected by Col-I kit, total RNA was extracted, and RNA was reverse transcribed into cDNA, and quantified by fluorescence quantitative PCR instrument.

[0060] Primer sequences: Col1a1-F (SEQ1): CGATGGATTCCCGTTCGAGT Col1a1-R (SEQ2):GAGGCCTCGGTGGACATTAG The results are as follows Figure 10-13As shown, the relative mRNA expression of Col-I in the blank control group was set to 101.00%, and that in the positive control group was 103.30%. At concentrations of 3.90625 mg / L, 7.8125 mg / L, 15.625 mg / L, and 31.25 mg / L, the relative expression of Col-I of ceramide NP was 88.90%, 95.93%, 97.64%, and 99.02%; the relative expression of Col-I of feruloyl sphingosine was 107.20%, 118.20%, 117.50%, and 124.90%; the relative expression of Col-I of feruloyl dihydrosphingosine was 106.60%, 114.60%, 117.60%, and 122.90%; and the relative expression of Col-I of ferulic acid was 98.16%, 98.20%, 103.20%, and 103.00%.

[0061] The content of collagen Col-I is closely related to the elasticity and toughness of the skin. Feruloylceramide can increase the expression of Col-I and improve the elasticity and toughness of the skin. The higher the concentration of feruloylceramide, the more significant the improvement of Col-I content, and the more obvious the improvement of skin elasticity and toughness. Among them, feruloylsphingosine and feruloyldihydrosphingosine are significantly better than ferulic acid and ceramide NP in increasing the content of Col-I.

[0062] Example 6 Using LPS-induced cell method to detect the anti-inflammatory and repair effects of compounds Interleukin 6 (IL-6) is the most typical cytokine associated with inflammation. It plays an important role in host defense by regulating immune and inflammatory responses. Inflammation affects the skin barrier, increases epidermal water loss, and affects the growth of keratinocytes. Once the barrier is damaged, it is difficult to recover. At the same time, it also decomposes the extracellular matrix, causing skin collapse, while inhibiting collagen synthesis, making the skin loose and wrinkled. Therefore, it is crucial to effectively reduce the production of interleukin IL-6 in keratinocytes and fibroblasts caused by external damage and ultraviolet rays, and reduce inflammatory responses, to restore the skin barrier and protect skin elasticity and stability.

[0063] RAW macrophages were cultured at a density of 1×10 4 The cells were seeded in 96-well plates and placed in an incubator overnight. After 24 h, the supernatant was discarded and 100 μL of samples (feruloyl phytosphingosine, feruloyl sphingosine, feruloyl dihydrosphingosine, and ferulic acid) diluted in DMEM medium were added. 40 μM quercetin was used as the positive control group, and the blank control group was DMEM medium without samples. Each group had 3 replicates and was incubated in 5 wt% CO. 2, and incubated at 37°C. Two hours after administration, 10 μg / mL LPS was added to the lipopolysaccharide model group and the experimental group and incubated together for 24 hours. After the reaction, 50 μL of the cell supernatant was taken and the intracellular IL-6 factor expression was detected using an IL-6 ELISA kit.

[0064] The results are as follows Figure 14-17 As shown, the IL-6 expression of the blank control group was set to 0.00. Under the stimulation of LPS at a working concentration of 10 μg / mL, the IL-6 level was 1.24, and the IL-6 level of the positive control group was 0.65. At the concentrations of 7.8125 mg / L, 15.625 mg / L, and 31.25 mg / L, the relative mRNA expression of IL-6 of feruloyl phytosphingosine was 0.85, 0.82, and 0.89, respectively; the relative mRNA expression of IL-6 of feruloyl sphingosine was 0.85, 0.82, and 0.73, respectively; the relative mRNA expression of IL-6 of feruloyl dihydrosphingosine was 0.82, 0.73, and 0.70, respectively; and the relative mRNA expression of IL-6 of ferulic acid was 0.96, 0.86, and 0.72, respectively. Co-incubation of cells with feruloylceramide, ferulic acid and IL-6 has a significant inhibitory effect on the inflammatory factor IL-6 and can significantly reduce the expression of IL-6 inflammatory factors in cells. The feruloylceramide of the present application has good anti-inflammatory and soothing effects.

[0065] Example 7 Light aging test MMP1, also known as interstitial collagenase and matrix metalloproteinase, belongs to the matrix metalloproteinase family. Its main substrate is fibrous collagen, which can degrade collagen fibers and gelatin in the extracellular matrix and change the cell microenvironment. MMP1 plays an important role in elastin. Inhibition of MMP1 can increase the synthesis of collagen and elastin in fibroblasts, and reduced MMP activity can increase the rate of collagen synthesis. After ultraviolet radiation, keratinocytes promote the increase of MMP1 expression in fibroblasts, thereby causing degradation of the skin extracellular matrix and skin collagen, leading to skin photoaging.

[0066] HFF-1 cells were cultured at 1×10 5 The cells were seeded at a density of 100 μL / well in a 96-well plate and incubated overnight in an incubator. After 24 h, the supernatant was discarded and 100 μL of culture medium containing samples of different concentrations (feruloyl phytosphingosine, feruloyl sphingosine, feruloyl dihydrosphingosine, feruloyl-6-hydroxy-sphingosine, and ceramide NP) was added. No drug was added to the model group, and the blank control group was a DMEM culture medium without drug. Each group had 3 replicates and was incubated in an incubator with a mass fraction of 5% CO. 2After incubation at 37°C for 4 h, the experimental group and the model group were irradiated with UVA or UVB. The distance between the UV radiation source and the cells was 15 cm, and the UVA or UVB intensity was 200 mJ / cm 2 The irradiation time was 1.0 h. After the irradiation, the cells were incubated in the incubator for 24 h. The MMP-1 ELISA kit was used to detect the expression of MMP-1 gene in the cells.

[0067] The results of the inhibition of MMP-1 overexpression caused by UVA are as follows Figure 18-Figure 22 As shown, the expression level of MMP1 in the blank control group was set to 1.00, and the expression level in the model group was 2.45. At the concentrations of 7.8125 mg / L, 15.625 mg / L, and 31.25 mg / L, the expression levels of MMP1 of feruloyl phytosphingosine were 1.65, 1.46, and 1.21; the expression levels of MMP1 of feruloyl sphingosine were 2.05, 1.63, and 1.06; the expression levels of MMP1 of feruloyl dihydrosphingosine were 2.09, 1.57, and 1.17; the expression levels of MMP1 of feruloyl-6-hydroxy-sphingosine were 1.95, 1.55, and 1.14; and the expression levels of MMP1 of ceramide NP were 2.18, 1.75, and 1.34. The higher the concentration, the more significant the inhibitory effect of feruloyl phytosphingosine, feruloyl sphingosine, feruloyl dihydrosphingosine and feruloyl-6-hydroxy-sphingosine on MMP1; and the inhibitory effect is significantly better than that of ceramide NP.

[0068] The results of the inhibition of MMP-1 overexpression caused by UVB are as follows Figure 23-Figure 27 As shown, the expression level of MMP1 in the blank control group was set to 1.03, and the expression level in the model group was 2.63. At the concentrations of 7.8125 mg / L, 15.625 mg / L, and 31.25 mg / L, the expression levels of MMP1 of feruloyl phytosphingosine were 2.26, 1.93, and 1.46; the expression levels of MMP1 of feruloyl sphingosine were 2.03, 1.68, and 1.13; the expression levels of MMP1 of feruloyl dihydrosphingosine were 1.94, 1.56, and 1.07; the expression levels of MMP1 of feruloyl-6-hydroxy-sphingosine were 1.61, 1.27, and 1.02; and the expression levels of MMP1 of ceramide NP were 2.04, 1.53, and 1.36. The higher the concentration, the more significant the inhibitory effect of feruloyl phytosphingosine, feruloyl sphingosine, feruloyl dihydrosphingosine and feruloyl-6-hydroxy-sphingosine on MMP1; the inhibitory effect of feruloyl phytosphingosine, feruloyl dihydrosphingosine and feruloyl-6-hydroxy-sphingosine is better than that of ceramide NP.

[0069] Feruloyl phytosphingosine, feruloyl sphingosine, feruloyl dihydrosphingosine and feruloyl-6-hydroxy-sphingosine can inhibit the production of MMP1 by fibroblasts induced by ultraviolet radiation, and have a certain effect on preventing skin photoaging. Compared with ceramide NP, feruloyl phytosphingosine, feruloyl sphingosine, feruloyl dihydrosphingosine and feruloyl-6-hydroxy-sphingosine significantly inhibited the overexpression of MMP-1 caused by UV, showing a significant dose relationship.

[0070] Example 8 Whitening activity test B16 cells in the exponential growth phase were taken and digested with 0.25% trypsin-EDTA and pipetted evenly. The cells were plated at 3×10 5 The cells were seeded at a density of 100 / well in a 12-well plate. 2 The supernatant was discarded, and culture medium containing samples of different mass concentrations (ceramide NP, feruloyl sphingosine, feruloyl dihydrosphingosine, feruloyl-6-hydroxy-sphingosine) was added. The blank control group was incubated with RPMI-1640 medium without samples, and the model group was incubated with DMEM medium. 15 mg / L arbutin was used as the positive control. Each group had 3 replicates. In the mass fraction of 5% CO 2 , incubate at 37℃ for 24h. Discard the culture medium in the well plate, wash once or twice with phosphate buffered saline (PBS), add 1mL of NaOH solution (1mol / L) containing 10% DMSO by mass to lyse the cells, and keep at 80℃ or 100℃ for 2h until the cells are completely dissolved. Place in an ELISA reader and measure the absorbance at 405nm. Calculate the melanin inhibition rate = 1-(OD value of each well / OD value of the model group) × 100%.

[0071] like Figure 28-Figure 31As shown, the melanin content of the blank control group was set to 99.42%, the melanin expression of the model group was 162.70%, and the melanin expression of the positive control group was 60.90. When the concentrations were 3.90625 mg / L, 7.8125 mg / L, 15.625 mg / L, and 31.25 mg / L, the melanin expression of ceramide NP was 118.90%, 105.30%, 97.79%, and 95.50%, respectively; the melanin expression of feruloyl sphingosine was 115.80%, 95.13%, 79.05%, and 81.80%, respectively; the melanin expression of feruloyl dihydrosphingosine was 131.40%, 110.00%, 87.26%, and 80.10%, respectively; the melanin expression of feruloyl-6-hydroxy-sphingosine was 112.90%, 89.94%, 77.32%, and 68.86%, respectively. Feruloyl sphingosine, feruloyl dihydrosphingosine and feruloyl-6-hydroxy-sphingosine all showed good whitening effects, among which feruloyl sphingosine and feruloyl-6-hydroxy-sphingosine were significantly better than ceramide NP at all concentrations, and feruloyl dihydrosphingosine was better than ceramide NP at high concentrations.

[0072] Example 9 Photostability test Ferulic acid, feruloyl phytosphingosine, feruloyl dihydrosphingosine, feruloyl sphingosine, and feruloyl-6-hydroxy-sphingosine were prepared into 2% solutions with methanol, placed under sunlight, and tested with reference substances on the 0th, 7th, 15th, and 30th days. The content trends of the results are shown in Tables 5 and Fig.32 As shown (AWS refers to ferulic acid, FEC (P) refers to feruloyl phytosphingosine, FEC (G) refers to feruloyl dihydrosphingosine, FEC (S) refers to feruloyl sphingosine, and FEC (H) refers to feruloyl-6-hydroxy-sphingosine).

[0073] Table 5: Light stability test results

[0074] Compared with ferulic acid, feruloylceramide is more stable to light. After being exposed to sunlight for 30 days, its content has hardly changed, making it more suitable for addition and use in cosmetics.

[0075] Example 10 Enhanced skin immune barrier test Human β-defensin 2 is the first discovered defensin with inducible expression. It is mainly derived from skin keratinocytes and mucosal epithelial cells. It plays an important role in the inherent immune function of the skin and mucous membranes, and has strong killing activity against bacteria, fungi, viruses and other microorganisms.

[0076] HaCaT cells were cultured at a rate of 1×10 6 The cells were seeded at a density of 100 μg / well in a 6-well plate and incubated at 37°C and 5% CO 2 Incubate overnight in an incubator. After 24 hours, the culture medium was discarded and 1 mL of samples (ceramide NP, feruloyl phytosphingosine, feruloyl sphingosine, feruloyl dihydrosphingosine, feruloyl-6-hydroxy-sphingosine) solutions of different concentrations were added. The blank control group was DMEM medium without drugs, the positive control was 30 μM quercetin, and the model group was 10 μg / mL LPS. LPS was added 1 hour after pre-protection to a final concentration of 10 μg / mL. After 24 hours of administration, total RNA was extracted, reverse transcribed into cDNA, and quantified by fluorescence quantitative PCR.

[0077] Primer sequences: hBD-2-F(SEQ3):CCAGCCATCAGCCATGACGGT hBD-2-R(SEQ4):GGAGCCCTTTCTGAATCCGCA The expression of human β-defensin 2 in the blank control group was set to 3.39%, the expression of human β-defensin 2 in the model group was 101.1%, and the expression of human β-defensin 2 in the positive control group was 274.3. At concentrations of 3.90625 mg / L, 7.8125 mg / L, and 15.625 mg / L, the expression levels of human β-defensin 2 of ceramide NP were 133%, 186%, and 232%, respectively; the expression levels of human β-defensin 2 of feruloyl phytosphingosine were 146%, 224%, and 305%, respectively; the expression levels of human β-defensin 2 of feruloyl sphingosine were 152%, 248%, and 340%, respectively; the expression levels of human β-defensin 2 of feruloyl dihydrosphingosine were 141%, 236%, and 317%, respectively; and the expression levels of human β-defensin 2 of feruloyl-6-hydroxy-sphingosine were 155%, 217%, and 324%, respectively. Feruloyl phytosphingosine, feruloyl sphingosine, feruloyl dihydrosphingosine and feruloyl-6-hydroxy-sphingosine all showed good effects in enhancing the expression of human β-defensin 2, and were significantly better than ceramide NP at all concentrations.

[0078] Embodiment 11 Preparation Example 1: Application of feruloyl dihydrosphingosine in Class II medical dressing (liquid type) First, 0.5 parts (all parts by weight) of feruloyl dihydrosphinganine and 5 parts of oil (2 parts of hexyldecanol, 2 parts of caprylic / capric triglyceride, 1 part of tocopheryl acetate) are heated and dissolved uniformly at 90-100°C, and then mixed with 86 parts of purified water, 5 parts of glycerin, 2 parts of hydrogenated lecithin, 1 part of polyglycerol-10 myristate, and 0.2 parts of methylparaben. After emulsification and high-pressure homogenization, the mixture is cooled and then mixed with 0.1 parts of sodium hyaluronate, 0.1 parts of collagen, and 0.1 parts of carbomer. Finally, the mixture is sterilized to prepare a medical dressing (liquid type) containing feruloyl dihydrosphinganine.

[0079] Preparation Example 2: Application of feruloylsphingosine in Class II medical dressing (liquid type) First, 0.1 parts (all parts by weight) of feruloylsphingosine and 1 part of hexyldecanol are heated and dissolved uniformly at 90-100°C, and then mixed with 92.4 parts of purified water, 5 parts of 1,3-propylene glycol, 1 part of cyclodextrin, and 0.2 parts of methylparaben. After cooling, the mixture is mixed with 0.1 parts of sodium hyaluronate, 0.1 parts of collagen, and 0.1 parts of xanthan gum. Finally, the mixture is sterilized to prepare a medical dressing (liquid type) containing feruloylsphingosine.

[0080] The above is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any changes or substitutions that can be easily thought of by a person skilled in the art within the technical scope disclosed by the present invention should be included in the protection scope of the present invention. Therefore, the protection scope of the present invention should be based on the protection scope of the claims.

Claims

1. Use of feruloylceramide in preparing skin care products.

2. The use according to claim 1, characterized in that The use relates to use in preparing cosmetics, health products, medical devices or medicines for tissue healing and / or repairing skin barriers.

3. The use according to claim 1, characterized in that The use relates to use in preparing anti-aging cosmetics, health products, medical devices or medicines.

4. The use according to claim 3, characterized in that The anti-aging performance is to inhibit elastase and / or promote collagen expression and / or inhibit photoaging and / or inhibit interstitial collagenase.

5. The use according to claim 1, characterized in that: The use relates to use in preparing cosmetics, health products, medical devices or medicines for anti-inflammatory purposes.

6. The use according to claim 5, characterized in that The anti-inflammatory effect is manifested by inhibiting the expression of IL-6.

7. The use according to claim 1, characterized in that The use relates to use in preparing cosmetics, health products, medical devices or medicines for whitening.

8. The use according to claim 7, characterized in that The whitening is manifested by inhibiting the expression of melanin.

9. The use according to claim 1, characterized in that The use relates to use in preparing cosmetics, health products, medical devices or medicines for enhancing the skin immune barrier.

10. The use according to claim 7, characterized in that The enhancement of the skin immune barrier is to promote the expression of human β-defensin 2.

Images