Genetic engineering strain for producing ergothioneine and construction method thereof

Abstract

The invention discloses a genetic engineering strain for producing ergothioneine and a construction method of the genetic engineering strain, and belongs to the technical field of genetic engineering. According to the genetically engineered bacterium, escherichia coli serves as a host, a Trichoderma reesei-derived Tregt1 gene and a Trichoderma reesei-derived Tregt2 gene are subjected to heterologous expression, a DsbA tag gene or a GST tag gene is added in front of the Trichoderma reesei-derived Tregt1 gene, and 5 amino acids or 6 amino acids are truncated at the C end of the Trichoderma reesei-derived Tregt2 gene. The yields of the recombinant strains E17 and E18 after fermentation in a shake flask for 72 hours respectively reach 193.40 mg / L and 201.27 mg / L, and compared with E1, the yields of the recombinant strains E17 and E18 are respectively improved by 186% and 198%. The recombinant strain E20 is subjected to fermentation production in a 5L fermentation tank, and the yield reaches 2331.58 mg / L within 80 hours.

Description

Technical Field

[0001] The invention relates to a genetic engineering strain for producing ergothioneine and a construction method thereof, and belongs to the technical field of genetic engineering. Background Art

[0002] Ergothioneine (ERG) is a sulfur-containing amino acid isolated from ergot fungi. Its molecular structure contains an imidazothiazole ring and a thiol hydroxyl group, and is a thiol compound extended from histidine. Ergothioneine has strong acid-base stability and high redox potential, which gives it good antioxidant and metal chelating ability. It is not prone to self-oxidation and is more stable than other thiol antioxidants. Therefore, it is widely used in different industries such as food, cosmetics and medical care as an antioxidant, detoxifier, neuroprotectant, immunomodulator, etc.

[0003] Ergothioneine is mainly found in fungi, bacteria and mammals. Human tissues and organs such as red blood cells, bone marrow, liver and eyes also contain ergothioneine. However, the human body cannot synthesize it on its own and can only obtain it through diet. Mushrooms are the main dietary source.

[0004] Ergothioneine can be obtained by biological extraction, chemical synthesis and biosynthesis. Due to the disadvantages of the first two methods, such as difficulty in synthesis and large environmental pollution, it is urgent to construct a genetically engineered strain of Escherichia coli that can efficiently synthesize ergothioneine. Ergothioneine has different synthesis pathways in bacteria, fungi and anaerobic bacteria. The most widely studied ones are the five-step reaction synthesis pathway catalyzed by the egtABCDE gene cluster in prokaryotes and the three-step reaction synthesis pathway catalyzed by the egt1 and egt2 genes in eukaryotes. At present, there are many studies on the five-step reaction synthesis pathway catalyzed by the egtABCDE gene cluster in Escherichia coli. Although the yield can reach a relatively high level, due to the long metabolic pathway, the by-products produced in the synthesis pathway are more, which brings certain difficulties to the later purification process; and due to the long metabolic pathway, the recombinant strain has a relatively high demand for energy. The three-step reaction synthesis pathway catalyzed by egt1 and egt2 genes not only eliminates the participation of L-glutamate, but also uses L-cysteine ​​as a sulfur source, thereby eliminating the intermediate γ-glutamylcysteine, getting rid of the biosynthetic competition between ergothioneine and glutathione, thereby improving the biosynthesis efficiency of ergothioneine and reducing energy loss. Summary of the invention

[0005] In view of the above problems in the prior art, the present invention provides an engineering strain for synthesizing ergothioneine, which uses Escherichia coli as a host, heterologously expresses Tregt1 gene and Tregt2 gene from Trichoderma reesei, and on this basis, genetically modifies the strain for efficient synthesis of ergothioneine.

[0006] The present invention is achieved through the following technical solutions:

[0007] The first object of the present invention is to provide a genetically engineered bacterium for producing ergothioneine, wherein the genetically engineered bacterium uses Escherichia coli as a host, heterologously expresses Tregt1 gene and Tregt2 gene from Trichoderma reesei, adds a DsbA tag gene in front of the Tregt1 gene, and truncates 5 amino acids or 6 amino acids at the C-terminus of the Tregt2 gene.

[0008] In one embodiment of the present invention, the nucleotide sequence of the Tregt1 gene is shown as SEQ ID NO.1, and the nucleotide sequence of the Tregt2 gene is shown as SEQ ID NO.2.

[0009] In one embodiment of the present invention, the nucleotide sequence of the DsbA tag gene is shown in SEQ ID NO.3.

[0010] In one embodiment of the present invention, the genetically engineered bacteria heterologously express Tregt1 gene and Tregt2 gene using pRSF as a vector.

[0011] In one embodiment of the present invention, the Escherichia coli is Escherichia coli BL21 (DE3).

[0012] A second object of the present invention is to provide a method for constructing a genetically engineered bacterium producing ergothioneine, comprising the steps of:

[0013] S1. Add the DsbA tag gene in front of the Tregt1 gene to obtain the DsbA-Tregt1 gene fragment, and truncate the Tregt2 gene to obtain Tregt2 1-465AA Tregt2 1-464AA Gene fragments;

[0014] S2. DsbA-Tregt1 gene fragment and Tregt2 1-465AA Tregt2 1-464AA The gene fragment was connected to the vector pRSF to obtain the vector pRSF-DsbA-Tregt1-Tregt2 1-465AA or pRSF-DsbA-Tregt1-Tregt2 1-464AA ;

[0015] S3. Insert the vector pRSF-DsbA-Tregt1-Tregt2 1-465AA or pRSF-DsbA-Tregt1-Tregt2 1-464AA The gene is transformed into an Escherichia coli host to obtain the genetically engineered bacteria.

[0016] In one embodiment of the present invention, the construction method also includes the step of transforming the Escherichia coli host, specifically, knocking out the SdaA, YhaM, TnaA, TolC, PykA, YjeH, and PurR genes on the genome of Escherichia coli BL21 (DE3), and overexpressing the CysM, CysE*, MetK, Prs, and HisG* genes on the genome to obtain the Escherichia coli host.

[0017] The third object of the present invention is to provide a production method of thioneine, wherein the method comprises the step of adopting the genetically engineered bacteria to ferment and culture to produce thioneine.

[0018] In one embodiment of the present invention, the method comprises the following steps: placing a monoclone of the genetically engineered bacteria in an LB test tube containing kanamycin, and culturing at 35-38°C and 150-250rpm for 10-15h; then transferring to a fermentation medium, culturing at 35-38°C and 150-250rpm for 2-3h, adding IPTG to a final concentration of 0.1-0.5mM to start induction, and fermenting and culturing at 22-28°C and 150-250rpm for 48h-72h.

[0019] In one embodiment of the present invention, the method comprises the following steps: after culturing the bacterial strain on a plate, inoculating it into an LB medium containing antibiotics, and culturing it at 35-38°C and 150-250rpm for 6-8h to obtain a seed solution; inoculating the seed solution into a fermentation tank containing a fermentation medium, culturing the fermentation liquid at 35-38°C until the OD600 reaches 20-25, adding IPTG with a final concentration of 0.1-0.5mM, and adjusting the temperature to 22-28°C for 60-80h; during the fermentation process, maintaining the pH value at 6.5-7.5 by adding ammonia water, maintaining the dissolved oxygen at 25%-35% by adjusting the stirring speed and ventilation volume, and when the initial glucose in the fermentation medium is exhausted, adding 70-90% glucose solution to maintain the glucose concentration at 0-1g / L.

[0020] In one embodiment of the present invention, the fermentation medium is: 15-25 g / L glucose, 3-5 g / L peptone, 5-7 g / L yeast extract, 0.8-1.2 g / L NaCl, 3-5 g / L KH2PO4, 0.8-1.2 g / L MgSO4·7H2O, 5-7 g / L (NH4)2SO4, 20-30 g / L Na2HPO4·12H2O, 0.4-0.6 g / L MnSO4·H2O, 0.4-0.6 g / L Na2MoO4·H2O, 0.4-0.6 g / L FeSO4·7H2O, 0.008-0.012 g / L CaCl2, 1-3g / L citric acid, 0.4-0.6g / L betaine, 0.4-0.6g / L histidine, 1-2g / L methionine, 1-2g / L cysteine, 0.1-0.3g / L VB6, 0.1-0.3g / L VB12 and 0.008-0.012g / L VH.

[0021] In the subsequent strain transformation process of the present invention, Escherichia coli BL21 (DE3) is also included in the chassis transformation, SdaA, YhaM, TnaA, TolC, PykA, YjeH, PurR genes on the Escherichia coli BL21 (DE3) genome are knocked out, and CysM, CysE*, MetK, Prs, HisG* genes are overexpressed on the genome. The plasmid pRSF-DsbA-Tregt1-Tregt2 carried by the E18 strain with the best effect of improving the ergothioneine yield obtained by the present invention is obtained. 1-464AA In the Escherichia coli of chassis transformation, 347.32mg / L thioneine output was achieved. Further culture medium optimization was carried out for thioneine production approach, and the strain shake flask fermentation achieved 430.89mg / L thioneine output. The present invention can also be further cultured in fermenter, and the fermentation condition and culture medium of fermenter are optimized, and the output of thioneine in fermenter is improved.

[0022] Beneficial effects of the present invention:

[0023] The recombinant strain E1 can achieve heterologous synthesis of ergothioneine in Escherichia coli, but its 72h production is only 67.53mg / L. Compared with E1, the Tregt1 gene can significantly increase the production of ergothioneine after adding the DsbA tag and the TrxA tag. Among them, the effect of increasing the production of ergothioneine is the best after adding the DsbA tag. The yields of the recombinant strains E2 and E6 after 72 hours of shake flask fermentation were 139.46 mg / L and 107.13 mg / L, respectively. It can be seen that adding the DsbA tag gene before the Tregt1 gene can significantly increase the yield of ergothioneine in Escherichia coli; truncating Tregt2 by 15 amino acids and 16 amino acids at the N-terminus and 5 amino acids and 6 amino acids at the C-terminus can significantly increase the yield of ergothioneine. The yields of the recombinant strains E8, E9, E11 and E12 after 72 hours of shake flask fermentation were 141.62 mg / L, 112.62 mg / L, 112.09 mg / L and 149.68 mg / L, respectively, which can significantly increase the yield of ergothioneine in Escherichia coli. After the two were combined, the yields of recombinant strains E17 and E18 reached 193.40 mg / L and 201.27 mg / L in shake flask fermentation for 72 hours, respectively, which were 186% and 198% higher than E1. The recombinant strain E20 was fermented in a 5L fermenter and the yield reached 2331.58 mg / L in 80 hours. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0025] Figure 1 The expression vectors are pRSF-Tregt1-Tregt2, pRSF-DsbA-Tregt1-Tregt2, pRSF-DsbC-Tregt1-Tregt2, pRSF-DsbG-Tregt1-Tregt2, pRSF-NT11-Tregt1-Tregt2, pRSF-TrxA-Tregt1-Tregt2, pRSF-GST-Tregt1-Tregt2, pRSF-Tregt1-Tregt2 15-470AA , pRSF-Tregt1-Tregt2 16-470AA , pRSF-Tregt1-Tregt2 17-470AA , pRSF-Tregt1-Tregt2 15-464AA , pRSF-Tregt1-Tregt21-465AA , pRSF-Tregt1-Tregt2 1-464AA , pRSF-Tregt1-Tregt2 1-463AA , pRSF-Tregt1-Tregt2 15-464AA , pRSF-DsbA-Tregt1-Tregt2 15-470AA , pRSF-DsbA-Tregt1-Tregt2 16-470AA , pRSF-DsbA-Tregt1-Tregt2 1-465AA , pRSF-DsbA-Tregt1-Tregt2 1-464AA and pRSF-DsbA-Tregt1-Tregt2 1-463AA Schematic diagram of the construction;

[0026] Figure 2 It is the HPLC test result figure of ergothioneine;

[0027] Figure 3 It is a graph of thioneine production of E1, E2, E3, E4, E5, E6 and E7 strains in shake flask fermentation for 72h;

[0028] Figure 4 It is a graph of thioneine production of E8, E9, E10, E11, E12, E13 and E14 strains after 72h of shake flask fermentation;

[0029] Figure 5 It is the ergothioneine yield graph of E15, E16, E17, E18 and E19 strains after 72h of shake flask fermentation;

[0030] Figure 6 This is the ergothioneine yield graph of E20 after 72h of shake flask fermentation;

[0031] Figure 7 This is the fermentation diagram of E20 in a 5L fermenter. DETAILED DESCRIPTION

[0032] The present invention is further described below in conjunction with specific examples. These implementation cases are only used to illustrate the present invention and are not used to limit the scope of the present invention. In addition, after reading the content taught by the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope limited by the claims attached to the application.

[0033] Culture medium:

[0034] Shake flask fermentation medium: 20 g / L glucose, 2 g / L yeast extract, 16 g / L (NH4)2SO4, 16 g / L Na2HPO4·12H2O, 3 g / L KH2PO4, 0.6 g / L MgSO4·7H2O, 0.01 g / L CaCl2 and 2% phenol red, pH adjusted to 6.8-7.0.

[0035] Optimized medium for shake flask fermentation: 20 g / L glucose, 2 g / L yeast extract, 16 g / L (NH4)2SO4, 16 g / L Na2HPO4·12H2O, 3 g / L KH2PO4, 0.6 g / L MgSO4·7H2O, 0.01 g / L CaCl2, 0.5 g / L MnSO4·H2O, 0.5 g / L Na2MoO4·H2O, 0.5 g / L FeSO4·7H2O, 2 g / L citric acid, 0.5 g / L betaine, 0.5 g / L histidine, 1.5 g / L methionine, 1.5 g / L cysteine, 0.01 g / L VB1, 0.01 g / L VB3, 0.01 g / L VB5, 0.2 g / L VB6, 0.2 g / L VB12, 0.01 g / L VH and 2% phenol red, pH adjusted to 6.8-7.0.

[0036] 5L fermentation tank medium: 20g / L glucose, 4g / L peptone, 6g / L yeast extract, 1g / L NaCl, 4g / L KH2PO4, 1g / L MgSO4·7H2O, 6g / L (NH4)2SO4, 25g / L Na2HPO4·12H2O, 0.5g / L MnSO4·H2O, 0.5g / L Na2MoO4·H2O, 0.5g / L FeSO4·7H2O, 0.01g / L CaCl2, 2g / L citric acid, 0.5g / L betaine, 0.5g / L histidine, 1.5g / L methionine, 1.5g / L cysteine, 0.01g / L VB1, 0.01g / L VB3, 0.01g / L VB5, 0.2g / L VB6, 0.2g / L VB12 and 0.01g / L VH.

[0037] HPLC analysis conditions: The chromatographic column is Thermo Hypersil GOLD aQ column; mobile phase A is ultrapure water, and mobile phase B is acetonitrile; elution is isocratic with 90% phase A and 10% phase B, flow rate is 0.6 mL / min, injection volume is 5 μL, and detection wavelength is 257 nm.

[0038] The technical solution of the present invention is described in detail below in conjunction with specific embodiments. In the following embodiments, unless otherwise specified, the reagents, materials and equipment used can be purchased from commercial sources, or prepared by conventional methods, or are commonly used in the industry.

[0039] Embodiment 1:

[0040] 1. The Tregt1 gene (GenBank: XM_006968558.1), Tregt2 gene (GenBank: XM_006968673.1) and NT11 tag sequence (GTTTCTGAACCGCACGACTACAACTACGAAAAAG) from Trichoderma reesei were selected. The three gene sequences were synthesized by Jiutian Gene Technology (Tianjin) Co., Ltd. After codon optimization, Tregt1 and Tregt2 were obtained to obtain the gene sequences shown in SEQ ID NO.1 and SEQ ID NO.2, which were used as templates for subsequent gene cloning.

[0041] SEQ ID NO.1:

[0042] ATGGCGCTCAAGTCAGCCACGACCACGACTACCACCACACAGAGGGCGCTCGACATCATCGACATTC

[0043] AGAATGCGCGAATCGAGGTCAACCTCAAGGACGAGATCCTTGCCCAGATGAATCCCGAGCAGGGCCC

[0044] CCGCACGCTGCCCACGCTGCTGCTCTATGACGAGCGCGGCCTGCAGCTGTTTGAAGAAATCACGTATC

[0045] TGGACGAATACTACCTGACCAACTACGAGATTGAGCTCCTGAAGAAATCGGCAGCCGAAATGGCCAG

[0046] CCAGATCCCCGAGGGAGCAATTGTGGTGGAGCTGGGCAGCGGAAAACCTGCGCAAAGTCTGCCTCCTC

[0047] CTGCAGGCGTTTGAAGATGCCAAGAAGAAGATTGACTACTTCGCGCTCGACCTGTCCCAGAAGGAGC

[0048] TCGAGCGCACGCTGGCCGAGGCGCCCGTCTTTGAGTACGTGAGCTGCCGGGGCCTGCGAGGGACGTA

[0049] TGACGACGGGTGCGAGTGGCTGAAGCAGGAGGCGATTCTGGCTCGGCCAAAGTGCATTTTGCACCTC

[0050] GGCTCCAGCATTGGCAACTTTACGCGCGACGAGGCGGCAGAGTTCCTGAGGTCATTTGCAGAGGTTC

[0051] TGCAGCCCTCGGATCTGATGATTGTCGGGGTTGACTCATGTCAGAACCCGGACAAGGTGTACCATGCA

[0052] TACAATGACAGCAAGGGCGTCACACATCAATTCGTCCTCAACGGCCTCACTCACGCAAACGAGGTTC

[0053] TCGGTCAGGAAGCCTTCAACGTCGAAGAGTGGCAAGTCATTGGCGAATACGTGTACGATGTCGACGG

[0054] CGGCCGTCACCAGGCCTTTGTGTCGCCTCTCGAGGTCGCCTCGGTCCTGGGACACATCATCAAGCCCC

[0055] ACGAGCGCATCAAGATTGAGCAGAGCTTCAAGTACTCTGACGTCGGCCTCGACAAGCTGTTCAAGAC

[0056] GGCCGGCCTCGTCGAGGTTGCCAAATGGAGCCGCCAGGGCGAATACGGCCTTCACATGCTCAAGAGA

[0057] GCCAAGATGCCCTTCCCCAGGCTCCGCGAGCTTTACGCCAGCGACACCCTGCCCACCTGGGCCGACT

[0058] GGGAGAACCTCTGGGCGGCCTGGGACACGGTCACCCGCAAGATGCTCCCCGACGCCGAGCTCAACG

[0059] AGAAGCCCATCAAGCTGCGCAACGCCTGCATCTTCTACCTCGGCCACATCCCGGCCTTCCTCGACATC

[0060] CAGCTCAAGAAGACGACCAAGGCCGGCGGAACCGAGCCGCTCTACTTCCACACCATCTTTGAGCGCG

[0061] GCATCGACCCGGACGTCGACAACCCGGAAAAGTGCCACGACCACTCCGAGGTCCCGGACGAGTGGC

[0062] CTCCCCTTGAGGACATCCTGAAGTATCAGGACCGCGTCCGCGAGAGACTCCGCAAGCTGTATGCCAG

[0063] CCCCGATGAGCTTGTCGGAGACGTTCGGCGCGCCGTCTGGATCGGCTTCGAGCACGAGGCGCTTCAC

[0064] CTCGAGACGCTGCTGTACATGCTGCTGCAGAGCGACAAGACGCTTCCGCCGCCGCACACGGTGGTGC

[0065] CGGACTTCCCCAAGATGGCGCAGAAGGCGTATGCCGCGCGGGTGCCGAATCAGTGGTTTGATGTCCC

[0066] GGAGCAGACGATTACCATTGGCATGGACGATCCTGAGGATGAGCACGAATCAAACCGGCACTTTGGA

[0067] TGGGACAACGAGAAGCCTGCCAGACAGGAGACTGTGCGTGCCTTTCAGGCCAAGGCCAGGCCCATC

[0068] ACCAACGAGGAGTACGCCAAGTACCTCTACTCTTCTCACATTGAGAACCTCCCGGCCTCTTGGTCGGT

[0069] CATCCCTCCCAACTATCACCACAACACCAACGCCACGACGCCCGGGAAGCCCATCTTGAGCGAGCTC

[0070] CCCGAGAGCTTCCTCCACGACAAGGCGGTGCGGACCGTCTACGGGCTGGTGCCCCTGCGCTACGCCC

[0071] TCGACTGGCCTGTCTTTGCGTCGTACGACGAGCTTGCCGGCTGCGCGGCGTGGATGGGCGGCAGGAT

[0072] CCCGACGATGGAGGAGGCCAAGAGCATCTACGCGTATGTGGAGAGGCAAAAGGATATTGCCAAGCAG

[0073] AGCAAGCTCTCCAACAAGCAAGAGACGCTGACATCAAGCTACAGGCACCTCGTCAATGACGGCGTC

[0074] GAAGAGACTCCCCCATCCAAGCCCTCCCCGGCCTCCCTCTTCGTCGACCTCAGCACAACCAACACCG

[0075] GCTTCCTCCACTGGCACCCCGTCCCCGTGACCCCCAACGGCGGCTCCCTCGCCGGCCAGGCCGAGCT

[0076] GGGCGGCGTCTGGGAGTGGACGAGCTCCGTGCTGCGTCCGCACCAGGGGTTCCGCCCGATGAGCCTC

[0077] TACCCGGGCTACACGGCGGACTTCTTCGACGACAAGCACAACGTCGTGCTGGGCGGGTCCTGGGCGA

[0078] CGCATCCCCGGATTGCGGGCCGGAAGAGCTTTGTCAATTGGTATCAGAGGAATTATCTGTATGCCTGG

[0079] GTTGGGGCAAGGTTGGTGCGAGATGTTTGA

[0080] SEQ ID NO.2:

[0081] AGATCTATGGCAAGTCTGCCGGTTCGCCAGCGCGAAGAAGGTGAAGCCCGCGTGGGTGAAGATGGCT

[0082] TTAAAGTTTTTGGCGGTGAAATGAAAAAGGATTTTCTGTTTGCACCGGGCTGGACCAATCTGAATCAT

[0083] GGTAGCTATGGTACAATTCCGCGTGCAATTCAGGCCAAACTGCGCAGCTATCAGGATGATATTGAAGC

[0084] CCGTCCGGACCCTTTTATTCGCTTTGAACATGCACGTCTGACCGATGAAAGCCGCGCAGCAGTTGCAG

[0085] GCGTGCTGAATGTGCCGGTTGAAACCGTGGTTTTTGTGAATAATGCAACCGAAGGTGTGAATACCGTT

[0086] TTTCGCAATATTAAATGGGATGCCGATGGCAAAGATGTTGCCCTGTGGTTTAGCACCGTTTATGAAGCC

[0087] TGTGGCAAAGCCATTGATTTTCTGTATGATTATCACGGCGATGGCCGCCTGAGCAGTCGTGAAATTGA

[0088] AATTGCATATCCGATTGAAGATGATGAAATTCTGCGCCGTTTTCGTAGCGCCGTTGAACAGGTGCGCA

[0089] GTGAAGGCAAACGTGCAAAAATTTGTATTTTTGATGTGGTTAGCAGCCGTCCGGGTGTGGTGTTTCCG

[0090] TGGGAACGTATGGTGGCAGCCTGTCGCGAACTGGGCGTGCTGAGTCTGGTGGATGGCGCCCAGGGCA

[0091] TTGGCATGGTTCGTCTGGATCTGGGTGCAGCAGATCCGGATTTTTTTGTGAGCAATTGTCATAAATGGC

[0092] TGTTTACCCCGCGTGGTTGCGCAGTGTTTTATGTTCCGGTGCGCAATCAGCCGCTGCTGCCGAGTACC

[0093] CTGGCCACCAGTCATGGTTATGCAAGTCTGACCGGTAAACGCCGTGCACCGGCAGGCAAACATGAAG

[0094] ATGATGATAATGATGATGGTAGCCTGAAAAAAAGTGCCTTTGTGAGTAATTTTGAGTTTACCGGCACCC

[0095] GTGATTATACCCCGAATTTTTGTGTGAAAGATGCAGTTGCATATCGTCGTGATGTGCTGGGTGGCGAAG

[0096] AACGCATTCTGGAATATCTGTGGGATCTGAATAAAAAAGGTAGCCGTCTGGTGGCAGAACGTCTGGGC

[0097] ACCGAAGTGCTGGAAAATAAAGAAGGCACCCTGACCAATTGTGCCATGGCAAATATTGCAATGCCGC

[0098] TGTGGAAAGGCGAAGCAGGTAAAGAAGGCGATGTGGTGGTTCCGGAAGAAGATGGCGATCGCGTTG

[0099] TGGTTTGGATGATGAGTACCATGGCCAAAGATTATAATACCATTGTTCCGATGTTCTGGCTGGGCAAAC

[0100] GCTTTTGGGTGCGCATTAGCGCCCAGGTTTATCTGGATCTGGGCGATTATGAATATGGTGCAGAAACCC

[0101] TGAAAAAACTGATTGAACGTGTGGGTAAAGGCGAATATAAAGGTGGTCAGAAAATTTAACTCGAG

[0102] 2. According to the Tregt1 sequence shown in SEQ ID NO.1 and the Tregt2 sequence shown in SEQ ID NO.2, relevant primers were designed (Table 1), and PCR cloning and related vector construction were performed as follows:

[0103] 1) Using Tregt1 as a template, high-fidelity PCR amplification was performed using primers Tregt1-F / Tregt1-R to obtain the Tregt1 gene fragment;

[0104] Using Tregt2 as template, high-fidelity PCR amplification was performed to obtain the Tregt2 gene fragment using primers Tregt2-F / Tregt2-R;

[0105] Using Escherichia coli BL21 (DE3) as a template, primers DsbA-F / DsbA-R, DsbC-F / DsbC-R, DsbG-F / DsbG-R and TrxA-F / TrxA-R were used to amplify the DsbA tag gene, DsbC tag gene, DsbG tag gene and TrxA tag gene fragments by high-fidelity PCR.

[0106] pET42b-GST and pET42b-NT11 plasmids were constructed, and the GST and NT11 tag gene fragments were amplified by high-fidelity PCR using primers GST-F / GST-R and NT11-F / NT11-R.

[0107] 2) The gene fragments Tregt1, Tregt2, DsbA tag gene, DsbC tag gene, DsbG tag gene, NT11 tag gene, TrxA tag gene, GST tag gene fragments obtained by the above PCR, the tag sequences are shown in Table 2, and the expression vector pRSF were amplified by high-fidelity enzyme PCR to obtain sticky ends, and the PCR products Tregt1, Tregt2, DsbA, DsbC, DsbG, NT11, TrxA, GST and linearized pRSF were recovered, and the homologous recombinase Tregt1, Tregt2, DsbA, DsbC, DsbG, NT11, TrxA, GST were respectively connected to the expression vector pRSF. RSF was plated and transformed into Escherichia coli BL21 (DE3) by heat shock method. The correct positive clones were verified and sequenced, namely vectors pRSF-Tregt1-Tregt2, pRSF-DsbA-Tregt1-Tregt2, pRSF-DsbC-Tregt1-Tregt2, pRSF-DsbG-Tregt1-Tregt2, pRSF-NT11-Tregt1-Tregt2, pRSF-TrxA-Tregt1-Tregt2, and pRSF-GST-Tregt1-Tregt2. The obtained E. coli engineering strains were named E1, E2, E3, E4, E5, E6 and E7.

[0108] 3) pRSF-Tregt1-Tregt2 and pRSF-DsbA-Tregt1-Tregt2 were used as plasmid donors, and primers Tregt2 15-470AA -F / Tregt2 15-470AA -R, Tregt2 16-470AA -F / Tregt2 16-470AA -R, Tregt2 17-470AA -F / Tregt2 17-470AA -R, Tregt2 1-465AA -F / Tregt2 1-465AA -R, Tregt2 1-464AA -F / Tregt2 1-464AA -R and Tregt2 1 -463AA -F / Tregt2 1-463AA -R, according to the principle of linear plasmid sticky end self-ligation, pRSF-Tregt1-Tregt2 obtained by high-fidelity enzyme PCR amplification 15-470AA , pRSF-Tregt1-Tregt2 16-470AA , pRSF-Tregt1-Tregt2 17-470AA , pRSF-Tregt1-Tregt21-465AA , pRSF-Tregt1-Tregt2 1-464AA , pRSF-Tregt1-Tregt2 1-463AA , pRSF-Tregt1-Tregt2 15-464AA , pRSF-DsbA-Tregt1-Tregt2 15-470AA , pRSF-DsbA-Tregt1-Tregt2 16 -470AA , pRSF-DsbA-Tregt1-Tregt2 1-465AA , pRSF-DsbA-Tregt1-Tregt2 1-464AA and pRSF-DsbA-Tregt1-Tregt2 1-463AA The gene fragments were transferred into Escherichia coli BL21 (DE3) by heat shock method to obtain Escherichia coli engineering strains, and plasmids pRSF-Tregt1-Tregt2 were obtained. 15-470AA , pRSF-Tregt1-Tregt2 16-470AA , pRSF-Tregt1-Tregt2 17-470AA , pRSF-Tregt1-Tregt2 1-465AA , pRSF-Tregt1-Tregt2 1-464AA , pRSF-Tregt1-Tregt2 1-463AA , pRSF-Tregt1-Tregt2 15-464AA , pRSF-DsbA-Tregt1-Tregt2 15-470AA , pRSF-DsbA-Tregt1-Tregt2 16-470AA , pRSF-DsbA-Tregt1-Tregt2 1-465AA , pRSF-DsbA-Tregt1-Tregt2 1-464AA and pRSF-DsbA-Tregt1-Tregt2 1-463AA The expression vectors were used to obtain the engineered Escherichia coli strains, which were named E8, E9, E10, E11, E12, E13, E14, E15, E16, E17, E18 and E19.

[0109] Table 1 Related primers

[0110]

[0111] Table 2 Tag sequences

[0112]

[0113]

[0114]

[0115] Embodiment 2:

[0116] The empty vector control strain and single clones of E1, E2, E3, E4, E5, E6, E7, E8, E9, E10, E11, E12, E13, E14, E15, E16, E17, E18 and E19 strains were picked and placed in 5 mL LB test tubes containing kanamycin, placed in a 37°C shaker, and cultured at 200 rpm for 12 h; then transferred to 250 mL baffled aquarium containing 50 mL fermentation medium at a 2% inoculum. The mixture was placed in a conical flask, and 50 mg / L of kanamycin was added, and the mixture was placed in a 37° C. shaker, and shaken at 200 rpm for 2 h. IPTG was added to a final concentration of 0.2 mM to start induction, and the mixture was placed in a 25° C. shaker, and fermented at 200 rpm for 48 h to 72 h. 1 mL of the fermentation broth was taken, and the mixture was centrifuged at 10000 rpm for 10 min. The supernatant was collected, and filtered through a 0.22 μm filter membrane. The engineered strain for synthesizing ergothioneine was screened by HPLC analysis.

[0117] The results are as follows Figure 3 As shown, the recombinant strain E1 was able to achieve heterologous synthesis of ergothioneine in Escherichia coli, but its production in 72 h was only 67.53 mg / L.

[0118] The results are as follows Figure 3 As shown, the yields of recombinant strains E2, E3, E4, E5, E6 and E7 in shake flask fermentation for 72h were 139.46mg / L, 71.25mg / L, 33.43mg, 24.67mg / L, 107.13mg / L and 85.06mg / L, respectively. Compared with E1, when DsbA and TrxA tag genes were added before Tregt1 gene, the yield of ergothioneine in Escherichia coli could be significantly improved. When DsbC and GST tag genes were added before Tregt1 gene, the yield of ergothioneine did not change much. When DsbG and NT11 tag genes were added before Tregt1 gene, the yield of ergothioneine in Escherichia coli could not be improved.

[0119] The results are as follows Figure 4As shown, the yield of recombinant strains E8, E9, E10, E11, E12, E13 and E14 in shake flask fermentation 72h is 141.60mg / L, 112.62mg / L, 21.52mg / L, 112.09mg / L, 149.68mg / L, 90.72mg / L and 91.91mg / L respectively, compared with E1, when Tregt2 gene N-terminal truncated 15 amino acids, N-terminal truncated 16 amino acids, C-terminal truncated 5 amino acids, C-terminal truncated 6 amino acids, the yield of thioneine in Escherichia coli can be significantly improved, but when 15 amino acids of N-terminal truncated and 6 amino acids of C-terminal truncated are combined, the yield of thioneine does not change much.

[0120] The results are as follows Figure 5 As shown, the yields of recombinant strains E15, E16, E17, E18 and E19 in shake flask fermentation for 72 h reached 48.67 mg / L, 20.93 mg / L, 193.40 mg / L, 201.27 mg / L and 45.90 mg / L, respectively. Compared with E1, adding the DsbA tag gene before the Tregt1 gene and truncating the C-terminus of the Tregt2 gene by 5 amino acids and 6 amino acids can significantly increase the yield of ergothioneine. Among them, E18, in which the DsbA tag gene is added before the Tregt1 gene and the C-terminus of the Tregt2 gene is truncated by 6 amino acids, has the best effect on improving the yield of ergothioneine.

[0121] Embodiment 3:

[0122] The plasmid pRSF-DsbA-Tregt1-Tregt2 in E18 obtained by screening 1-464AA , and the heat shock method was used to transfer the modified Escherichia coli to obtain an Escherichia coli engineering strain, which was named E20. Among them, the Escherichia coli transformation refers to the use of CRISPR / Cas9 gene editing technology to knock out SdaA, YhaM, TnaA, TolC, PykA, YjeH, PurR in the genome, and overexpress CysM, CysE*, MetK, Prs, HisG* in the genome. The sequences or numbers are shown in Table 3.

[0123] Table 3 Gene sequence or number

[0124]

[0125] According to the culture method in Example 2, E20 was fermented in a shake flask. The results are as follows: Figure 6 As shown, the yield of the recombinant strain E20 reached 347.32 mg / L after 72 h of shake flask fermentation.

[0126] Embodiment 4:

[0127] The shake flask fermentation medium of E20 was optimized, and the optimized culture conditions were as follows:

[0128] The optimized culture medium was 20 g / L glucose, 4 g / L peptone, 6 g / L yeast extract, 1 g / L NaCl, 4 g / L KH2PO4, 1 g / L MgSO4·7H2O, 6 g / L (NH4)2SO4, 25 g / L Na2HPO4·12H2O, 0.5 g / L MnSO4·H2O, 0.5 g / L Na2MoO4·H2O, 0.5 g / L FeSO4·7H2O, 0.01 g / L CaCl2, 2 g / L citric acid, 0.5 g / L betaine, 0.5 g / L histidine, 1.5 g / L methionine, 1.5 g / L cysteine, 0.2 g / L VB6, 0.2 g / L VB12 and 0.01 g / L VH.

[0129] like Figure 6 As shown, after medium optimization, the yield of shake flask fermentation for 72 hours reached 430.89 mg / L, and the ergothioneine yield was increased by 538.07% compared with E1.

[0130] Embodiment 5:

[0131] E20 was cultured in a fermenter, and the specific steps were as follows:

[0132] 5L fermentation tank medium: 20g / L glucose, 4g / L peptone, 6g / L yeast extract, 1g / L NaCl, 4g / L KH2PO4, 1g / L MgSO4·7H2O, 6g / L (NH4)2SO4, 25g / L Na2HPO4·12H2O, 0.01g / L MnSO4·7H2O, 0.01g / L Na2MoO4·H2O, 0.01g / L FeSO4·7H2O, 0.01g / L CaCl2, 2g / L citric acid, 0.5g / L betaine, 0.5g / L histidine, 1.5g / L methionine, 1.5g / L cysteine, 0.001g / L VB1, 0.001g / L VB3, 0.001g / L VB5, 0.01g / L VB6, 0.001g / L VB12 and 0.001g / L VH.

[0133] 5L fermentation tank culture steps: inoculate the strain into an LB plate and culture overnight at 37°C, then take a loop of the strain from the plate and inoculate it into a shaking tube containing 5mL LB medium (10g / L peptone, 10g / L NaCl, 5g / L yeast extract) and corresponding antibiotics and culture overnight at 37°C, 200rpm. Then transfer it to a 250mL baffled conical flask containing LB medium containing corresponding antibiotics at a 2% inoculation rate, culture at 37°C, 200rpm, and obtain seed liquid for 6-8h. Finally, inoculate the seed culture medium into a 5L fermentation tank containing 1.5L fermentation medium at a 10% inoculation rate and culture the fermentation liquid at 37°C to OD 600 After 20-25, add isopropyl β-D-thiogalactoside (IPTG) with a final concentration of 0.2mM, adjust the temperature to 25°C, and cultivate for 75-90h. During the fermentation process, the pH value is maintained at 7 by adding 25% ammonia water (v / v), and the dissolved oxygen is maintained at 25%-35% by adjusting the stirring speed and ventilation volume. When the initial glucose in the fermentation medium is exhausted, add 80% glucose solution (w / v) to maintain the glucose concentration at 0-1g / L.

[0134] The results are as follows Figure 7 As shown, the recombinant strain E20 was fermented in a 5L fermenter and the yield reached 2331.58 mg / L in 80 hours.

[0135] The embodiments provided above are not intended to limit the scope of the present invention, and the steps described are not intended to limit the execution order thereof. Those skilled in the art may make obvious improvements to the present invention in combination with existing common knowledge, which also fall within the scope of protection defined by the claims of the present invention.

Claims

1. A genetically engineered bacterium for producing thioneine, characterized in that, The genetically engineered bacteria uses Escherichia coli as a host, heterologously expresses Tregt1 gene and Tregt2 gene from Trichoderma reesei, adds a DsbA tag gene in front of the Tregt1 gene, and truncates 5 or 6 amino acids at the C-terminus of the Tregt2 gene.

2. The genetically engineered bacterium according to claim 1, characterized in that: The nucleotide sequence of the Tregt1 gene is shown in SEQ ID NO.1, and the nucleotide sequence of the Tregt2 gene is shown in SEQ ID NO.

2.

3. The genetically engineered bacterium according to claim 1, characterized in that The nucleotide sequence of the DsbA tag gene is shown in SEQ ID NO.

3.

4. The genetically engineered bacterium according to any one of claims 1 to 3, characterized in that The genetically engineered bacteria heterologously express Tregt1 gene and Tregt2 gene using pRSF as a vector.

5. The genetically engineered bacterium according to any one of claims 1 to 3, characterized in that The Escherichia coli is Escherichia coli BL21 (DE3).

6. A method for constructing a genetically engineered bacterium for producing ergothioneine according to any one of claims 1 to 5, characterized in that: The steps include: S1. Add the DsbA tag gene in front of the Tregt1 gene to obtain the DsbA-Tregt1 gene fragment, and truncate the Tregt2 gene to obtain Tregt2 1-465AA Tregt2 1-464AA Gene fragments; S2. DsbA-Tregt1 gene fragment and Tregt2 1-465AA Tregt2 1-464AA The gene fragment was connected to the vector pRSF to obtain the vector pRSF-DsbA-Tregt1-Tregt2 1-465AA or pRSF-DsbA-Tregt1-Tregt2 1-464AA ; S3. Insert the vector pRSF-DsbA-Tregt1-Tregt2 1-465AA or pRSF-DsbA-Tregt1-Tregt2 1-464AA The gene is transformed into an Escherichia coli host to obtain the genetically engineered bacteria.

7. The construction method according to claim 6, characterized in that: The nucleotide sequence of the Tregt1 gene is shown in SEQ ID NO.1, the nucleotide sequence of the Tregt2 gene is shown in SEQ ID NO.2; the nucleotide sequence of the DsbA tag gene is shown in SEQ ID NO.

3.

8. A production method of ergothioneine, characterized in that, The method comprises the following steps: using the genetically engineered bacteria according to any one of claims 1 to 5 for fermentation culture to produce ergothioneine.

9. The production method according to claim 8, characterized in that: The fermentation culture specifically includes the following steps: after culturing the bacterial strain on a plate, inoculate it into an LB culture medium containing antibiotics, and culture it at 35-38° C. and 150-250 rpm for 6-8 hours to obtain a seed solution; The seed liquid is inoculated into a fermentation tank containing a fermentation medium, and after the fermentation liquid OD600 is cultured to 20-25 at 35-38°C, IPTG with a final concentration of 0.1-0.5mM is added, and the temperature is adjusted to 22-28°C for 60-90h. During the fermentation process, the pH value is maintained at 6.5-7.5 by adding ammonia water, and the dissolved oxygen is maintained at 25%-35% by adjusting the stirring speed and ventilation volume. When the initial glucose in the fermentation medium is exhausted, 70-90% glucose solution is added to maintain the glucose concentration at 0-1g / L.

10. The production method according to claim 9, characterized in that: The fermentation culture medium is: 15-25 g / L glucose, 3-5 g / L peptone, 5-7 g / L yeast extract, 0.8-1.2 g / L NaCl, 3-5 g / L KH2PO4, 0.8-1.2 g / L MgSO4·7H2O, 5-7 g / L (NH4)2SO4, 20-30 g / L Na2HPO4·12H2O, 0.4-0.6 g / L MnSO4·H2O, 0.4-0.6 g / L Na2MoO4·H2O, 0.4-0.6 g / L FeSO4·7H2O, 0.008-0.012 g / L CaCl2, 1-3g / L citric acid, 0.4-0.6g / L betaine, 0.4-0.6g / L histidine, 1-2g / L methionine, 1-2g / L cysteine, 0.1-0.3g / L VB6, 0.1-0.3g / L VB12 and 0.008-0.012g / L VH.

Images