Cloning method of benzoic acid decarboxylase gene mutant and application of benzoic acid decarboxylase gene mutant in lignin phenol monomer biotransformation

Abstract

The invention discloses a cloning method of a benzoic acid decarboxylase gene mutant and application of the benzoic acid decarboxylase gene mutant in lignin phenol monomer biotransformation, wild type aspergillus oryzae 2, 3-dihydroxybenzoic acid decarboxylase gene is cloned from a strain FY1 separated from a rice field water sample, and sequencing is performed to obtain a complete gene sequence; proline Pro at the site 189 of the sequence is mutated into glycine Gly through software, and a P189G mutant is cloned. Then, a recombinant escherichia coli strain containing the gene is obtained through expression in escherichia coli, and the strain can express a recombinant mutant enzyme with high carboxylation activity. Compared with the prior art, the recombinant mutant enzyme formed by the invention has good reaction adaptability, high substrate tolerance and single product, and the catalytic conversion rate reaches 95.5%. The method is simple and fast, can effectively improve the activity and thermal stability of the enzyme, and is beneficial to the application of production practice.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, in particular to a method for cloning a benzoate decarboxylase gene mutant and application thereof in bioconversion of lignin phenol monomers. Background Art

[0002] Lignin, as one of the three major elements of lignocellulosic biomass, is the most abundant source of renewable aromatic biopolymers on earth and is of great value to the sustainability of biorefining. The aromatic platform compounds (phenolic monomers) obtained by lignin degradation retain the unique methoxyphenol structural unit, and its carboxylation product, aromatic carboxylic acid, is an important intermediate for the synthesis of medicines, dyes and pesticides. However, the domestic production capacity and quality of aromatic carboxylic acids are extremely low and can only rely on imports. With the expiration of many patented products, the world's pharmaceutical intermediates center has gradually shifted to Asia, and the development of intermediate synthesis technology represented by aromatic carboxylic acids is imminent.

[0003] At present, the synthesis of aromatic carboxylic acids from lignin phenolic monomers mainly relies on the chemical Kolbe-Schmitt carboxylation reaction, which is highly regioselective and has harsh conditions, leading to serious product component imbalance and environmental pollution problems. In recent years, the biological Kolbe-Schmitt reaction catalyzed by benzoate decarboxylase has shown strong momentum due to its advantages such as green and mild, single product component, etc. However, the thermodynamics of this reaction is not conducive to carboxylation, and the average carboxylation conversion rate is less than 50%, which seriously hinders its industrial application. Summary of the invention

[0004] The present invention aims to solve the deficiencies in the prior art and provide a method for cloning a benzoate decarboxylase gene mutant and its application in the bioconversion of lignin phenolic monomers, so as to improve the carboxylation conversion rate of lignin phenolic monomers by changing the gene structure of the wild-type benzoate decarboxylase.

[0005] To achieve the above object, the present invention is implemented according to the following technical solutions:

[0006] The present invention aims to provide a method for cloning a benzoate decarboxylase gene mutant, comprising the following steps:

[0007] S1. The wild-type Aspergillus oryzae 2,3-dihydroxybenzoate decarboxylase (2,3-DHBD_Ao1) gene (2,3-DHBD_Ao1) was cloned from strain FY1, and the complete 2,3-DHBD_Ao1 gene sequence was obtained by sequencing, and the sequence is shown in SEQ NO.1;

[0008] S2. The mutation site was determined using Discovery Studio software, the proline Pro at position 189 of the 2,3-DHBD_Ao1 sequence was mutated to glycine Gly, and the P189G mutant of 2,3-DHBD_Ao1 (2,3-DHBD_Ao2) was cloned, and its sequence is shown in SEQ NO.2.

[0009] Furthermore, the specific method for cloning 2,3-DHBD_Ao1 in step S1 is as follows:

[0010] Using the homologous cloning method, the Aspergillus oryzae strain FY118S rDNA sequence as shown in SEQNO.3 was compared with the nucleartide database on NCBI, and the primers were designed using the 2,3-dihydroxybenzoate decarboxylase gene of Aspergillus oryzae with the highest homology as a template, Ao-1: 5'-ATGCTCGGTAAGATCGCTC-3', Ao-2: 5'-TGAACTATCCTTGTAAGAA-3'; PCR amplification was performed using the genomic DNA of Aspergillus oryzae strain FY1 as a template, and the PCR amplification system was: 94℃-4min, 94℃-30s, 60℃-30s, 72℃-2min, 30 cycles, 72℃-10min; 2,3-DHBD_Ao1 was obtained.

[0011] Furthermore, cloning 2,3-DHBD_Ao2 in step S2 specifically includes:

[0012] The protein was subjected to virtual amino acid mutation using Discovery Studio software. After the mutation site was determined, the 2,3-DHBD_Ao1 sequence was used as a template for mutation to obtain 2,3-DHBD_Ao2. The 2,3-DHBD_Ao1 sequence was used as a template and the designed primers were used:

[0013]

[0014] Overlapping PCR amplification was performed, and the first round of PCR amplification system was: 94°C-1min, 98°C-10s, 60°C-40s, 72°C-1min, 30 cycles; the product was recovered by the kit to obtain 2,3-DHBD_Ao2.

[0015] Another object of the present invention is to provide a wild-type Aspergillus oryzae 2,3-dihydroxybenzoate decarboxylase gene 2,3-DHBD_Ao1 and its P189G mutant 2,3-DHBD_Ao2 cloned by the cloning method as claimed in claim 1.

[0016] The third object of the present invention is to provide an application of an Aspergillus oryzae 2,3-dihydroxybenzoate decarboxylase P189G mutant (2,3-DHBD_Ao2) in the bioconversion of lignin phenolic monomers, specifically to construct a recombinant Escherichia coli strain Escherichia coli AO (mutant) that catalyzes the efficient carboxylation of lignin phenolic monomers to produce aromatic carboxylic acids, wherein the recombinant strain E. coli AO is an Escherichia coli strain expressing a mutant sequence (2,3-DHBD_Ao2) in which proline Pro at position 189 is mutated to glycine Gly, and the sequence of the 2,3-DHBD_Ao2 is shown in SEQNO.2. The deposit number of the recombinant Escherichia coli strain is: CGMCC NO.32406, and the classification name is: Escherichia coli AO, the deposit date is: October 30, 2024, and the deposit address is: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit unit is: General Microbiological Center of China Microbiological Culture Collection Administration.

[0017] Furthermore, a method is provided in which the recombinant strain E. coli AO is directly used as a mutant 2,3-dihydroxybenzoate decarboxylase (2,3-DHBD_Ao2) to catalyze phenolic monomers to generate aromatic carboxylic acids.

[0018] Specifically, the fermentation broth after the E. coli AO induction culture is separated to obtain bacterial bodies with a total solid concentration greater than 80% (w / w), and freeze-dried to obtain freeze-dried bacterial bodies with a recombinant enzyme expression level of 8.41 mg / g cell dry weight.

[0019] The E. coli culture method is as follows:

[0020] (1) Seed culture: The recombinant strain E. coli AO is inoculated into a seed culture medium and cultured at a temperature of 15 to 45°C for 4 to 24 hours. Preferably, the culture temperature is 37°C and the culture time is 10 hours;

[0021] (2) Induction culture: The seed culture solution is inoculated into the induction medium, the inoculation amount is 0.05-0.3% (v / v), the induction temperature is 15-30°C, the induction time is 6-48 hours, and the cells are harvested by centrifugation. The preferred inoculation amount is 0.1%, the induction temperature is 25°C, and the culture time is 24 hours.

[0022] Further, the collected cells are freeze-dried, and 10-50 mg of freeze-dried recombinant cells are added to a reaction containing 0.5-3.0 mM resorcinol and 1 mL of saturated KHCO3 solution, the reaction temperature is 20-50°C, the reaction time is 4-48 hours, and the reaction is terminated with 2 mL of methanol. Preferably, the freeze-dried cells are added in an amount of 20 mg, 1.0 mM resorcinol, the reaction temperature is 30°C, and the reaction time is 24 hours.

[0023] Seed culture medium (1L) formula: 20 g peptone, 10 g yeast extract, 20 g sodium chloride, 100.0 mg ampicillin, and the rest is water, pH 6.0.

[0024] The formula of the induction medium (1L) is: 20g of peptone, 10g of yeast extract, 20g of sodium chloride, 100.0mg of ampicillin, 0.25-2.0mM of IPTG, and the rest is water. The preferred amount of IPTG added is 0.1mM.

[0025] Beneficial effects:

[0026] 1. The recombinant strain E. coli AO of the present invention is obtained by using gene recombination technology, and the proline Pro at position 189 of the 2,3-DHBD_Ao1 sequence is mutated to glycine Gly to obtain 2,3-DHBD_Ao2. The recombinantly expressed 2,3-dihydroxybenzoate decarboxylase mutant (2,3-DHBD_Ao2) can achieve efficient biosynthesis of aromatic carboxylic acids, and the intracellular enzyme protein of 2,3-DHBD_Ao2 expressed by E. coli AO can reach 8.41 mg / g cell dry weight.

[0027] 2. After washing and freeze-drying, E. coli AO cells can be directly used as 2,3-DHBD_Ao2 background for catalytic carboxylation reaction.

[0028] 3. The recombinant enzyme has good reaction adaptability, high substrate tolerance, single product, and the recombinant enzyme catalytic conversion rate reaches 95.5%.

[0029] 4. The process has simple steps, short reaction time, high reusability, low cost, and high economic value and industrial application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 The three-dimensional structure simulation diagram of wild-type Aspergillus oryzae 2,3-dihydroxybenzoate decarboxylase and mutant protein, where a is the wild enzyme and b is the mutant enzyme.

[0031] Figure 2Figure 2 is a schematic diagram comparing the carboxylation activities of various Escherichia coli recombinant enzymes under the same conditions, where 2,3-DHBD_AO1 is a wild enzyme, 2,3-DHBD_AO2 is a mutant enzyme, 2,6-DHBD_Rs is a 2,6-dihydroxybenzoate decarboxylase from Rhizobium Sp., PAD_An is a phenolic acid decarboxylase from Aspergillus nige, 2,3-DHBD_Co is a 2,3-dihydroxybenzoate decarboxylase from Cutaneotrichosporon oleaginosum, and 2,3-DHBD_Ta is a 2,3-dihydroxybenzoate decarboxylase from Trichosporon asahii.

[0032] Figure 3 Comparison of carboxylation reaction conditions catalyzed by wild enzyme (▼) and mutant enzyme (▽), where a is the comparison of optimal substrate concentration; b is the comparison of optimal reaction pH; and c is the comparison of optimal reaction temperature. DETAILED DESCRIPTION

[0033] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0034] Example 1

[0035] The present invention clones a wild-type Aspergillus oryzae 2,3-dihydroxybenzoate decarboxylase gene (2,3-DHBD_Ao1) from strain FY1, and sequences to obtain a complete 2,3-DHBD_Ao1 sequence;

[0036] The strain FY1 was isolated from a water sample from a paddy field in Fuyu. Specifically, the water sample was obtained from the paddy field and then separated and purified on a YPD plate to obtain a single strain. The 18S rDNA sequence of the strain FY1 was shown in SEQ NO.3 by 18S rDNA sequencing. The obtained sequence was compared in NCBI, and the results showed that the 18S rDNA similarity between the strain and Aspergillus oryzae RIB40 was 100%, so the strain FY1 was identified as Aspergillus oryzae.

[0037] Using the homologous cloning method, the 18S r DNA sequence of the FY1 strain was compared with the nucleartide database on NCBI, and the primers were designed using the 2,3-dihydroxybenzoate decarboxylase gene of Aspergillus oryzae RIB40 with the highest homology as a template, Ao-1: 5'-ATGCTCGGTAAGATCGCTC-3', Ao-2: 5'-TGAACTATCCTTGTAAGAA-3'. PCR amplification was performed using FY1 genomic DNA as a template. PCR amplification system: 94℃-4min, 94℃-30s, 60℃-30s, 72℃-1min, 30 cycles, 72℃-10min. The results were detected by electrophoresis, and the target band was recovered using a kit (Dalian Bao Bio Co., Ltd.). The target fragment was connected to the pMD18-T vector and transformed into DH5α competent cells. The positive clones were screened on the plate with ampicillin resistance, and single colonies were picked for shaking. The plasmid was extracted for restriction digestion verification and sent to Biotechnology Co., Ltd. for sequence determination. The sequencing results were compared with NCBI and the homology with the target sequence reached 100%, indicating that the 2,3-dihydroxybenzoate decarboxylase gene of FY1 was successfully cloned.

[0038] The protein was subjected to virtual amino acid mutation using Discovery Studio software. After the mutation site was determined, the proline Pro at position 189 of the 2,3-DHBD_Ao1 sequence was mutated to glycine Gly, and the Aspergillus oryzae 2,3-dihydroxybenzoate decarboxylase gene P189G mutant (2,3-DHBD_Ao2) was cloned. The specific operations are as follows:

[0039] Design primers with mutation sites for mutation. The primer sequences are as follows:

[0040] Primer Name Primer Sequence (5'-3')

[0041] A-F1 ATGCTCGGTAAGATCGCTC

[0042] A-R1 GAGGTCCACCCACGAGCCAT

[0043] A-F2 ATGGCTCGTGGGTGGACCTC

[0044] A-R2 CTAAGCTGAACTATCCTTG

[0045] Using 2,3-DHBD_Ao1 sequence as template, overlapping PCR amplification was performed. The first round of PCR amplification system was: 94℃-1min, 98℃-10s, 60℃-40s, 72℃-1min, 30 cycles; the product was recovered by the kit to obtain 2,3-DHBD_Ao2. The results were compared by DNAMAN, and the mutation site was in the correct position.

[0046] Example 2

[0047] A recombinant strain Escherichia coli AO for catalyzing the efficient carboxylation of phenolic monomers to produce aromatic carboxylic acids is constructed, wherein the E. coli AO is a recombinant strain containing 2,3-DHBD_Ao2. Escherichia coli containing pET21a(+) is enriched and cultured in LB medium, and plasmids are extracted. 2,3-DHBD_Ao2 is connected to the pET21a(+) plasmid to obtain a gene expression component. The gene expression component is transferred into Amp-sensitive Escherichia coli, and the transformants are screened using an LB plate containing Amp, and PCR verification is performed to obtain a recombinant strain E. coli AO.

[0048] Example 3

[0049] The culture medium described in this example

[0050] Seed culture medium (1L) formula: 20 g peptone, 10 g yeast extract, 20 g sodium chloride, 100.0 mg ampicillin, and the rest is water, pH 6.0.

[0051] Formula of induction medium (1 L): 20 g peptone, 10 g yeast extract, 20 g sodium chloride, 100.0 mg ampicillin, 0.1 mM IPTG, and the rest water.

[0052] The E. coli strain carrying 2,3-DHBD_Ao2 was cultured in 10 mL of seed medium at 37°C and 200 rpm for 10 h. Then 4 mL of seed solution was transferred to 400 mL of induction medium and cultured for about 3 h until the OD 600 =0.4-0.8, add 0.1mM IPTG, culture at 25℃, 180rpm for 24h, induce the recombinant strain to produce enzyme protein. Harvest the cells by centrifugation, the bacterial content is 82% (w / w). Freeze dry in a freeze dryer, and the expression of the recombinant enzyme is 8.43mg / g cell dry weight. The freeze-dried cells are used as the recombinant enzyme background.

[0053] Example 4

[0054] Accurately weigh 20 mg of freeze-dried bacterial powder, place it in a 10 mL test tube, add 900 μL of KHCO3 saturated solution, and hydrate in a 30°C constant temperature shaking water bath for 30 min. The control group is inactivated freeze-dried bacteria, add 900 μL of KHCO3 solution, and follow the same steps as the experimental group. After hydration, 100 μL of 10 mM resorcinol solution was added to the control group and the experimental group, respectively, and reacted in a 30°C water bath shaker for 24 h. After the reaction, 2 mL of methanol was quickly added to the reaction system for inactivation.

[0055] The reaction solution was centrifuged, and the supernatant was filtered through a 0.4 μm filter paper into a clean liquid chromatography sample bottle. An Eclipse XDB-C18 (4.6×150 mm) column was used, and a mixture of acetonitrile and 0.3% (v / v) trifluoroacetic acid solution was used as the mobile phase in a ratio of 15:85. The contents of the substrate resorcinol and the product 2,6-DHBA were calculated according to the standard curve, and the enzyme activity was expressed as the enzyme-catalyzed carboxylation conversion rate (%). The conversion rate was calculated as W=W1 / (W0+W1), where W represents the conversion rate, W1 represents the amount of substance of the product, and W0 represents the amount of substance of the substrate.

[0056] The results showed that the recombinant strain expressing the mutant enzyme (2,3-DHBD_Ao2) could directly serve as an enzyme background to carboxylate resorcinol to produce 2,6-dihydroxybenzoic acid, with a carboxylation conversion rate of 95.5%.

[0057] according to Figure 1 As shown in Figure 1, through three-dimensional simulation, the substrate recognition mode and substrate inlet channel of Aspergillus oryzae 2,3-dihydroxybenzoate decarboxylase are clarified. In the simulation results, after the 189th amino acid of the enzyme is changed from proline (Pro, P) to glycine (Gly, G), the substrate inlet channel expands (b), the steric hindrance is significantly reduced, and the reaction balance is shifted to carboxylation. Based on this, Aspergillus oryzae 2,3-dihydroxybenzoate decarboxylase is subjected to the corresponding transformation stated in the present invention.

[0058] according to Figure 2 As shown, under the same conditions, the carboxylation activities of the recombinant mutant 2,3-dihydroxybenzoate decarboxylase (2,3-DHBD_Ao2), the wild-type 2,3-dihydroxybenzoate decarboxylase (2,3-DHBD_Ao1) and other decarboxylases were compared, among which the conversion rate of the carboxylation reaction catalyzed by the recombinant mutant enzyme reached 95.5%, the conversion rate of the carboxylation reaction catalyzed by the wild enzyme was 49.3%, and the conversion rate of the carboxylation reaction catalyzed by the other decarboxylases under the same conditions was only 25.1-41.8%. For example, the 2,6-dihydroxybenzoate decarboxylase (2,6-DHBD_Rs) from Rhizobium Sp. has a carboxylation conversion rate of 33.5%; the phenolic acid decarboxylase (PAD_An) from Aspergillus nige has a carboxylation conversion rate of 39.2%; the 2,3-dihydroxybenzoate decarboxylase (2,3-DHBD_Co) from Cutaneotrichosporon oleaginosum has a carboxylation conversion rate of 41.8%; the 2,3-dihydroxybenzoate decarboxylase (2,3-DHBD_Ta) from Trichosporon asahii has a carboxylation conversion rate of 33.4%.

[0059] like Figure 3 As shown in the figure, the comparison of the carboxylation reaction conditions catalyzed by 2,3-DHBD_Ao1 and 2,3-DHBD_Ao2 showed that the mutant enzyme 2,3-DHBD_Ao2 had a higher substrate tolerance and reached the highest conversion rate at a substrate concentration of 40 mM, while the conversion rate of the wild type decreased with the increase of substrate concentration ( Figure 3 a); The mutant enzyme and the wild-type enzyme had the same optimal pH, both exhibiting the highest activity at pH 6.0, while the mutant enzyme had a significantly higher tolerance to acidic pH than the wild-type enzyme ( Figure 3 b); The maximum reaction temperature of the wild enzyme is 30°C, while the maximum reaction temperature of the mutant enzyme is slightly higher, 35°C, and the mutant enzyme shows better temperature tolerance ( Figure 3 c).

[0060] The above-mentioned embodiments only express the implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that for ordinary technicians in this field, several modifications and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be based on the attached claims.

Claims

1. A method for cloning a benzoate decarboxylase gene mutant, characterized in that: The following steps are involved: S1. The wild-type Aspergillus oryzae 2,3-dihydroxybenzoic acid decarboxylase (2,3-DHBD_Ao1) gene (2,3-DHBD_Ao1) was cloned from the strain FY1 isolated from the paddy water sample, and the complete 2,3-DHBD_Ao1 gene sequence was obtained by sequencing, and the sequence is shown in SEQ NO.1; S2. The mutation site was determined using Discovery Studio software, and the proline Pro at position 189 of the 2,3-DHBD_Ao1 sequence was mutated to glycine Gly. The P189G mutant 2,3-DHBD_Ao2 of 2,3-DHBD_Ao1 was cloned, and its sequence is shown in SEQ NO.

2.

2. The cloning method according to claim 1, characterized in that: The specific method for cloning 2,3-DHBD_Ao1 in step S1 is as follows: Using the homologous cloning method, the strain FY118SrDNA sequence as shown in SEQNO.3 was compared with the nucleartide database on NCBI, and the primers were designed using the 2,3-dihydroxybenzoate decarboxylase gene of A.oryzae with the highest homology as a template, Ao-1: 5'-ATGCTCGGTAAGATCGCTC-3', Ao-2: 5'-TGAACTATCCTTGTAAGAA-3'; PCR amplification was performed using the genomic DNA of strain FY1 as a template, and the PCR amplification system was: 94℃-4min, 94℃-30s, 60℃-30s, 72℃-2min, 30 cycles, 72℃-10min; 2,3-DHBD_Ao1 was obtained.

3. The cloning method according to claim 1, characterized in that: The step S2 of cloning the P189G mutant 2,3-DHBD_Ao2 of 2,3-DHBD_Ao1 specifically comprises: The protein was virtually mutated with amino acids using Discovery Studio software. After the mutation site was determined, the 2,3-DHBD_Ao1 sequence was used as a template for mutation to obtain the P189G mutant 2,3-DHBD_Ao2 of 2,3-DHBD_Ao1. Using the 2,3-DHBD_Ao1 sequence as a template, the designed primers were used: Overlapping PCR amplification was performed, and the first round of PCR amplification system was: 94°C-1min, 98°C-10s, 60°C-40s, 72°C-1min, and 30 cycles; after the product was recovered by the kit, the P189G mutant 2,3-DHBD_Ao2 of 2,3-DHBD_Ao1 was obtained.

4. A P189G mutant 2,3-DHBD_Ao2 of 2,3-DHBD_Ao1 cloned by the cloning method as claimed in claim 1.

5. A use of 2,3-DHBD_Ao2 as claimed in claim 4 in recombinant expression of mutant benzoate decarboxylase, characterized in that: Specifically, a mutant enzyme that catalyzes the efficient carboxylation of phenolic monomers to produce aromatic carboxylic acids and its recombinant expression strain Escherichia coli AO are constructed. The recombinant strain E. coli AO is an Escherichia coli strain that expresses a mutant sequence (2,3-DHBD_Ao2) in which proline Pro at position 189 is mutated to glycine Gly. The 2,3-DHBD_Ao2 sequence is shown in SEQ NO.

2. The storage number of the recombinant Escherichia coli strain is: CGMCC NO.32406, and the classification name is: Escherichiacoli AO. The storage date is: October 30, 2024, and the storage address is: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The storage unit is: General Microbiology Center of China Microbiological Culture Collection Administration.

6. Use of the recombinant strain E. coli AO expressing the mutant enzyme as claimed in claim 5 in the bioconversion of lignin phenolic monomers, characterized in that: Provided is a method for directly catalyzing phenolic monomers to generate aromatic carboxylic acids by using a recombinant strain E. coli AO as a background of a mutant 2,3-dihydroxybenzoate decarboxylase (2,3-DHBD_Ao2), which specifically comprises the following steps: separating the fermentation liquid after induction culture of the E. coli AO to obtain bacterial bodies with a total solid concentration greater than 80% (w / w), and freeze-drying to obtain freeze-dried bacterial bodies with a recombinant enzyme expression amount of 8.41 mg / g cell dry weight; accurately weighing 20 mg of freeze-dried bacterial powder, placing it in a 10 mL test tube, adding 900 μL of a saturated KHCO3 solution, and hydrating it in a 30°C constant temperature oscillating water bath for 30 min; a control group inactivated freeze-dried bacteria, adding 900 μL of a KHCO3 solution, and performing the same steps as the experimental group; after hydration, 100 μL of a 10 mM resorcinol solution was added to the control group and the experimental group respectively, reacting in a 30°C water bath shaker for 24 h, and quickly adding 2 mL of methanol to the reaction system for inactivation after the reaction was completed.

Images