Application of LncRNA as gastric cancer biomarker and therapeutic target

Abstract

The invention belongs to the technical field of biological medicine, and particularly relates to application of LncRNA as a gastric cancer biomarker and a treatment target. The invention provides an LncRNA (long non-coding ribonucleic acid), wherein the LncRNA is LncLRR1-1; the nucleotide sequence of the LncLRR1-1 is as shown in SEQ ID NO. 1 (sequence identifier number 1). The LncLRR1-1 can positively regulate the occurrence and development of gastric cancer, is highly expressed in gastric cancer tissues and patient serum, and can be used as a gastric cancer biomarker and a therapeutic target. Results of embodiments show that knock-down of LncLRR1-1 can inhibit proliferation and metastasis of gastric cancer cells, and a new target is provided for treatment of gastric cancer.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to an application of LncRNA as a biomarker and therapeutic target for gastric cancer. Background Art

[0002] Gastric cancer (GC) is a common malignant tumor of the digestive tract. It progresses rapidly and is often discovered late. When discovered, it is usually in the advanced stage, and patients often have a poor prognosis. Despite improvements in current surgical treatment, immunotherapy, and targeted therapy, the overall survival rate of gastric cancer patients is still low. Postoperative metastasis and treatment resistance are still the main problems that hinder the improvement of patient survival. Therefore, it is urgent to find new diagnostic markers and therapeutic targets for gastric cancer in clinical practice. Summary of the invention

[0003] The purpose of the present invention is to provide an application of LncRNA as a biomarker and therapeutic target for gastric cancer. The LncRNA positively regulates the occurrence and development of gastric cancer and can be used as a biomarker and therapeutic target for gastric cancer.

[0004] The present invention provides a LncRNA, wherein the LncRNA is LncLRR1-1; the nucleotide sequence of the LncLRR1-1 is shown in SEQ ID NO.1.

[0005] The present invention also provides the use of the LncRNA described in the above scheme as a biomarker in the preparation of a product for diagnosing gastric cancer; the LncRNA positively regulates the occurrence and development of gastric cancer.

[0006] As a preferred solution, the product includes a primer pair for detecting the LncRNA described in the above solution.

[0007] As a preferred embodiment, the primer pair includes a forward primer having a nucleotide sequence as shown in SEQ ID NO.2 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.3.

[0008] The present invention also provides the use of the LncRNA described in the above scheme as a therapeutic target in the preparation of a drug for preventing and / or treating gastric cancer.

[0009] As a preferred embodiment, the drug includes an expression inhibitor of the LncRNA.

[0010] As a preferred embodiment, the expression inhibitor includes siRNA targeting LncLRR1-1.

[0011] As a preferred embodiment, the siRNA targeting LncLRR1-1 includes at least one of si-LncLRR1-1-1, si-LncLRR1-1-2 and si-LncLRR1-1-3; the si-LncLRR1-1-1 consists of a sense chain as shown in SEQ ID NO.4 and an antisense chain as shown in SEQ ID NO.5; the si-LncLRR1-1-2 consists of a sense chain as shown in SEQ ID NO.6 and an antisense chain as shown in SEQ ID NO.7; the si-LncLRR1-1-3 consists of a sense chain as shown in SEQ ID NO.8 and an antisense chain as shown in SEQ ID NO.9.

[0012] As a preferred embodiment, the effects of the drug include: inhibiting at least one of proliferation, migration and invasion of gastric cancer cells.

[0013] As a preferred embodiment, the gastric cancer cells include MKN-45 and / or HGC-27.

[0014] Beneficial effects: The present invention provides a LncRNA, wherein the LncRNA is LncLRR1-1; the nucleotide sequence of the LncLRR1-1 is shown in SEQ ID NO.1. The LncLRR1-1 of the present invention is highly expressed in tumor-associated macrophages and their exosomes. The expression of LncLRR1-1 in gastric cancer tissues is significantly increased compared with adjacent tissues, and the expression of LncLRR1-1 in the serum of gastric cancer patients is also higher than that in the serum of normal subjects. It shows that the expression of LncLRR1-1 can effectively diagnose gastric cancer, has good specificity and sensitivity, and meets the standards as a biomarker. In addition, the proliferation rate, plate cloning, migration and invasion ability of gastric cancer cells transfected with small interfering RNA (siRNA) of LncLRR1-1 are much lower than those of the control group. Knockdown of LncLRR1-1 can inhibit the proliferation and metastasis of gastric cancer cells in vitro, providing a new target for the treatment of gastric cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0016] Figure 1 The high-throughput sequencing results of M0-EX and M2-EX; A is the hierarchical clustering diagram of differential LncRNAs in M0-EX and M2-EX, and B is the volcano diagram of differential LncRNAs in M0-EX and M2-EX;

[0017] Figure 2 The expression of LncLRR1-1 in different groups; A is the expression level of LncLRR1-1 in M0 and M2, and B is the expression level of LncLRR1-1 in M0-EX and M2-EX; * indicates that the data are significantly different, p < 0.05; ** indicates that the data are significantly different, p < 0.01;

[0018] Figure 3 Schematic diagram of the expression of LncLRR1-1 in gastric cancer tissues and adjacent tissues; **** indicates that the data are extremely significantly different, p < 0.0001;

[0019] Figure 4 The expression diagram and ROC curve of LncLRR1-1 in the serum of gastric cancer patients; A is the expression level of LncLRR1-1 in the serum of gastric cancer patients and normal subjects, ** indicates that the data are significantly different, p < 0.01; B is the ROC curve of LncLRR1-1 in the serum of gastric cancer patients;

[0020] Figure 5 Figure 2 is a diagram of knockdown efficiency of different LncLRR1-1 small interfering RNAs; A is MKN-45 cells, B is HGC-27 cells; ns means no significant difference in the data; ** means significant difference in the data, p < 0.01; **** means extremely significant difference in the data, p < 0.0001;

[0021] Figure 6 Schematic diagram of cell growth curve results after transfection with different LncLRR1-1 small interfering RNAs; A is MKN-45 cells, B is HGC-27 cells; **** indicates that the data are extremely significantly different, p < 0.0001;

[0022] Figure 7 The following are microscopic images of the results of plate cloning; A is a microscopic image of plate cloning, and B is a statistical graph of the number of cloned cells; ** indicates that the data are significantly different, p < 0.01; *** indicates that the data are extremely significantly different, p < 0.001;

[0023] Figure 8 The following are microscopic images of migration results; A is a microscopic image of migration, and B is a statistical graph of the number of migrated cells; **** indicates that the data are extremely significantly different, p < 0.0001;

[0024] Fig. 9 The following are microscopic images of invasion results; A is a microscopic image of invasion, and B is a statistical graph of the number of invasive cells; **** indicates that the data are extremely significantly different, p < 0.0001. DETAILED DESCRIPTION

[0025] The present invention provides a lncRNA, wherein the lncRNA is lncLRR1-1; the nucleotide sequence of the lncLRR1-1 is shown in SEQ ID NO.1: 5'-CGCCGGGCGCGGUGGCGCGUGC CUGUAGUCCCAGCUACUCGGGAGGCUGAGGCUGGAGGAUCGCUUGAGUCCAGGAGUUCUGGGCUGUAGUGCGCUAUGCCGAUCGGGUGUCCGCACUAAGUUCGGCAUCAAUAUGGUGACCUCCCGGGAGCGGGGGACCACCAGGUUGCCUAAGGAGGGGUGAACCGGCCCAGGUCGGAAACGGAGCAGGUCAAAACUCCCGUGCUGAUCAGUAGUGGGAUCGCGCCUGUGAAUAGCCACUGCACUCCAGCCUGGGCAACAUAGCGAGACCCCGUCUCU-3'.

[0026] The present invention also provides the use of the LncRNA described in the above scheme as a biomarker in the preparation of a product for diagnosing gastric cancer; the LncRNA positively regulates the occurrence and development of gastric cancer. LncLRR1-1 is highly expressed in tumor-associated macrophages and their exosomes. Clinical samples were used for verification by qRT-PCR. Compared with adjacent tissues, the expression of LncLRR1-1 in gastric cancer tissues was significantly increased; at the same time, compared with the serum of normal physical examination subjects, the expression of LncLRR1-1 in the serum of gastric cancer patients was also higher. This shows that the expression of LncLRR1-1 can effectively diagnose gastric cancer, has good specificity and sensitivity, and meets the standards as a biomarker.

[0027] As an embodiment, the product of the present invention includes a primer pair for detecting the LncRNA. As an embodiment, the primer pair includes a forward primer with a nucleotide sequence as shown in SEQ ID NO.2 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.3. As an embodiment, the product of the present invention also includes an internal reference gene detection primer. In a specific embodiment of the present invention, the internal reference gene is β-actin; the internal reference gene detection primer includes a forward primer with a nucleotide sequence as shown in SEQ ID NO.12 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.13.

[0028] As an embodiment, the primer pair of the present invention can accurately characterize the expression level of LncLRR1-1 through qPCR detection. As an embodiment, the reaction procedure of the qPCR detection is 95°C pre-denaturation for 5min; 95°C denaturation for 10sec, 57°C annealing and extension for 30s, repeated for 40 cycles; finally, the melting curve acquisition program is set at 95°C for 15sec, 60°C for 60sec, and 95°C for 15sec. As an embodiment, the product of the present invention also includes qPCR amplification reagents and reverse transcription reaction reagents; the qPCR amplification reagents include 2×AceQ Universal SYBR qPCRMasterMix; the reverse transcription reaction reagents include the following components: 10×RTMix, HiScript III Enzyme Mix, Oligo(dT) 20 VN and random hexamers.

[0029] The present invention also provides the use of the LncRNA described in the above scheme as a therapeutic target in the preparation of a drug for preventing and / or treating gastric cancer. As an embodiment, the drug of the present invention includes an expression inhibitor of the LncRNA. As an embodiment, the expression inhibitor includes an siRNA targeting LncLRR1-1.

[0030] As an embodiment, the siRNA targeting LncLRR1-1 of the present invention includes at least one of si-LncLRR 1-1-1, si-LncLRR1-1-2 and si-LncLRR1-1-3; the si-LncLRR1-1-1 is composed of a sense strand with a nucleotide sequence as shown in SEQ ID NO.4 and an antisense strand with a nucleotide sequence as shown in SEQ ID NO.5; the si-LncLRR1-1-2 is composed of a sense strand with a nucleotide sequence as shown in SEQ ID NO.6 and an antisense strand with a nucleotide sequence as shown in SEQ ID NO.7; the si-LncLRR1-1-3 is composed of a sense strand with a nucleotide sequence as shown in SEQ ID NO.8 and an antisense strand with a nucleotide sequence as shown in SEQ ID NO.9. The siRNA targeting LncLRR1-1 of the present invention has a high targeted knockdown efficiency, which is beneficial to inhibiting the expression of LncLRR1-1 in gastric cancer cells, thereby improving the therapeutic effect of the drug.

[0031] As a specific embodiment, the effect of the drug includes: inhibiting at least one of the proliferation, migration and invasion of gastric cancer cells. As a specific embodiment, the gastric cancer cells include MKN-45 and / or HGC-27. In a specific embodiment of the present invention, inhibiting the expression of LncLRR1-1 can inhibit the proliferation, migration and invasion of gastric cancer cells MKN-45 and HGC-27.

[0032] In order to further illustrate the present invention, the application of a LncRNA provided by the present invention as a gastric cancer biomarker and therapeutic target is described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0033] In the following examples, unless otherwise specified, all methods are conventional; the materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources.

[0034] Example 1

[0035] High-throughput sequencing to screen LncRNAs that are specifically highly expressed in M2-EX

[0036] The exosomes from M0 macrophages and M2 tumor-associated macrophages were extracted by ultracentrifugation. The extraction method is described in: Théry C, Amigorena S, Raposo G, et al. Isolation and characterization of exosomes from cell culture supernatants and biological fluids [M]. Curr Protoc Cell Biol, 2006, Chapter 3: Unit 3.22. The exosomes from M0 macrophages (M0-EX) and M2 tumor-associated macrophages (M2-EX) were analyzed by high-throughput sequencing. The results are shown in Figure 2. Figure 1 As shown, A is the hierarchical clustering diagram of differential LncRNAs in M0-EX and M2-EX; B is the volcano diagram of differential LncRNAs in M0-EX and M2-EX. Figure 1The horizontal axis of A in the figure is the sequencing groups M0-EX and M2-EX; the vertical axis is the abundance of LncRNA expression; green is low expression, and red is high expression. With p<0.05 and |log2FC|>1 as the threshold, a heat map is used to show the difference in LncRNA expression between M0-EX and M2-EX. Group 1 refers to M0-EX, and group 2 refers to M2-EX. A total of 80 differentially expressed LncRNAs were screened, of which 21 were upregulated and 69 were downregulated. In particular, LncLRR1-1 (SEQ ID NO.1) ranked high in the upregulation fold in gastric cancer.

[0037] Example 2

[0038] Primers were designed based on LncLRR1-1, and the expression of Lnc-MALAT1 in M0 macrophages, M2 tumor-associated macrophages, M0-EX and M2-EX was determined by real-time fluorescence quantitative PCR.

[0039] (1) Reverse transcription

[0040] A. Removal of genomic DNA: Prepare the mixture shown in Table 1 in an RNase-free EP tube on ice; gently pipette to mix; react at 42°C for 2 min.

[0041] Table 1 Reverse transcription reaction system 1

[0042] RNase-free ddH2O Add to 10 μL 5×gDNAwiperMix 2μL Total RNA 1 μg

[0043] B. Prepare cDNA synthesis reaction solution according to Table 2. Heat at 37℃ for 15min and then at 85℃ for 5s.

[0044] Table 2 Reverse transcription reaction system 2

[0045] The mixture from the previous step 10μL 10×RTMix 2uL HiScriptEnzymeMix 2uL Oligo(dT) 1μL Random hexamers 1μL <![CDATA[RNase-freeddH2O]]> 4μL

[0046] (2) qPCR

[0047] A. Prepare the following mixture in a qPCR tube according to Table 3:

[0048] Table 3 qPCR system preparation

[0049] 2×AceQ Universal SYBR qPCR Master Mix 10μL Forward primer (10 μM) 0.4uL Reverse primer (10 μM) 0.4uL cDNA 2μL <![CDATA[RNase-freeddH2O]]> 7.2μL

[0050] B. qPCR was performed to detect the relative expression of LncLRR1-1 using β-actin as the internal reference gene; the primers for LncLRR1-1 are shown in SEQ ID NO.2 and SEQ ID NO.3; the primers for β-actin are shown in SEQ ID NO.12 and SEQ ID NO.13:

[0051] LncLRR1-1-F (SEQ ID NO.2): 5'-TCAATATGGTGACCTCCCGG-3';

[0052] LncLRR1-1-R (SEQ ID NO.3): 5'-GACGGGGTCTCGCTATGTT-3';

[0053] β-actin-F (SEQ ID NO:12): 5'-CACGAAACTACCTTCAACTCC-3';

[0054] β-actin-R (SEQ ID NO: 13): 5'-CATACTCCTGCTTGCTGATC-3'.

[0055] The qPCR amplification process is as follows: ① pre-denaturation at 95°C for 5 min; ② denaturation at 95°C for 10 s, ③ annealing and extension at 57°C for 30 s, steps ② to ③ are repeated for 40 cycles, ⑤ finally, the melting curve acquisition program is set at 95°C for 15 s, 60°C for 60 s, and 95°C for 15 s. The detection results are as follows: Figure 2 And as shown in Table 4.

[0056] Table 4 Relative expression levels of LncLRR1-1 in each group

[0057] Group M0 M2 M0-EX M2-EX Expression 1.00 4.35 1.00 7.29

[0058] according to Figure 2 As shown in Table 4, in each group of experimental results, both M2 and M2-EX could significantly over-express LncLRR1-1, indicating that LncLRR1-1 can be used as a specific molecule to detect tumors.

[0059] Example 3

[0060] Expression of LncLRR1-1 in clinical gastric cancer tissues and adjacent tissues

[0061] (1) RNA was extracted from 35 gastric cancer tissue and adjacent tissue samples, wherein the tissue samples were gastric cancer and adjacent tissue samples collected from June 2019 to March 2024 by Nantong Cancer Hospital, Jiangsu Province.

[0062] A. Take out the frozen gastric cancer tissue and adjacent tissue samples from the -80℃ refrigerator and thaw them on ice; B. After the tissue is thawed, take 15mg of tissue into a 1.5mL RNase-free EP tube and add 200μL Trizol lysis solution to each tube; C. Grind the tissue block as thoroughly as possible with a tissue grinding rod on ice, grind for 15s each time, let it stand on ice for 45s, repeat the operation 5 times, then add Trizol lysis solution to each EP tube to 1mL, mix thoroughly and let it stand at 4℃ for 10min; D. Add 200μL chloroform solution to each tube, vortex and oscillate to mix, let it stand at 4℃ for 5min; E. Centrifuge at 4℃, 11200rpm for 15min, carefully pipette 600μL of the upper aqueous phase containing RNA into a new EP tube, and try to avoid sucking the white The red organic phase in the middle layer and the lower layer; F. Add an equal volume of isopropanol solution to each tube, gently mix the mixture in the tube several times, and let it stand at 4℃ for 10 minutes; G. Centrifuge at 4℃, 11200rpm for 10 minutes, discard the supernatant in small amounts and multiple times to avoid sucking the RNA precipitate at the bottom of the tube; H. Add 1mL of 75% anhydrous ethanol prepared with DEPC water, and gently wash the RNA precipitate; I. Centrifuge at 4℃, 11200rpm for 5 minutes, carefully discard the supernatant, dry it naturally at room temperature, and add appropriate amount of DEPC water to resuspend the precipitate when the RNA precipitate becomes translucent; J. After dissolving at 4℃ overnight, blow and mix, take 1μL DEPC water as a blank control, draw 1μL of the sample to be tested on the NanoDrop spectrophotometer to detect the RNA concentration and purity, and store it at -80℃ for a long time.

[0063] (2) Reverse transcription was performed according to step (1) of Example 2.

[0064] (3) qPCR was performed according to step (2) of Example 2. The results are as follows: Figure 3 shown.

[0065] according to Figure 3 It can be seen that LncLRR1-1 is significantly overexpressed in gastric cancer tissues compared with adjacent adjacent tissues (normal tissues).

[0066] Example 4

[0067] Expression of LncLRR1-1 in the serum of gastric cancer patients and normal subjects

[0068] (1) RNA was also extracted from the sera of 25 gastric cancer patients and 25 normal physical examination subjects. The serum samples were sera from gastric cancer patients and normal physical examination subjects collected by Nantong Cancer Hospital, Jiangsu Province from January 2021 to July 2024. The sera of gastric cancer patients described in this example and the 35 gastric cancer tissues in Example 3 were derived from different gastric cancer patients.

[0069] A. Take 200 μL of serum sample in a 1.5 mL RNase-free EP tube, add 4 μL RNA Carrier and mix evenly, then add 200 μL lysis solution and 20 μL digestion solution, shake and mix, and place in a 65°C water bath for 10 min; B. Add 900 μL of anhydrous ethanol, transfer to the adsorption column after mixing, centrifuge at 4°C, 12000 rpm for 1 min, and discard the waste liquid; C. Add 500 μL of washing solution A containing 30% anhydrous ethanol, let stand for 2 min, centrifuge at 4°C, 12000 rpm for 1 min, and discard the waste liquid; D. Add 500 μL of washing solution B containing 70% anhydrous ethanol, centrifuge at 4°C, 12000 rpm for 1 min, discard the waste liquid, and centrifuge again for 3 min; E. Take out the adsorption column and put it in a new EP tube, add the preheated elution solution, let stand for 2 min, centrifuge at 4°C, 12000 rpm for 2 min, collect the RNA solution and detect its concentration and purity, and use it directly in the next experiment or store it at -80°C.

[0070] (2) Reverse transcription was performed according to step (1) of Example 2.

[0071] (3) qPCR was performed according to step (2) of Example 2. The results are as follows: Figure 4 As shown in Figure 1, the ROC curve was used to evaluate the sensitivity and specificity of LncLRR1-1 in diagnosing gastric cancer. Figure 4 As shown in B.

[0072] according to Figure 4 It can be seen that compared with healthy people, LncLRR1-1 is highly expressed in gastric cancer serum. In terms of diagnostic efficacy, the AUC of LncLRR1-1 reaches 0.7088, and the sensitivity reaches 80%, which can be used as a biomarker for gastric cancer diagnosis.

[0073] Example 5

[0074] (1) Small interference construction

[0075] Shanghai Yigou Biotechnology Co., Ltd. was commissioned to design and synthesize three small interfering RNAs (si-LncLRR1-1-1, si-LncLRR1-1-2 and si-LncLRR1-1-3) and one small interfering RNA control group (si-control) for LncLRR1-1. The nucleotide sequences are as follows:

[0076] si-LncLRR1-1-1-S (SEQ ID NO.4): 5'-GCACUAAGUUCGGCAUCAA-3';

[0077] si-LncLRR1-1-1-AS (SEQ ID NO.5): 5'-UUGAUGCCGAACUUAGUGC-3';

[0078] si-LncLRR1-1-2-S (SEQ ID NO.6): 5'-GGAGGAUCGCUUGAGUCCA-3';

[0079] si-LncLRR1-1-2-AS (SEQ ID NO.7): 5'-UGGACUCAAGCGAUCCUCC-3';

[0080] si-LncLRR1-1-3-S (SEQ ID NO.8): 5'-CGGAAACGGAGCAGGUCAA-3';

[0081] si-LncLRR1-1-3-AS (SEQ ID NO. 9): 5'-UUGACCUGCUCCGUUUCCG-3'.

[0082] si-control (SEQ ID NO. 10): 5'-UUCUCCGAACGUGUCACGU-3';

[0083] si-control (SEQ ID NO. 11): 5'-ACGUGACACGUUCGGAGAA-3';

[0084] At the same time, the addition of TT overhang series to the end of the small interfering RNA forms a sticky end, which can enhance the stability of siRNA, promote binding to the target sequence, improve the connection efficiency, facilitate screening and identification, and promote cell uptake and RISC loading. The above-mentioned small interfering RNA was used to knock down LncLRR1 respectively to obtain si-LncLRR1-1, si-LncLRR1-2 and si-LncLRR1-3.

[0085] (2) Cell transfection

[0086] A. Take cells (HGC-27 and MKN-45) with good growth conditions and inoculate them into 6-well plates 18 hours before transfection to make the cell confluence reach 50% before transfection. B. Take 5 μL of si-control, si-LncLRR1-1-1, si-LncLRR1-1-2 and si-LncLRR1-1-3 in step (1) respectively, add them to Ep tubes containing 250 μL of blank culture medium, and mix gently; take si-control as the control group and add it to Ep tubes containing 250 μL of blank culture medium. C. Take 5 μL of Lipofectamine TM2000 transfection reagent, add to another Eppendorf tube containing 250μL blank culture medium, mix gently, and incubate at room temperature for 5min. D. Mix the liquids in steps B and C, incubate at room temperature for 20min, add to the 6-well plate in step A, add 1640 culture medium to 2mL, and perform transfection in the incubator; remove the mixture after 6h and add 2mL complete culture medium. E. After 48h of culture, trypsinize the cells for subsequent experiments.

[0087] (2) Determination of transfection efficiency

[0088] A. Wash the cells in step (2) with pre-cooled PBS, discard the PBS, and add 1 mL of Trizol lysis buffer to pipette. Collect the solution after pipetting into a 1.5 mL RNase-free EP tube. Place the treated centrifuge tube in a 4°C refrigerator and let it stand for 10 minutes; B. After standing, add 200 μL of chloroform to each tube for mixing, shake it by hand 15 times to fully mix the chloroform and Trizol, and then place it in a refrigerator or ice box and let it stand for 5 minutes; C. Centrifuge at 4°C, 12000g for 15 minutes, carefully pipette the upper aqueous phase into a new EP tube, add an equal volume of pre-cooled isopropanol, mix it upside down, and let it stand at room temperature for 10 minutes; D. Centrifuge at 4°C, 12000g for 10 minutes, and white flocculent precipitate can be seen at the bottom of the tube. Carefully discard the supernatant, add 1 mL of 75% ethanol (DEPC water), and wash the precipitate thoroughly; E. Centrifuge at 4°C, 12000g for 5 minutes, discard the ethanol as much as possible, and dry the precipitate in an open place in a clean environment for 2 to 5 minutes. When the precipitate is a translucent film, add an appropriate amount of DEPC water to fully dissolve the RNA. F. Reverse transcription is performed according to Example 2. G. qPCR is performed according to Example 2. The detection results of LncLRR1-1 are as follows: Figure 5 And as shown in Table 5.

[0089] Table 5 LncLRR1-1 expression detection results

[0090] Group MNK-45 HGC-27 si-control 1.00 1.00 si-LncLRR1-1-1 0.87 0.61 si-LncLRR1-1-2 0.43 0.70 si-LncLRR1-1-3 0.32 0.43

[0091] according to Figure 5 As shown in Table 5, si-LncLRR1-1-2 and si-LncLRR1-1-3 have higher knockdown efficiency. Therefore, si-LncLRR1-1-2 and si-LncLRR1-1-3 with higher knockdown efficiency were selected for subsequent experiments.

[0092] Example 6 Effect of Inhibiting LncLRR1-1 Expression on Proliferation, Migration and Invasion of Gastric Cancer Cells

[0093] (1) Cell transfection

[0094] si-LncLRR1-1-2 and si-LncLRR1-1-3 were selected to transfect HGC-27 and MKN-45, respectively, and the transfection method was performed according to Example 5.

[0095] (1) Cell growth curve

[0096] The cells transfected in step (1) were digested and counted, and 10,000 cells / well were seeded into a 24-well plate containing 1 mL of complete medium and placed in a cell culture incubator for culture. One group was digested and counted every 24 hours, and a cell growth curve was drawn with time as the horizontal axis and the number of cells as the vertical axis. The results are shown in Figure 2. Figure 6 and as shown in Table 6.

[0097] Table 6 Cell growth curve

[0098]

[0099]

[0100] according to Figure 6 As shown in Table 6, the proliferation rate of gastric cancer cells transfected with si-LncLRR1-1-2 and si-LncLRR1-1-3 was much lower than that of the control group.

[0101] (2) Plate cloning

[0102] A. Digest and count the cells transfected in step (1), and inoculate 1000 cells / well into a 6-well plate containing 2 mL of complete culture medium. B. Culture the cells in a cell culture incubator for 9 days, changing the culture medium every 3 days. C. When the cells form a cell colony visible to the naked eye, discard the culture medium and wash with PBS. Add 1 mL of 4% paraformaldehyde to fix for 30 minutes and then discard. Add 1 mL of crystal violet staining solution and stain for 15 minutes. Remove the staining solution, rinse with running water until no purple staining solution drips, and dry. D. Take a picture. The results are as follows: Figure 7 As shown in A; the number of cell clones in each well was counted, and the results were as follows Figure 7 As shown in B and Table 7.

[0103] Table 7 Number of cell clones

[0104] MNK-45 HGC-27 si-control 201 184 Si-LncLRR1-1-2 40 58 Si-LncLRR1-1-3 101 95

[0105] according to Figure 7 As shown in Table 7, the plate clones of gastric cancer cells transfected with si-LncLRR1-1-2 and si-LncLRR1-1-3 were much lower than those of the control group.

[0106] (3) Transwell migration assay

[0107] A. Digest the transfected cells in step (1) with trypsin, resuspend the cells in basal medium and count them, adjusting the cell density to 2.5×10 5 / mL, take 200μL and add it to the Tranwell chamber. B. Place the Tranwell chamber in a 24-well plate with 600μL complete culture medium and place it in a cell culture incubator for 24h. C. Discard the culture medium and wash with PBS, add 1mL 4% paraformaldehyde to fix for 30min and then discard, add 1mL crystal violet staining solution to stain for 15min. D. Carefully wipe off the non-migrated cells with a cotton swab and take pictures under a microscope. The results are as follows Figure 8 As shown in A; and the number of migrated cells was counted, and the results were as follows Figure 8 As shown in B and Table 8.

[0108] Table 8 Number of migrated cells

[0109] Group MNK-45 HGC-27 si-control 497 596 Si-LncLRR1-1-2 393 461 Si-LncLRR1-1-3 303 205

[0110] according to Figure 8 As shown in Table 8, the migration ability of gastric cancer cells transfected with si-LncLRR1-1-2 and si-LncLRR1-1-3 was lower than that of the control group.

[0111] (4) Matrigel invasion assay

[0112] A. One day before the experiment, place Matrigel from -20°C in a 4°C refrigerator overnight to melt it from solid to liquid. B. Prepare 10% volume concentration of Matrigel on ice, spread 50 μL on the upper layer of the chamber, and place at 37°C for 30 minutes to solidify the Matrigel. C. Digest the cells transfected in step (1) with trypsin, resuspend the cells in basal culture medium and count them, adjusting the cell density to 5×10 5 / mL, take 200μL and add it to the Tranwell chamber. D. Place the Tranwell chamber in a 24-well plate with 600μL complete culture medium and place it in a cell culture incubator for 48h. E. Discard the culture medium and wash with PBS, add 1mL 4% paraformaldehyde to fix for 30min and then discard, add 1mL crystal violet staining solution to stain for 15min. F. Carefully wipe off the uninvaded cells with a cotton swab and take pictures under a microscope. The results are as follows Fig. 9 As shown in A; and the number of invasive cells was counted, the results are as follows Fig. 9 As shown in B and Table 9.

[0113] Table 9 Number of invasive cells

[0114] Group MNK-45 HGC-27 si-control 566 579 Si-LncLRR1-1-2 362 477 Si-LncLRR1-1-3 232 254

[0115] according to Fig. 9As shown in Table 9, the invasion ability of gastric cancer cells transfected with si-LncLRR1-1-2 and si-LncLRR1-1-3 was lower than that of the control group.

[0116] It can be seen that the proliferation rate, plate cloning, migration and invasion ability of gastric cancer cells transfected with si-LncLRR1-1-2 and si-LncLRR1-1-3 were much lower than those of the control group. The above results show that knocking down LncLRR1-1 can inhibit the proliferation and metastasis of gastric cancer cells in vitro, providing a new target for gastric cancer treatment.

[0117] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A LncRNA, characterized in that: The LncRNA is LncLRR1-1; the nucleotide sequence of the LncLRR1-1 is shown in SEQ ID NO.

1.

2. Use of the LncRNA according to claim 1 as a biomarker in the preparation of a product for diagnosing gastric cancer; the LncRNA positively regulates the occurrence and development of gastric cancer.

3. The use according to claim 2, characterized in that: The product comprises a primer pair for detecting the LncRNA according to claim 1.

4. The use according to claim 3, characterized in that: The primer pair includes a forward primer whose nucleotide sequence is shown as SEQ ID NO.2 and a reverse primer whose nucleotide sequence is shown as SEQ ID NO.

3.

5. Use of the LncRNA according to claim 1 as a therapeutic target in the preparation of a drug for preventing and / or treating gastric cancer.

6. The use according to claim 5, characterized in that: The drug includes an expression inhibitor of the LncRNA.

7. The use according to claim 6, characterized in that: The expression inhibitor includes siRNA targeting LncLRR1-1.

8. The use according to claim 7, characterized in that: The siRNA targeting LncLRR1-1 includes at least one of si-LncLRR1-1-1, si-LncLRR1-1-2 and si-LncLRR1-1-3; the si-LncLRR1-1-1 is composed of a sense chain with a nucleotide sequence as shown in SEQ ID NO.4 and an antisense chain with a nucleotide sequence as shown in SEQ ID NO.5; the si-LncLRR1-1-2 is composed of a sense chain with a nucleotide sequence as shown in SEQ ID NO.6 and an antisense chain with a nucleotide sequence as shown in SEQ ID NO.7; the si-LncLRR1-1-3 is composed of a sense chain with a nucleotide sequence as shown in SEQ ID NO.8 and an antisense chain with a nucleotide sequence as shown in SEQ ID NO.

9.

9. The use according to any one of claims 5 to 8, characterized in that: The effects of the drug include: inhibiting at least one of the proliferation, migration and invasion of gastric cancer cells.

10. The use according to claim 9, characterized in that: The gastric cancer cells include MKN-45 and / or HGC-27.

Images