Amphoteric ion modified nucleic acid aptamer and preparation method thereof

Abstract

The invention discloses a zwitter-ion modified nucleic acid aptamer and a preparation method thereof, and belongs to the field of biological medicine. Wherein both the zwitterion and the aptamer have functional activity, the zwitterion has an anti-nonspecific binding effect, the aptamer can actively target a target molecule, and the zwitterion and the aptamer are coupled together through a click chemistry reaction. The zwitter-ion modified aptamer provided by the invention not only is flexible in construction mode, but also can resist the adsorption effect of proteins and cells on the aptamer, and improves the specific targeting ability of the aptamer to target molecules in a complex environment.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to a nucleic acid aptamer modified with zwitterions and a preparation method thereof. Technical Background

[0002] Nucleic acid drugs such as aptamers, siRNA and miRNA play an important role in the fields of malignant tumors, cardiovascular and cerebrovascular diseases, and rare genetic diseases, and have become the third largest category of drugs after small molecule drugs and antibody drugs. Among them, nucleic acid aptamers (Aptamers), as a class of single-stranded DNA or RNA small nucleic acid sequences screened by SELEX (Systematic Evolution of Ligands by Exponential Enrichment) technology, can be folded into specific secondary and tertiary structures. At the same time, with the help of intermolecular forces such as electrostatic force, hydrophobic force, and van der Waals force, they can identify target molecules of specific diseases with high affinity and high specificity by matching the spatial structure of the target molecule conformation. Therefore, they show broad clinical application prospects in the fields of biological detection, disease diagnosis, and drug development, especially in the personalized diagnosis and treatment of highly heterogeneous diseases such as tumors. 1 .

[0003] However, despite the excellent performance of aptamers in in vitro environments, it is still difficult to completely target the designed target sites in complex and dynamic physiological environments. This is because after entering the body, aptamers will be affected by various biological macromolecules in the processes of circulation, phagocytosis, and crossing biological barriers, such as non-specific interactions with plasma proteins and nucleic acids; in addition, complex molecules such as proteins and glycosylated structures present on the surface of biological membranes may also hinder the binding of aptamers to target proteins. The interaction between aptamers and the physiological environment will affect their ability to bind to target molecules, thereby affecting the pathways of entry into target organs and target cells and changing their behavior in vivo. Previous studies have shown that nanoparticles form a multi-layer protein corona on their surface due to non-specific adsorption with plasma proteins, thereby affecting their properties such as metabolism and tumor uptake. 2,3 ; The targeting ability of nucleic acid aptamers will be reduced by the influence of plasma proteins 4,5 .

[0004] Nonspecific interactions of macromolecules in biological systems are a common phenomenon that can easily lead to reduced detection sensitivity and accuracy of biosensors and reduce the delivery efficiency of drug delivery systems. Hydration is one of the most effective ways to resist nonspecific interactions. Among them, polyethylene glycol (PEG) modification has been widely used in the biomedical field because of its ability to effectively enhance hydration, low toxicity and high biocompatibility, solubility in a variety of polar / non-polar solvents, and effective resistance to protein adsorption in complex biological environments. This is because PEG interacts with water molecules through hydrogen bonds to form a hydration protective layer in the biological aqueous environment, effectively inhibiting the nonspecific adsorption caused by biological molecules, thereby improving the water solubility of hydrophobic drugs, improving the stability of biological and colloids, prolonging the blood circulation time of drugs and improving bioavailability. However, the immunogenicity and oxidative degradation properties of PEG modification will affect its own performance and limit its in vivo application. First, the widespread use of PEG modification in commercial products (such as food, cosmetics, medicines, etc.) leads to high concentrations of anti-PEG antibodies in some patients. This autoantigenic property may seriously limit the biomedical efficacy of PEG therapy. 6 , such as accelerated blood clearance of PEGylated drugs, leading to reduced therapeutic outcomes 7 At the same time, high concentrations of anti-PEG antibodies may trigger strong hypersensitivity reactions in certain patients, leading to serious and fatal side effects. 8 ; Secondly, due to its amphiphilicity (hydrophilic / lipophilic) PEG modification on the surface of biological macromolecule reagents (such as antibodies, nucleic acids, etc.), it is easy to form complex structures locally in a physiological water environment, thereby significantly affecting the functional activity of biological reagents (such as recognition, regulation, etc.) 9 ; In addition, the linear structure of PEG means that it has only two ends available for functionalization, making it difficult to adjust the drug loading in PEG-conjugated drugs; finally, due to the slow oxidative degradation of PEG in the biological environment, the use of PEG therapy may lead to the accumulation of PEG in the body 10 Therefore, it is particularly important to develop low-molecular-weight antifouling modifications with low immunogenicity to improve the antifouling properties of aptamers.

[0005] In recent years, zwitterion (ZW) materials have attracted extensive attention due to their design flexibility, high biocompatibility and antifouling properties. Zwitterions are composed of positively and negatively charged groups and can dynamically change their charge properties in different biological environments. 11 , with “intelligent” properties that respond to different environmental stimuli (such as enzymes, pH, and redox processes) 12 Under neutral conditions such as blood circulation and normal tissues, zwitterions exist as ion pairs with overall internal balanced charges, which can induce the formation of a hydration layer through dipole minimization and electrostatic effects, thereby facilitating resistance to nonspecific adsorption.13 At the same time, zwitterions undergo changes in acidic environments such as tumor tissues and cell endosomes, resulting in increased ionization of the cationic fragment and decreased ionization of the anionic part, leading to improved endosomal escape and enhanced internalization into cancer cells. 14,15 This regulatory mechanism is different from the hydrogen bond hydration of the classic PEG modification. 16 , while showing strong anti-adsorption ability and low immunogenicity 17,18 However, the application research of zwitterion-modified aptamers is still limited to enhancing the antifouling performance of biosensors immobilized on the surface of metal substrates, and no researchers have applied zwitterions to resist the nonspecific binding of aptamers to the biological environment. Summary of the invention

[0006] In view of the above problems, the present invention discloses a nucleic acid aptamer modified with zwitterions and a preparation method thereof, which belongs to the field of biomedicine. The zwitterions and nucleic acid aptamers both carry active groups, the former has the effect of resisting nonspecific binding, and the latter can actively target the target molecule, and the two are coupled together through a "click chemistry" reaction. The zwitterion-modified nucleic acid aptamer provided by the present invention is not only flexible in construction, but also can resist the adsorption of proteins and cells on the nucleic acid aptamer, and improve the specific targeting ability of the nucleic acid aptamer to the target molecule in a complex environment.

[0007] Specifically, a class of nucleic acid aptamers modified with zwitterions constructed by the present invention can effectively resist nonspecific interactions in complex environments. The core design is to chemically modify nucleic acid aptamers using regulatable betaine zwitterions and their trivalent derivatives. This modification method has the following characteristics: Figure 1 ): (1) Compared with PEG macromolecule modification, zwitterion has lower immunogenicity; at the same time, low molecular weight zwitterion modification will not affect the binding of nucleic acid aptamer to target due to the formation of complex structure locally, thus maintaining the high affinity of nucleic acid aptamer to target protein. (2) Resist the nonspecific interaction between biological macromolecules and nucleic acid aptamer, and enhance its target binding ability in complex environment; in addition, it can also improve the ability of nucleic acid aptamer to resist nuclease degradation in blood, thereby enhancing its own stability. (3) Using precise coupling methods such as "click chemistry", multivalent zwitterions with diverse structures can be directly coupled to different positions of the aptamer (such as the 3' / 5' end or the middle sequence site), and the hydrophilic domain of the zwitterion can be used to form an anti-fouling biological interface (hydration protective layer), thereby reducing the interference of the complex environment of plasma or cell surface on the binding of the aptamer to the target and improving the specific targeting ability of the aptamer in complex environments. One or more trivalent zwitterion units can also be coupled to a single or multiple sites of the aptamer. In addition, since zwitterions have modifiable properties, the performance of the aptamer can be regulated by adjusting the specific composition of the trivalent zwitterion.

[0008] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0009] In one aspect, the present invention provides a nucleic acid aptamer complex, wherein the complex comprises a zwitterion and a nucleic acid aptamer, wherein the zwitterion and the nucleic acid aptamer are coupled together via a chemical bond.

[0010] Furthermore, the zwitterions include but are not limited to sulfobetaine, carboxybetaine, phosphorylcholine and their derivatives.

[0011] Furthermore, the derivative refers to the monomer structure and its derivatives containing different unit types (such as phosphoric acid, carboxylic acid, etc.), different valence states, different lengths, and different charge numbers. The derivative refers to the product obtained by structural transformation or modification of the original substance by chemical means under specific conditions. This change may involve changes in part or all of the molecular structure, but always maintains properties or functions similar to the original substance.

[0012] Further, the zwitterions include but are not limited to

[0013]

[0014] and its derivatives.

[0015] Furthermore, the zwitterion is sulfobetaine and its derivatives.

[0016] Furthermore, the number of monomers in the zwitterion is 1 to 6, preferably 1 to 3, and more preferably 3.

[0017] The present invention confirms that the valence state of zwitterions affects the anti-interference and biological activity of the modified nucleic acid aptamer, wherein when the zwitterions contain three sulfobetaine monomers, the performance of the nucleic acid aptamer reaches the best, so it is preferred to use trivalent zwitterions to modify the nucleic acid aptamer.

[0018] Furthermore, the zwitterion is a trivalent sulfobetaine

[0019] Furthermore, the chemical bonds include but are not limited to chemical bonds constructed by common coupling methods such as carboxylic acid-amino, thiol-maleimide, N-hydroxysuccinimide-amino, and alkyne-azide.

[0020] It should be understood that the 3' and / or 5' end of the nucleic acid aptamer / zwitterion is connected to one or more active groups selected from thiol, amino, dibenzocyclooctyne, azide, and maleimide. The active group refers to an atom or atomic group with specific chemical activity in a molecule, which can participate in chemical reactions or interact with other molecules, thereby coupling the nucleic acid aptamer and the zwitterion together. Therefore, the type of the above-mentioned chemical bond is determined by the type of active groups connected to the nucleic acid aptamer and the zwitterion.

[0021] Furthermore, the nucleic acid aptamer and the zwitterion are coupled via an azide-alkyne reaction. Specifically, the 3' and / or 5' end of the nucleic acid aptamer is connected with an azide or alkyne active group, and the zwitterion is connected with an alkyne or azide active group correspondingly.

[0022] It should be understood that the positions of the groups can be exchanged according to the structure of the target product, but the active groups attached to the aptamer and the zwitterion need to correspond, that is, if the 3' and / or 5' ends of the aptamer carry an azide group, then the zwitterion needs to be modified with an alkyne group to the 3' and / or 5' ends, and vice versa.

[0023] In some specific embodiments, the nucleic acid has an alkyne-reactive group attached and the zwitterion has an azide-reactive group attached.

[0024] Specifically, the preferred specificity of the specific genes CD5, CD19, CD20, CD25, CD37, CD30, CD33, CD45, CAMPATH-1, HLD-DR, carcinoembryonic antigen(CEA),TAG-72,EpCAM,MUC1,MUC15,folate-binding protein,A33,G250,prostate-specific membrane antigen(PSMA),ferritin,GD2,GD3,GM2,Leg,CA-125,CA19-9,epidermal growth factor,p185HER2,IL-2receptor,tenascin,metalloproteinase,endosialin,vascularendothelial growth factor,avB3,WT1,LMP2,HPV E6,HPV E7,EGFRvIII,Her-2 / neu,MAGEA3,p53 nonmutant,NY-ESO-1,MelanA / MART1,Ras mutant,gp100,p53mutant,PR1,bcr-abl,tyrosinase,survivin,PSA,hTERT,a Sarcoma translocation breakpoint fusion protein,EphA2,PAP,ML-IAP,AFP,ERG,NA17,PAX3,ALK,androgen receptor,cyclin Bl,polysialic acid,MYCN,RhoC,TRP-2,fucosyl GM1,mesothelin(MSLN),PSCA,MAGE Al,MAGE-A3,sLe(animal),CYP1B1,PLAV1,GM3,BORIS,Tn,GloboH,ETV6-AML,NY-BR-1,RGS5,SART3,STn,Carbonic anhydrase IX,PAX5,OY-TESL Sperm protein 17,LCK,HMWMAA,AKAP-4,55X2,XAGE1,B7H3,Legumain,Tie 3,Page4,VEGFR2,MAD-CT-1,PDGFR-B,MAD-CT-2,ROR2,CMET,HER3,EPCAM,CA6,NAPI2B,TROP2,CLDN18.2, fibroblast activation protein (FAP), RON, LY6E, FRA, DLL3, PTK7, LIV1, ROR1, Fos-related antigen 1, VEGFR, endoglin, PD-L1, CD204, CD206, CD301, VTCN1, and VISTA and other disease-related antigens. .

[0025] Furthermore, the nucleic acid aptamer targets any one or more of C-MET and CD71 antigens.

[0026] In some specific embodiments, the nucleic acid aptamer targeting C-MET antigen has the nucleotide sequence shown in SEQ ID NO:1 (SL1) in the sequence list (ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGAT);

[0027] In some specific embodiments, the nucleic acid aptamer targeting CD71 antigen has the nucleotide sequence shown in SEQ ID NO: 2 (XQ2d) in the sequence list (ACTCATAGGGTTAGGGGCTGCTGGCCAGATACTCAGATGGTAGGGTTACTATGAGC);

[0028] Furthermore, the zwitterion is coupled to the 5' end or 3' end of the nucleic acid aptamer; in some specific embodiments, the nucleic acid aptamer is SL1, and the zwitterion is coupled to the 3' end of the nucleic acid aptamer, ie, a zwitterion-modified nucleic acid aptamer (SL1-TSB).

[0029] Furthermore, the nucleic acid aptamer is also connected to any one or more of drugs, liposomes, F bases, metal complexes, fluorescent dyes, and protein polypeptides. This coupling of different functional chemical groups is also called a functionalized nucleic acid aptamer.

[0030] In some specific embodiments, the nucleic acid aptamer is further coupled to auristatin E. More specifically, the nucleic acid aptamer is TSB-SL1-MMAE.

[0031] Furthermore, the number of zwitterions coupled to the nucleic acid aptamer is 1-100.

[0032] The present invention optimizes the number and sites of zwitterion modification by taking SL1 nucleic acid aptamer as the research object, and finds that the effect of coupling two trivalent zwitterions is better than that of coupling one, which may be because the anti-interference performance of zwitterions is enhanced as the number increases. Therefore, technicians in this field can adjust the number of zwitterions coupled to the nucleic acid aptamer according to the experimental purpose and the difficulty of operation; and the effect of coupling at the 3' end of the nucleic acid aptamer is better, which may be because the non-specific interference (plasma protein and cell surface adhesion) of SL1 at the 3' end is more serious, so the effect of modifying the zwitterion at the 3' end is more significant.

[0033] In another aspect, the present invention provides a method for preparing a nucleic acid aptamer complex, wherein the nucleic acid aptamer complex is the same as described above.

[0034] Furthermore, the coupling modes of the nucleic acid aptamer and the zwitterion include but are not limited to azide-alkyne, thiol-maleimide, amino-carboxyl and other efficient coupling chemical reactions.

[0035] In theory, the target zwitterion-modified aptamer can be successfully coupled to the target zwitterion-modified aptamer by different coupling methods, but because different structural modifications will cause different degrees of interference to the aptamer, it is necessary to select a coupling method with simple structure and efficient synthesis as much as possible for coupling. Usually, the coupling is performed by default using methods that do not affect anti-interference activity, toxic side effects or biological activity, such as amide bonds, thiol-maleimide, and click chemistry. Otherwise, it is difficult to explain whether the effect of the modified aptamer is due to the zwitterion or the structure of the coupling method. Therefore, as long as the coupling site structure is simple and reasonable, only the efficient coupling of the zwitterion is focused on. Therefore, the present invention compares the efficiency of different coupling methods and finds that the efficiency of azide-alkyne is the best, so this coupling method is preferred.

[0036] On the other hand, the present invention provides a use of a zwitterion for improving the ability of a nucleic acid aptamer to resist plasma interference and / or cell surface interference. The nucleic acid aptamer is the same as described above. In some specific embodiments, the zwitterion is a trivalent sulfobetaine.

[0037] The beneficial effects of the present invention include:

[0038] 1. Zwitterionic materials are considered to be a new generation of antifouling materials. Different from the hydrogen bond hydration of classic PEG modification, zwitterionic materials form a hydration layer through dipole minimization and electrostatic interaction, which is beneficial to resist nonspecific adsorption. While showing strong anti-adsorption ability, they have low immunogenicity. Before this, zwitterionic materials have not been applied to the modification of nucleic acid aptamers, and no studies have shown that zwitterionic modification can improve the anti-interference ability and other properties of nucleic acid aptamers.

[0039] 2. Compared with the existing technology, the zwitterion (ZwApt) coupled nucleic acid aptamer developed by the present invention is a new nucleic acid aptamer modification method, which has the characteristics of flexible construction, strong anti-interference and wide application. It can also be coupled with zwitterion modifications of different structures according to different application scenarios to improve the active targeting of nucleic acid aptamers to tumor sites, and has significant application transformation potential;

[0040] 3. The present invention has confirmed that while not affecting the binding of nucleic acid aptamers to targets, it also reduces the non-specific binding of nucleic acid aptamers to plasma contents and negative cells;

[0041] 4. The present invention confirms that zwitterion modification has less toxic side effects and can improve the biological activity of functionalized nucleic acid aptamers to a certain extent, avoiding the effects of conventional PEG modification on the performance and application of nucleic acid aptamers caused by immunogenicity, oxidative degradation characteristics and steric hindrance effects;

[0042] 5. The present invention also provides an optimization scheme for zwitterion valence, coupling mode, coupling number and position, further improving the performance of zwitterion-modified nucleic acid aptamers. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0044] Figure 1 : Zwitterionic modification enhances the ability of nucleic acid aptamers to specifically bind to targets in complex environments; TSB: trivalent sulfobetaine, negative cells: non-target cells; positive cells: target cells;

[0045] Figure 2 : Zwitterion modified structure library;

[0046] Figure 3 : Synthesis route of zwitterionic trivalent sulfobetaine (TSB); A to F correspond to products A to F described in Example 1, respectively;

[0047] Figure 4 :Synthetic route of zwitterionic trivalent sulfobetaine (TSB) coupled nucleic acid aptamer (type Ⅰ);

[0048] Figure 5 :Synthetic route of zwitterionic trivalent sulfobetaine (TSB) coupled functionalized nucleic acid aptamers (type II);

[0049] Figure 6 : Mass spectra of zwitter ion trivalent sulfobetaine (TSB) coupled to nucleic acid aptamer; Figure A is trivalent sulfobetaine zwitter ion (TSB) coupled to nucleic acid aptamer SL1 (SL1-TSB), Figure B is trivalent sulfobetaine zwitter ion (TSB) coupled to nucleic acid aptamer XQ2d (XQ2d-TSB), and Figure C is trivalent sulfobetaine zwitter ion (TSB) coupled to functionalized nucleic acid aptamer SL1-MMAE (TSB-SL1-MMAE);

[0050] Figure 7 : Experimental flow chart of the anti-interference performance of zwitterion-modified nucleic acid aptamers based on flow cytometry;

[0051] Figure 8 :The effect of zwitterion-modified nucleic acid aptamer (XQ2d-TSB) on anti-interference of plasma contents;

[0052] Fig. 9 :The effect of zwitterion-modified nucleic acid aptamer (SL1-TSB) on resisting nonspecific interference on cell membrane surface;

[0053] Fig.10 :The effect of zwitterion-modified nucleic acid aptamer (TSB-SL1-MMAE) against nonspecific interference of cell membrane surface proteins;

[0054] Fig.11 : The site and quantity of zwitterion (TSB) coupled to the aptamer;

[0055] Fig.12 :Synthesis route diagram of SL1-TSB-TSB;

[0056] Fig.13 : Synthesis route diagram of TSB-SL1-TSB;

[0057] Fig.14 :Effects of the number and sites of coupled zwitterions (TSB) on resistance to nonspecific binding on cell membrane surface. DETAILED DESCRIPTION

[0058] The present invention is further elaborated in detail below in conjunction with the accompanying drawings and specific embodiments of the specification. The embodiments are only used to explain the present invention and are not used to limit the scope of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in the field without making creative work are within the scope of protection of the present invention.

[0059] The reverse phase preparative column purification, desalting, seed plate, etc. involved in each step of the method described in the present invention are all conventional methods in the art, and can be determined by those skilled in the art in combination with the common sense in the art and the contents described in the present invention; the test methods used in the following embodiments are all conventional methods unless otherwise specified; the materials and reagents used are all reagents and materials that can be obtained from commercial channels unless otherwise specified; the nucleic acid aptamers of the present invention are named according to the position where the zwitterion is coupled to the nucleic acid aptamer, such as SL1-TSB represents that TSB is coupled to the 3' end of the nucleic acid aptamer SL1.

[0060] Explanation of relevant technical terms in the present invention:

[0061] Aptamer: A single-stranded DNA or RNA consisting of 20-60 bases.

[0062] Zwitterion: refers to a neutral molecule that carries both positive and negative charges and is electrically neutral overall. It is easily soluble in water and has strong hydration.

[0063] Functionalized nucleic acid aptamers: nucleic acid aptamers modified with specific chemical functional groups or protein peptides, so that they can play specific functions in detection, treatment, diagnosis, etc. For example, the nucleic acid aptamer SL1 is functionalized with the small molecule poison MMAE to construct the functionalized nucleic acid aptamer SL1-MMAE, so as to play the role of precise killing of targeted cells.

[0064] Derivatives: refers to products obtained by chemically modifying the structure of the original substance under specific conditions. This change may involve partial or overall changes in the molecular structure, but always maintains properties or functions similar to the original substance.

[0065] Example 1: Synthesis of zwitterions and their multivalent derivatives

[0066] The zwitterions and their multivalent derivatives include, but are not limited to, sulfobetaine monomers, trivalent sulfobetaines, azide-modified trivalent sulfobetaines, and zwitterions and their structural analogs containing different betaine unit types (such as phosphoric acid, carboxylic acid, etc.), different zwitterion valence states, different lengths, and different charge numbers (see Figure 2 ), wherein the active group is located on the nucleic acid aptamer and the zwitterion, and its function is to couple the zwitterion and the nucleic acid aptamer together. In this embodiment, the nucleic acid aptamer is preferably connected with dibenzocyclooctyne (DBCO), and the zwitterion has an azide group.

[0067] This example provides a synthetic route for sulfobetaine and trivalent sulfobetaine zwitterion (TSB) ( Figure 3 ), the specific steps are as follows:

[0068] 1.1 Synthetic product A

[0069] 14 g of 97% pure compound 3-[[2-(methacryloyloxy)ethyl]dimethylammonium]propionate (Shanghai MacLean Biochemical Technology Co., Ltd.) was taken into a 100 ml round-bottom flask, a magnetic bar was added in advance, methanol was added, and the mixture was placed in a magnetic stirrer, ice bath, 400 rpm; 8 ml of 97% pure reactant N,N-dimethyl-1,3-diaminopropane (Shanghai MacLean Biochemical Technology Co., Ltd.) was taken into the above round-bottom flask, and the mixture was reacted at 0°C for 1 hour. , followed by reaction at room temperature for 12 hours; the reaction solution was evaporated under reduced pressure and then redissolved in distilled water, extracted with dichloromethane, dried over anhydrous sodium sulfate, and evaporated under reduced pressure and then purified by silica gel column chromatography (dichloromethane: methanol volume ratio = 10: 1) to obtain a light yellow transparent oily liquid N-Boc-dimethylaminopropylamine product (product A) with a yield of 78%. The yield was calculated as actual yield / theoretical yield × 100%, wherein the theoretical yield was calculated by the mass of the input raw materials (convertible molar mass).

[0070] 1.2 Synthesis of product B

[0071] 5.87 g of the above product A was taken into a round-bottom flask, and 240 ml of anhydrous dimethylformamide (Shanghai MacLean Biochemical Technology Co., Ltd.) was added, and the mixture was placed in a magnetic stirrer at 500 rpm; 5.37 g of 97% pure 1,3-propane sultone (Shanghai MacLean Biochemical Technology Co., Ltd.) was taken into the above round-bottom flask and reacted at room temperature for 48 hours until the reaction of the N-Boc-dimethylaminopropylamine raw material was complete as monitored by thin layer chromatography; after the reaction solution was evaporated by rotary evaporation under reduced pressure (Pland (Shanghai) Trading Co., Ltd.), the product was added to 100 ml of ether (Shanghai MacLean Biochemical Technology Co., Ltd.) The product was recrystallized from 1,4-dichloro-2-yl-1-nitropropane (Shanghai Mecklen Biochemical Technology Co., Ltd.) and stirred for 30 minutes. The solvent was extracted by vacuum filtration to remove excess sultone. The solid after filtration was redissolved in distilled water, extracted with 100 ml of dichloromethane (Shanghai Mecklen Biochemical Technology Co., Ltd.), dried over anhydrous sodium sulfate (Shanghai Mecklen Biochemical Technology Co., Ltd.), and rotary evaporated under reduced pressure. The product was purified by silica gel chromatography (same as described in step "1.1") to obtain a white colloidal solid 3-((3-(tert-butoxycarbonyl)amino)propyl)dimethylammonio)propane-1-sulfonate product (Product B) with a yield of 40%.

[0072] 1.3 Synthesis of Product C

[0073] 0.4 ml of 10 mol / ml hydrochloric acid was dissolved in 0.6 ml of 97% pure 1,4-dioxane (Shanghai MacLean Biochemical Technology Co., Ltd.), mixed, the mixed solution was pipetted into a round-bottom flask, and 12 ml of dichloromethane (Shanghai MacLean Biochemical Technology Co., Ltd.) solvent was added, 700 mg of product B was added at 0°C, and heated to room temperature, the process took about 30 minutes; then the reaction was continued at room temperature for 20 minutes, and the solvent was evaporated; by repeated recrystallization in dichloromethane / isopropanol / methanol (Shanghai MacLean Biochemical Technology Co., Ltd.) (volume ratio = 10 / 5 / 1) solvent, a white solid 3-((3-aminopropyl)dimethylammonio)propane-1-sulfonate product (product C) was obtained with a yield of 55%.

[0074] 1.4 Synthetic product D

[0075] 15 mg of 1-hydroxybenzotriazole (HOBT) (Shanghai MacLean Biochemical Technology Co., Ltd.) and 60 mg of 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDCl) (Shanghai MacLean Biochemical Technology Co., Ltd.) were weighed into a reaction tube, the reaction tube was sealed, and the air in the reaction tube was replaced with nitrogen; 40 mg of 3-[2-benzyloxycarbonylamino-3-(2-carboxy-ethoxy)-2-(2-carboxy-ethoxymethyl)-propoxy]-propionic acid (Shanghai MacLean Biochemical Technology Co., Ltd.) was weighed into a 1.5 ml centrifuge tube, dissolved in 1 ml of anhydrous dimethylformamide (Shanghai MacLean Biochemical Technology Co., Ltd.), and added to the above reaction tube; a small amount of triethylamine ( Shanghai MacLean Biochemical Technology Co., Ltd.), mixed and added to the reaction tube; 80 mg of product C was dissolved in 0.35 ml of distilled water, added to the reaction tube, and the reaction tube was placed in a magnetic stirrer for reaction at room temperature for 36 hours; the reaction solution was evaporated under reduced pressure and purified by a reverse phase C18 column (purification within 0-20 minutes, the volume ratio of methanol: water changed from 0-20%) to obtain a white solid 14-(((benzyloxy)carbonyl)amino)-14-((3-((3-(dimethyl(3-sulfonylpropyl)ammonio)propyl)amino)-3-oxopropoxy)methyl)-4,4,24,24-tetramethyl-9,19-dioxo-12,16-dioxa-4,8,20,24-tetraazacyclooxane-4,24-diammonium-1,27-disulfonate product (product D) with a yield of 51%.

[0076] 1.5 Synthetic product E

[0077] 44 mg of product D and 6 mg of 10% palladium on carbon (Shanghai MacLean Biochemical Technology Co., Ltd.) were added to a 25 ml round-bottom flask, and 2 ml of methanol (Shanghai MacLean Biochemical Technology Co., Ltd.) was added. The air in the round-bottom flask was replaced with a hydrogen environment, and the mixture was placed in a magnetic stirrer. The mixture was reacted at room temperature for 12 hours and purified by filtration to obtain a white solid 14-amino-14-((3-((3-(dimethyl(3-sulfonylpropyl)ammonium)propyl)amino)-3-oxopropoxy)methyl)-4,4,24,24-tetramethyl-9,19-dioxo-12,16-dioxa-4,8,20,24-tetrazolyl-4,24-diamine-1,27-disulfonate product (product E) with a yield of 50%.

[0078] 1.6 Synthesis of Product F

[0079] 14 mg of product E was dissolved in anhydrous dimethyl sulfoxide (Shanghai MacLean Biochemical Technology Co., Ltd.), and then 40 mg of 2,5-dioxopyrrolidin-1-yl 2-(2-(2-(2-azido)ethoxy)ethoxy)acetate (Shanghai MacLean Biochemical Technology Co., Ltd.) and a small amount of triethylamine (Shanghai MacLean Biochemical Technology Co., Ltd.) were added in sequence. The mixture was reacted at 37°C for 12 hours and purified by reverse phase C18 column to obtain a white solid 14-((3-((3-((3-((λ 1 -oxyethyl)dioxo-λ 6 The product, trivalent sulfobetaine zwitterion (TSB, product F), was prepared by mixing with 4,4,24,24-tetramethyl-9,19-dioxo-12,16-dioxa-4,8,20,24-tetraazaoxadicyclo-4,24-diammonium-1,27-disulfonate (TSB, product F) in a yield of 29%.

[0080] Example 2: Preparation and purification of zwitterion-modified nucleic acid aptamers

[0081] This example provides two types (type I and type II) of TSB-coupled nucleic acid aptamers. The synthetic routes are shown in Figure 4-5 , wherein the TSB-coupled nucleic acid aptamer in type I is a conventional nucleic acid sequence that is not modified by drug molecules and has a dibenzocyclooctyne active group at the 3' end (preferably SL1 (SEQ ID NO: 1) and XQ2d (SEQ ID NO: 2) in this embodiment, which specifically target C-MET antigen and CD71 antigen, respectively) ( Figure 4), the aptamer coupled to TSB in type II (preferably SL1 (SEQ ID NO: 1) in this embodiment, which specifically targets C-MET antigen) has a dibenzocyclooctyne active group at the 5' end and a drug molecule at the 3' end (preferably Vc-MMAE (monomethyl auristatin E) in this embodiment, which is a synthetic analog of sea dolitoxin that causes cell death by destroying the microtubule network), so it has certain therapeutic effects and is therefore also called a functionalized aptamer (preferably SL1-MMAE molecule in this embodiment) ( Figure 5 ); the specific experimental steps are as follows:

[0082] The nucleic acid aptamer (SL1 or XQ2d synthesized by Sangon Biotech (Shanghai) Co., Ltd.) or the functionalized nucleic acid aptamer (SL1-MMAE molecule, purchased from Sangon Biotech (Shanghai) Co., Ltd.) was dissolved in 30 μl of distilled water to prepare a solution with a concentration of 133 μmol / L, and then 10 μl of 2,000 μmol / L trivalent sulfobetaine zwitterion (preparation method see Example 1) was added, and after mixing, 40 μl of nucleic acid aptamer solution with a final concentration of 100 μmol / L was obtained, and the mixture was reacted at 37°C for 12 hours. The nucleic acid aptamer that resists nonspecific binding in complex environments was purified by reverse phase preparative column and freeze-dried. Due to the loss in the purification process, the yield was about 90%. After desalting, it was freeze-dried for use. The three TSB-coupled nucleic acid aptamers SL1-TSB

[0083]

[0084] XQ2d-TSB and

[0085] TSB-SL1-MMAE The mass spectrometry results are as follows Figure 6 As shown; it should be understood that in order to achieve the purpose of efficiently detecting nucleic acid aptamers and evaluating their performance, all nucleic acid aptamers used for flow cytometry detection in the present invention carry a fluorescent group (the fluorescent group is: cyanine 5 (Cy5) dye, and the nucleic acid aptamer with a fluorescent group is synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.).

[0086] It can be understood that the solution for dissolving the nucleic acid aptamer can be deionized water, triethylammonium acetate buffer, phosphate buffer or any combination thereof, and deionized water is preferred in this embodiment; the reaction solvent can be triethylammonium acetate buffer, deionized water, phosphate buffer and acetonitrile, dimethyl sulfoxide, dimethylformamide or any combination thereof, and deionized water is preferred in this embodiment; the separation and purification of zwitterion-modified nucleic acid aptamers can be separated and purified using one of high performance liquid chromatography, hydrophobic interaction chromatography, and ion exchange chromatography, and high performance liquid chromatography is preferred in this embodiment; the functionalized nucleic acid aptamers in the multivalent zwitterion-coupled functionalized nucleic acid aptamers include but are not limited to functionalized nucleic acid aptamers constructed by cytotoxic drug monomethyl auristatin E (Vc-MMAE), liposomes, F bases, metal complexes, fluorescent dyes and other functional groups, and functionalized nucleic acid aptamers constructed by protein and polypeptide modification, and Vc-MMAE is preferred in this embodiment; the coupling mode of nucleic acid aptamers and multivalent zwitterions includes azide-alkyne, thiol-maleimide, amino-carboxyl and other efficient coupling chemistries, and azide-alkyne is preferred in this embodiment. It should be understood that this example only provides a representative synthesis method of TSB-coupled nucleic acid aptamers, and a more specific synthesis scheme can be further optimized according to the experimental purpose and the theoretical knowledge and experience of professionals.

[0087] In addition, the sites where zwitterions or multivalent derivatives are coupled to nucleic acid aptamers include but are not limited to the 3' end or 5' end of the nucleic acid aptamer, and also include single or multiple other sequence sites of nucleic acid aptamers. According to needs, single or multiple zwitterions or multivalent derivatives can be coupled to different positions of the nucleic acid aptamer using "click chemistry".

[0088] Example 3: Study on the anti-interference performance of zwitterion-modified nucleic acid aptamers in plasma contents

[0089] In this example, XQ2d and XQ2d-TSB aptamers and their target cells HCT116 were selected to explore the performance of zwitterion-modified aptamers in resisting interference from plasma contents. The experimental flow chart is shown in FIG. Figure 7 The specific experimental process is as follows:

[0090] 3.1 Preparation of cell suspension

[0091] Excess HCT116 cells (Cell Bank, Chinese Academy of Sciences) were washed twice with Dulbecco's phosphate buffer (Thermo Fisher Scientific), and 1.5 ml of trypsin-free digestion solution (Thermo Fisher Scientific) was added for digestion at 37°C for 5 min to digest cells that do not express the nucleic acid aptamer target protein; after centrifugation at 1,000 rpm for 3 min, the trypsin-free digestion solution was aspirated, and 3 ml of 1640 cell culture medium (Thermo Fisher Scientific) was added and pipetted evenly. The cell density was adjusted to 5×10 by counting with a cell counting plate. 6 / ml; according to the corresponding cell number 5×10 6 1 ml of cell suspension was added to a new 15 ml centrifuge tube and centrifuged at 1,000 rpm for 3 minutes. The 1640 cell culture medium (i.e., supernatant) was aspirated and 2 ml of binding buffer was added. The formula of the binding buffer (total volume 10 ml) was as follows: 10 mg of bovine serum albumin (Shanghai Titan Technology Co., Ltd.), 9.9 ml of washing buffer (2.5 ml of 1 mol / L magnesium chloride solution was added to 500 ml of Dulbecco's phosphate buffer, and the solution volume was supplemented to 9.9 ml with sterile water) and 100 μl of transfer RNA (tRNA, (Sigma-Aldrich, USA)). After thorough mixing, 200 μl of cell suspension was added to each group of 1.5 ml centrifuge tubes in turn. The number of cells in each tube was 5×10 5 .

[0092] 3.2 Preparation of nucleic acid samples

[0093] The nucleic acid aptamers (XQ2d and XQ2d-TSB) were configured as high-concentration storage solutions of the same concentration (43.8 μmol / L); 140 μL of Dulbecco's phosphate buffer or plasma was added to a 200 μL centrifuge tube in advance; 8.5 μL of the high-concentration nucleic acid storage solution was added to the above-mentioned Dulbecco's phosphate buffer (sample 1, as a positive control), and in addition, 2 μL (sample 3) or 8.5 μL (sample 2) of the high-concentration nucleic acid storage solution was added to the above-mentioned plasma. The above-mentioned systems were all placed in a 200 μL centrifuge tube.

[0094] After the prepared nucleic acid incubation samples (samples 1 to 3) were quickly and thoroughly vortexed on a vortexer, they were incubated at 37°C for 10 minutes. After the incubation, the corresponding volumes of incubation samples (i.e., 32 μl of Dulbecco's phosphate buffer (sample 1), 32 μl of sample 2, and 128 μl of sample 3) were drawn and added to the cell suspension prepared in step "3.1". In order to ensure that the nucleic acid content in each tube of cell suspension in each group was consistent, binding buffer was added to each centrifuge tube containing cell suspension. The volume of binding buffer added = total binding volume 400 μl - cell suspension 200 μl - subsequent addition of nucleic acid. The volume of the acid sample was mixed with a 1 ml pipette tip, placed in an ice box, protected from light, and combined on a shaker for 30 minutes; centrifuged at 1,300 rpm for 4 minutes at 4°C; the supernatant was aspirated, and the sample was washed again twice with 500 μl of washing buffer before being placed on a flow cytometer (Thermo Fisher Scientific); in addition to sample 1 (positive control), this experiment also had two controls: Control-40A refers to a non-targeting nucleic acid sequence composed of 40 adenine deoxyribonucleotides (synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.), which was used as a negative control, and the rest of the preparation steps were the same as described above; Cell only-HCT116 means that the sample only contains HCT116 cells, and no nucleic acid aptamers are added. The results of the ability of nucleic acid aptamers to resist plasma interference are shown in Figure 2. Figure 8 shown.

[0095] The results show that plasma affects the efficiency of XQ2d and XQ2d-TSB aptamers in targeting HCT116 cells to varying degrees, but after the XQ2d aptamer is modified with TSB, the interference of plasma on the aptamer is alleviated. Specifically, compared with the peak graph of XQ2d, the fluorescence intensity of the XQ2d-TSB peak (the horizontal axis represents the fluorescence intensity, and the fluorescence intensity gradually increases from left to right) is closer to sample 1, indicating that the TSB-modified XQ2d is more able to bind to the target cells than XQ2d, that is, it is less affected by plasma interference. At the same time, the above-mentioned anti-plasma interference performance test was also carried out on SL1-TSB and TSB-SL1-MMAE, and the test results were consistent with those of XQ2d-TSB, among which XQ2d-TSB was the most representative.

[0096] In summary, modifying nucleic acid aptamers with zwitterions can effectively resist the adsorption of nucleic acid aptamers by plasma proteins.

[0097] In addition to the flow cytometry used in this example, biochemical methods such as mass spectrometry, chromatography, gel electrophoresis, confocal microscopy imaging, and kits can also be used to characterize the anti-non-target cell interference effect of zwitterion-coupled nucleic acid aptamers, and the conclusions obtained by these methods should also be consistent with those of flow cytometry.

[0098] Example 4: Study on the anti-cell surface nonspecific interference performance of zwitterion-modified nucleic acid aptamers

[0099] In this example, SL1 and SL1-TSB nucleic acid aptamers and target non-expressing cell lines (HEK293T, NCI-H661, Ramos and Miapaca2), SL1-MMAE and TSB-SL1-MMAE and non-target cells (HEK293T cells) were selected to explore the performance of zwitterion-modified nucleic acid aptamers in resisting nonspecific interference on the cell surface. The specific experimental process is as follows:

[0100] The negative HEK293T cells (Cell Bank of the Chinese Academy of Sciences) were digested with trypsin-free digestion solution and counted using a cell counting plate. The number of cells was 5×10 5 / tube, transfer the cells to a centrifuge tube, centrifuge at 1,000 rpm for 3 minutes, discard the supernatant, add 400 μl of pre-cooled binding buffer (the components are the same as those described in Example 3); add an equal amount of nucleic acid aptamer to make the final concentration of the nucleic acid aptamer in the binding buffer 200 nanomoles / liter, shake and mix well, put it in an ice box, shake and incubate it on a shaker in the dark for 40 minutes; wash it with washing buffer 2-3 times, and analyze it by flow cytometry; at the same time, set up 2 controls: Control-40A refers to a nucleic acid sequence without targeting ability composed of 40 adenine deoxyribonucleotides, this sample is used as a negative control, and the rest of the preparation steps are the same as above; Cell only means that the sample contains only negative cells and no nucleic acid aptamer is added. The flow analysis steps of NCI-H661, Ramos and Miapaca2 cell lines are the same as above.

[0101] like Fig. 9 As shown in the figure, no matter which negative cell is bound, the fluorescence intensity in the SL1-TSB flow cytometry results (the horizontal axis represents the fluorescence intensity, and the fluorescence intensity gradually increases from left to right) is lower than that of the SL1 flow cytometry results, indicating that the TSB-modified SL1 is less affected by cell surface interference than SL1. This shows that the binding force of the zwitterion-modified nucleic acid aptamer (SL1-TSB) to the four negative cells is lower than that of the nucleic acid aptamer (SL1). Among them, when the negative cell objects are HEK293T and Miapaca2 cells, the anti-cell surface nonspecific binding effect is the best; in addition, the results of TSB-SL1-MMAE are consistent with those of SL1-TSB ( Fig.10 ), which further confirmed that zwitterion-modified aptamers can effectively resist nonspecific binding to the cell membrane surface, regardless of whether the aptamer is coupled to a drug.

[0102] In addition to the flow cytometry used in this example, biochemical methods such as mass spectrometry, chromatography, gel electrophoresis, confocal microscopy imaging, and kits can also be used to characterize the anti-non-target cell interference effect of zwitterion-coupled nucleic acid aptamers, and the conclusions obtained by these methods should also be consistent with those of flow cytometry.

[0103] Example 5: Effect of the number of zwitterionic monomers on zwitterionic modified nucleic acid aptamers

[0104] Theoretically, as the number of monomers in the zwitterions increases, the ability of the modified aptamer to resist plasma interference and nonspecific adsorption on the cell surface also increases. However, the increase in the number of monomers will inevitably lead to a larger molecular structure, which may affect the local conformation of the aptamer, thereby hindering the binding of the aptamer to the target. Therefore, in this example, monovalent (one monomer) and trivalent (three monomers) sulfobetaines were synthesized respectively (the synthesis of trivalent sulfobetaines was the same as in Example 1; the synthesis of monovalent sulfobetaines was carried out by Figure 3 The product C in the reaction mixture was reacted with 2,5-dioxopyrrolidin-1-yl 2-(2-(2-(2-azido)ethoxy)ethoxy)acetate (Shanghai MacLean Biochemical Technology Co., Ltd.) and a small amount of triethylamine (Shanghai MacLean Biochemical Technology Co., Ltd.) at 37°C for 12 hours and purified by a reverse phase C18 column. These zwitterions with different valence states were coupled to SL1 or SL1-MMAE nucleic acid aptamers (the coupling method was the same as that described in Example 2), and then the anti-interference ability of nucleic acid aptamers modified with zwitterions with different valence states was evaluated according to the steps described in Example 3 and Example 4 (the negative cells combined in this example were HEK293T cells).

[0105] The results show that within a certain valence range (number of monomers <3), as the number of zwitterion monomers increases, the anti-plasma interference and anti-cell surface nonspecific adsorption capabilities of the modified nucleic acid aptamer also increase; it should be understood that in order to reduce steric hindrance and ensure a certain synthesis efficiency, only trivalent sulfobetaines were synthesized in this embodiment, but sulfobetaines of different valences can be designed and synthesized according to the needs and purposes of technicians. In short, this embodiment preferably uses trivalent zwitterions to modify nucleic acid aptamers.

[0106] Example 6: Effect of coupling mode on zwitterion-modified nucleic acid aptamers

[0107] Theoretically, zwitterions can also be successfully coupled to nucleic acid aptamers through different coupling methods (preferably azide-alkyne in Example 2), but the coupling efficiency will vary; in addition, different structural modifications will also cause different degrees of interference to nucleic acid aptamers, so it is best to choose a coupling method with simple structure and efficient synthesis for coupling. Therefore, this example explores the efficiency of three coupling methods of azide-alkyne, thiol-maleimide, and amino-carboxyl to generate SL1-TSB, wherein the azide-alkyne coupling step is the same as that described in Example 2, and the thiol-maleimide and amino-carboxyl coupling steps are: the TSB-coupled nucleic acid aptamer is a conventional nucleic acid sequence that is not modified by drug molecules and has a thiol or carboxyl active group connected to the 3' end or 5' end. The specific experimental steps are as follows:

[0108] The nucleic acid aptamer (SL1 synthesized by Sangon Biotech (Shanghai) Co., Ltd.) was dissolved in 30 μl of distilled water to prepare a solution with a concentration of 133 μmol / L, and then 10 μl of 2,000 μmol / L of trivalent sulfobetaine zwitterions corresponding to the nucleic acid aptamer active groups (i.e., nucleic acid aptamers modified with thiol active groups correspond to zwitterions modified with maleimide; nucleic acid aptamers modified with carboxyl active groups correspond to zwitterions modified with amino groups) were added, and after mixing, 40 μl of nucleic acid aptamer solution with a final concentration of 100 μmol / L was obtained, and the solution was reacted at 37°C for 12 hours. The nucleic acid aptamer with nonspecific binding resistance to complex environments was purified by reverse phase preparative column and freeze-dried, and then desalted and freeze-dried for use.

[0109] The results showed that the yields of the three coupling methods, namely, azide-alkyne, amino-carboxyl, and thiol-maleimide, were 90%, <5%, and 50%, respectively. Among them, the coupling efficiency of azide-alkyne was the highest, and that of amino-carboxyl was the lowest. Specifically, when the nucleic acid aptamer and zwitterion carried carboxyl and amino groups, respectively, even when the equivalent ratio of nucleic acid aptamer: zwitterion = 1:200, the reaction efficiency was extremely low, and there was almost no product. This may be due to the influence of factors such as the high hydrophilicity of zwitterions and nucleic acid aptamers themselves, as well as steric hindrance. Therefore, the azide-dibenzocyclooctyne method was optimized to couple nucleic acid aptamers.

[0110] Example 7: Effects of the number and sites of zwitterion coupling on zwitterion-modified nucleic acid aptamers

[0111] As described in Example 2, a single or multiple zwitterions can be coupled to any site of the aptamer using the "click chemistry" method ( Fig.11 On the other hand, because the more zwitterions there are, the wider the coverage of its hydration effect is, and it can resist a wider range of nonspecific interference. Therefore, SL1-TSB-TSB were synthesized in this embodiment. TSB-SL1-TSB and SL1-TSB, and the ability of the above three nucleic acid aptamers to resist nonspecific binding in negative cells was detected by the method described in Example 4. The synthesis steps of the TSB-coupled nucleic acid aptamer SL1 are as follows:

[0112] 8.1 Synthesis steps of SL1-TSB-TSB

[0113] Synthesis circuit diagram see Fig.12 .

[0114] The nucleic acid aptamer (SL1 modified with two dibenzocyclooctyne (DBCO) active groups at the 3' end was synthesized by Sangon Biotech (Shanghai) Co., Ltd.) was dissolved in 30 μl of distilled water to prepare a solution with a concentration of 133 μmol / L, and then 20 μl of 2,000 μmol / L trivalent sulfobetaine zwitterion (preparation method see Example 1) was added, mixed, reacted at 37°C for 12 hours, and 50 μl of nucleic acid aptamer solution with a final concentration of 80 μmol / L was obtained. The nucleic acid aptamer with resistance to nonspecific binding in complex environments was purified by reverse phase preparative column and freeze-dried. Due to the loss in the purification process, the yield was about 90%, and it was freeze-dried for use after desalting.

[0115] 8.2 Synthesis steps of TSB-SL1-TSB

[0116] Synthesis circuit diagram see Fig.13 .

[0117] The nucleic acid aptamer (SL1 modified with a dibenzocyclooctyne (DBCO) active group at each of the 3' and 5' ends was synthesized by Sangon Biotech (Shanghai) Co., Ltd.) was dissolved in 30 μl of distilled water to prepare a solution with a concentration of 133 μmol / L, and then 20 μl of 2,000 μmol / L trivalent sulfobetaine zwitterion (preparation method see Example 1) was added, mixed, reacted at 37°C for 12 hours, and 50 μl of nucleic acid aptamer solution with a final concentration of 80 μmol / L was obtained. The nucleic acid aptamer that resists nonspecific binding in complex environments was purified by reverse phase preparative column and freeze-dried. Due to the loss in the purification process, the yield was about 90%, and it was freeze-dried for use after desalting.

[0118] 8.3 The synthesis steps of SL1-TSB are the same as those described in Example 2.

[0119] The results are as follows Fig.14As shown in the figure, the order of TSB-coupled aptamer SL1 molecules with strong to weak binding force to HEK293T cells (target non-expressing cells) is: SL1-TSB>TSB-SL1-TSB>SL1-TSB-TSB, indicating that with the increase in the number of zwitterion modifications at the 3' end of the aptamer (SL1), the ability to resist cell surface interference is also enhanced. In other words, increasing the number of zwitterion couplings can improve the ability of the aptamer to resist cell surface interference; the newly added zwitterion coupling to the 3' end of the aptamer has a stronger enhancement effect than coupling to the 5' end, which may be because the non-specific interference of SL1 at the 3' end (i.e., the adhesion of plasma proteins and cell surfaces to SL1) is more serious, and the TSB modification just protects SL1.

[0120] It should be understood that the effect of coupling different numbers of zwitterions is regular, that is, within a certain range, the more zwitterions are coupled, the better the performance of the aptamer is improved; on the contrary, the modification effect of different sites depends on the sequence and conformation of the aptamer itself, which means that in some cases, modifying the zwitterion to the 5' end of the aptamer is more effective, while in other cases, modifying it to the 3' end is better, and the aptamer SL1 belongs to the latter case.

[0121] The above shows and describes the basic principles and main features of the present invention and the advantages of the present invention. For those skilled in the art, it is obvious that the present invention is not limited to the details of the above exemplary embodiments, and the present invention can be implemented in other specific forms without departing from the spirit or basic features of the present invention; therefore, no matter from which point of view, the embodiments should be regarded as exemplary and non-restrictive. The scope of the present invention is limited by the attached claims rather than the above description. Therefore, it is intended to include all changes within the meaning and scope of the equivalent elements of the claims in the present invention, and any figure marks in the claims should not be regarded as limiting the claims involved.

[0122] References

[0123] (1) Li, J.; Mo, L.; Lu, C.-H.; Fu, T.; Yang, H.-H.; Tan, W. Functional nucleicacid-based hydrogels for bioanalytical and biomedical applications. ChemicalSociety Reviews 2016, 45(5), 1410-1431.

[0124] (2)Poon,W.;Kingston,B.R.;Ouyang,B.;Ngo,W.;Chan,W.C.W.A framework fordesigning delivery systems.Nature Nanotechnology 2020,15(10),819-829.

[0125] (3)Zhang,Y.;Wu,J.L.Y.;Lazarovits,J.;Chan,W.C.W.An Analysis of theBinding Function and Structural Organization of the Protein Corona.Journal ofthe American Chemical Society 2020,142(19),8827-8836.

[0126] (4)Ding,D.;Zhang,Y.;Sykes,E.A.;Chen,L.;Chen,Z.;Tan,W.The influence ofphysiological environment on the targeting effect of aptamer-guided goldnanoparticles.Nano Research 2019,12(1),129-135.

[0127] (5)Liu,J.;Ren,Z.;Sun,Y.;Xu,L.;Wei,D.;Tan,W.;Ding,D.Investigation ofthe Relationship between Aptamers’Targeting Functions and Human PlasmaProteins.ACS Nano 2023,17(23),24329-24342.

[0128] (6)Chen,B.-M.;Cheng,T.-L.;Roffler,S.R.Polyethylene GlycolImmunogenicity:Theoretical,Clinical,and Practical Aspects of Anti-Polyethylene Glycol Antibodies.ACS Nano 2021,15(9),14022-14048.

[0129] (7)Zhang,P.;Sun,F.;Liu,S.;Jiang,S.Anti-PEG antibodies in the clinic:Current issues and beyond PEGylation.Journal of Controlled Release 2016,244,184-193.

[0130] (8)Ju,Y.; J.M.;Simon,V.;Dawson,K.;Krammer,F.;Kent,S.J.Impact ofanti-PEG antibodies induced by SARS-CoV-2mRNA vaccines.Nature ReviewsImmunology 2023,23(3),135-136.

[0131] (9)Keefe,A.J.;Jiang,S.Poly(zwitterionic)protein conjugates offerincreased stability without sacrificing binding affinity orbioactivity.Nature Chemistry 2012,4(1),59-63.

[0132] (10)Baumann,A.;Tuerck,D.;Prabhu,S.;Dickmann,L.;Sims,J.Pharmacokinetics,metabolism and distribution of PEGs and PEGylatedproteins:quo vadis?Drug Discovery Today 2014,19(10),1623-1631.

[0133] (11)Gao,Q.-Q.;Zhang,C.-M.;Zhang,E.-X.;Chen,H.-Y.;Zhen,Y.-H.;Zhang,S.-B.;Zhang,S.-F.Zwitterionic pH-responsive hyaluronic acid polymer micelles fordelivery of doxorubicin.Colloids and Surfaces B:Biointerfaces2019,178,412-420.

[0134] (12)Sun,H.;Chang,M.Y.Z.;Cheng,W.-I.;Wang,Q.;Commisso,A.;Capeling,M.;Wu,Y.;Cheng,C.Biodegradable zwitterionic sulfobetaine polymer and itsconjugate with paclitaxel for sustained drug delivery.Acta Biomaterialia2017,64,290-300.

[0135] (13)Debayle,M.;Balloul,E.;Dembele,F.;Xu,X.;Hanafi,M.;Ribot,F.;Monzel,C.;Coppey,M.;Fragola,A.;Dahan,M.;et al.Zwitterionic polymer ligands:an idealsurface coating to totally suppress protein-nanoparticlecorona formation?Biomaterials 2019,219,119357.

[0136] (14)Li,M.;Zhang,W.;Li,J.;Qi,Y.;Peng,C.;Wang,N.;Fan,H.;Li,Y.Zwitterionic polymers:Addressing the barriers for drug delivery.ChineseChemical Letters 2023,34(11),108177.

[0137] (15)Harijan,M.;Singh,M.Zwitterionic polymers in drug delivery:Areview.Journal of Molecular Recognition 2022,35(1),e2944.

[0138] (16)Leng,C.;Sun,S.;Zhang,K.;Jiang,S.;Chen,Z.Molecular level studieson interfacial hydration of zwitterionic and other antifouling polymers insitu.Acta Biomaterialia 2016,40,6-15.

[0139] (17)Jiang,S.;Cao,Z.Ultralow-Fouling,Functionalizable,and HydrolyzableZwitterionic Materials and Their Derivatives for BiologicalApplications.Advanced Materials 2010,22(9),920-932.

[0140] (18)Li,B.;Jain,P.;Ma,J.;Smith,J.K.;Yuan,Z.;Hung,H.-C.;He,Y.;Lin,X.;Wu,K.;Pfaendtner,J.;et al.Trimethylamine N-oxide-derived zwitterionicpolymers:A new class of ultralow fouling bioinspired materials.ScienceAdvances 2019,5(6),eaaw9562.

[0141] SEQ ID NO:1

[0142] SL1

[0143] ATCAGGCTGGATGGTAGCTCGGTCGGGGTGGGTGGGTTGGCAAGTCTGAT

[0144] SEQ ID NO:2

[0145] XQ2d

[0146] ACTCATAGGGTTAGGGGCTGCTGGCCAGATACTCAGATGGTAGGGTTACTATGAGC。

Claims

1. A nucleic acid aptamer complex, characterized in that: The complex comprises a zwitterion and a nucleic acid aptamer, and the zwitterion and the nucleic acid aptamer are coupled together through a chemical bond.

2. The nucleic acid aptamer complex according to claim 1, wherein The zwitterions include, but are not limited to, sulfobetaine, carboxybetaine, phosphorylcholine and derivatives thereof.

3. The nucleic acid aptamer complex according to claim 2, characterized in that: The zwitterions include but are not limited to and its derivatives.

4. The nucleic acid aptamer complex according to claim 1, characterized in that The number of monomers in the zwitterion is 1-6.

5. The composite according to claim 1, characterized in that The chemical bonds include, but are not limited to, chemical bonds constructed by common coupling methods such as carboxylic acid-amino, thiol-maleimide, N-hydroxysuccinimide-amino, and alkyne-azide.

6. The nucleic acid aptamer complex according to claim 1, characterized in that Preferred strains containing a range of CD5, CD19, CD20, CD25, CD37, CD30, CD33, CD45, CAMPATH-1, HLD -DR,carcinoembryonic antigen,TAG-72,EpCAM,MUC1,MUC15,folate-binding protein,A33,G250,prostate-specific membrane antigen,ferritin,GD2,GD3,GM2,Leg,CA-125,CA19-9,epidermal growth factor,p185HER2,IL-2receptor,tenascin,a metalloproteinase,endosialin,vascular endothelial growth factor,avB3,WT1,LMP2,HPV E6,HPV E7,EGFRvIII,Her-2 / neu,MAGE A3,p53 nonmutant,NY-ESO-1,MelanA / MART1,Rasmutant,gp100,p53 mutant,PR1,bcr-abl,tyrosinase,survivin,PSA,hTERT,a Sarcomatranslocation breakpointfusion protein,EphA2,PAP,ML-IAP,AFP,ERG,NA17,PAX3,ALK,androgen receptor,cyclin Bl,polysialic acid,MYCN,RhoC,TRP-2,fucosyl GM1,mesothelin,PSCA,MAGEAl,MAGE-A3,sLe,CYP1B1,PLAV1,GM3,BORIS,Tn,GloboH,ETV6-AML,NY-BR-1,RGS5,SART3,STn,Carbonic anhydrase IX,PAX5,OY-TESL Sperm protein 17,LCK,HMWMAA,AKAP-4,55X2,XAGE1,B7H3,Legumain,Tie 3,Page4,VEGFR2,MAD-CT-1,PDGFR-B,MAD-CT-2,ROR2,CMET,HER3,EPCAM,CA6,NAPI2B,TROP2,CLDN18.2,fibroblast activation protein,RON,LY6E,FRA,DLL3,PTK7,LIV1,ROR1,Fos-related antigen 1,VEGFR,endoglin,PD-L1,CD204,CD206,CD301,VTCN1,and VISTA and other disease-related antigens. .

7. The nucleic acid aptamer complex according to claim 1, characterized in that The nucleic acid aptamer is also connected to any one or more of drugs, liposomes, F bases, metal complexes, fluorescent dyes, and protein polypeptides.

8. A method for preparing a nucleic acid aptamer complex, characterized in that: The nucleic acid aptamer complex is as described in any one of claims 1 to 7.

9. The method according to claim 8, characterized in that The coupling methods of the nucleic acid aptamer and the zwitterion include, but are not limited to, efficient coupling chemical reactions such as azide-alkyne, thiol-maleimide, and amino-carboxyl.

10. Use of zwitterions for improving the ability of nucleic acid aptamers to resist plasma interference and / or cell surface interference.

Images