Sweet tea cinnamoyl coenzyme A reductase gene and application thereof

Abstract

The invention belongs to the field of strigose hydrangea juvenile leaf genetic engineering, particularly relates to separation and functional analysis of strigose hydrangea juvenile leaf cinnamoyl-coenzyme A reductase (CCR) and chalcone synthase (CHS) genes, and also relates to in-vitro synthesis of phloretin by using the strigose hydrangea juvenile leaf CCR and CHS genes. The invention discloses application of a strigose hydrangea juvenile leaf CCR gene coded protein. The strigose hydrangea juvenile leaf CCR gene coded protein catalyzes oxidation of 4-hydroxyphenylpropanal to form phloretin synthesis precursor dihydrop-coumaroyl coenzyme A; the phloretin is synthesized under the combined action of the protein coded by the strigose hydrangea juvenile leaf CHS gene. The nucleotide sequence of the strigose hydrangea juvenile leaf CCR gene is shown as SEQ ID No: 1, and the nucleotide sequence of the strigose hydrangea juvenile leaf CHS gene is shown as SEQ ID No: 2.

Description

Technical Field

[0001] The invention belongs to the field of sweet tea genetic engineering, and specifically relates to the separation and functional analysis of sweet tea cinnamoyl CoA reductase (CCR) and chalcone synthase (CHS) genes, and also relates to the in vitro synthesis of phloretin using sweet tea CCR and CHS genes. Background Art

[0002] Sweet tea is an important substitute tea for the folks. Its scientific name is Lithocarpus litseifolius (Hance) Chun. It is named because its young leaves have a significant sweetness. Its sweetness does not come from sugars, but from dihydrochalcone compounds. Dihydrochalcone substances are a class of atypical flavonoid substances. The aglycone has a 2-phenylchromone (C6-C3-C6) basic skeleton. Its A ring comes from malonyl coenzyme A metabolism and has 2′, 4′ and 6′-hydroxyl groups. The B ring comes from the shikimic acid pathway and has 3 and 4-hydroxyl groups. Unlike other flavonoid substances, the double bond in the C3 carbon chain is reduced and the C ring cannot be formed. The A ring and the B ring are connected by a carbon chain. The dihydrochalcone substances in sweet tea are mainly phloretin and its glycosides.

[0003] Similar to the synthesis process of naringenin chalcone, phloretin is produced by the condensation reaction of one molecule of dihydro-p-coumaroyl-CoA and three molecules of malonyl-CoA under the action of CHS, but there is no consensus on the in vivo synthesis pathway of dihydro-p-coumaroyl-CoA, the precursor of phloretin. So far, the product encoded by the double bond reductase gene (DBR) in apple has been reported to have the ability to reduce p-coumaroyl-CoA to dihydro-p-coumaroyl-CoA, but since no corresponding activity was detected in experiments by other teams, the function of this gene has been questioned. In addition, many DBRs from different species have been reported to reduce the double bond in p-coumaraldehyde to generate 4-hydroxyphenylpropanal. Therefore, the in vivo synthesis of dihydro-p-coumaroyl-CoA has been controversial, and the focus of the contradiction is mainly how the double bond reduction step in its precursor p-coumaroyl-CoA is carried out through enzymatic reactions.

[0004] Previous studies have shown that CCR is a key gene in the plant lignin metabolism pathway. The protein it encodes can reduce p-coumaryl-CoA, feruloyl-CoA and sinapinic acid-CoA to p-coumaraldehyde, coniferyl aldehyde and sinapinic aldehyde, respectively, and then generate the corresponding lignin monomers under the catalysis of cinnamyl alcohol dehydrogenase (CAD). Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a gene sequence of sweet tea cinnamoyl coenzyme A reductase (Cinnamoyl CoAreductase, CCR) and the protein encoded by it and the new function.

[0006] In order to solve the above technical problems, the present invention provides a sweet tea gene, including a sweet tea CCR gene and a sweet tea CHS gene, the nucleotide sequence of the sweet tea CCR gene is shown in SEQ ID No: 1, and the nucleotide sequence of the sweet tea CHS gene is shown in SEQ ID No: 2.

[0007] The present invention also provides the protein encoded by the above-mentioned sweet tea gene. The amino acid sequence of the protein encoded by the sweet tea CCR gene is shown in SEQ ID NO: 3, and the amino acid sequence of the protein encoded by the sweet tea CHS gene is shown in SEQ ID NO: 4.

[0008] The present invention also provides the use of the protein encoded by the sweet tea CCR gene: the protein encoded by the sweet tea CCR gene catalyzes the oxidation of 4-hydroxyphenylpropionaldehyde to form dihydro-p-coumaroyl-CoA, a precursor of phloretin synthesis.

[0009] The invention provides an improvement on the use of the protein encoded by the sweet tea CCR gene: catalyzing 4-hydroxyphenylpropionaldehyde and coenzyme A (CAS No. 85-61-0) to generate dihydro-p-coumaroyl-CoA.

[0010] As a further improvement of the use of the protein encoded by the CCR gene of the sweet tea of ​​the present invention: phloretin is synthesized under the joint action of the protein encoded by the CHS gene of the sweet tea.

[0011] The present invention also provides a method for synthesizing phloretin: a reaction system comprising a protein encoded by a CCR gene of sweet tea, a protein encoded by a CHS gene of sweet tea, 4-hydroxyphenylpropionaldehyde, coenzyme A, NADP and malonyl-CoA is reacted to obtain phloretin.

[0012] As an improvement of the method for synthesizing phloretin of the present invention:

[0013] The reaction system consisted of the following components: a protein encoded by the CCR gene at a final concentration of 1 mg / mL, a protein encoded by the CHS gene at a final concentration of 1 mg / mL, 4-hydroxyphenylpropionaldehyde, coenzyme A, NADP, and malonyl-CoA at a final concentration of 500 μM, respectively, and the rest was a pH 6.5 citric acid buffer;

[0014] React at 25±0.5°C for 2-8h (preferably 4-8h);

[0015] The obtained products include phloretin as a main product, and also include dihydro-bisnoryangonin and dihydro-p-coumaroyl triacetinacid lactone as by-products.

[0016] The present invention has found through research that CCR can catalyze the reduction of substances such as coumaroyl-CoA, feruloyl-CoA and mustard-CoA, and can also catalyze the oxidation of 4-hydroxyphenylpropionaldehyde to form dihydro-p-coumaroyl-CoA, a precursor of phloretin synthesis.

[0017] The prokaryotic expression product of gene CCR can catalyze 4-hydroxyphenylpropionaldehyde to synthesize dihydro-p-coumaryl-CoA, and combined with the prokaryotic expression of sweet tea chalcone synthase (CHS) gene, the in vitro synthesis of phloretin can be achieved.

[0018] The present invention adopts the following technical scheme to achieve the goal: extracting total RNA from sweet tea leaves, cloning sweet tea CCR gene and sweet tea CHS gene through reverse transcription-polymerase chain reaction (RT-PCR) and sequencing verification, which have nucleotide sequences shown in SEQ ID No: 1 and SEQ ID No: 2 respectively. The CCR gene open reading frame (ORF) is 996 bp in length, can encode CCR protein, has a total length of 331 amino acids, and has a sequence shown in SEQ ID No: 3; the CHS gene open reading frame (ORF) is 1170 bp in length, can encode CHS protein, has a total length of 389 amino acids, and has a sequence shown in SEQ ID No: 4.

[0019] The present invention also provides the optimum reaction conditions for the catalysis of p-coumaroyl-CoA, feruloyl-CoA, mustard-CoA and 4-hydroxyphenylpropionaldehyde by the prokaryotic expression product of the sweet tea CCR gene, proving that the encoding product of the sweet tea CCR gene provided by the present invention can not only catalyze p-coumaroyl-CoA, feruloyl-CoA and mustard-CoA to generate the corresponding hydroxycinnamaldehyde, but also catalyze 4-hydroxyphenylpropionaldehyde to generate dihydro-p-coumaroyl-CoA. In addition, under the joint action of the expression products of the CCR gene and the CHS gene, the in vitro synthesis of phloretin can be achieved with 4-hydroxyphenylpropionaldehyde as the starting substrate.

[0020] The specific technical steps for implementing the present invention are as follows:

[0021] 1. Cloning and sequence analysis of CCR and CHS genes in sweet tea

[0022] In spring, young leaves of sweet tea shoots were collected and ground in liquid nitrogen to extract total RNA from the leaves. After electrophoresis and UV analysis, the RNA quality and concentration were confirmed to meet the requirements of gene cloning. Ultra TM Directional RNALibrary Prep Kit for The kit (New England Biolabs, Inc.) was used to separate mRNA and fragment it, and the transcriptome library was constructed through double-stranded cDNA synthesis, cDNA end repair and A addition, NEBNext Adaptor adapter ligation, selection of specific length fragments for recovery, PCR amplification and enrichment. The specific operation refers to the instructions of the kit. The constructed transcriptome library was commissioned to a sequencing company for sequence determination and assembly using the Illumina HiSeq 2500 platform.

[0023] According to the CCR and CHS candidate gene sequences obtained by transcriptome sequencing, primers CCR-F / CCR-R (Table 1) and CHS-F / CHS-R (Table 1) were designed to clone ORF; RT-PCR was used to amplify the candidate gene ORF sequence, and the amplified products were electrophoresed on 1.0% agarose gel ( Figure 1 ), the target band was cut and recovered, and the amplified product was inserted into the pCold-TF vector (TF refers to trigger factor, which is a prokaryotic ribosome binding partner protein that can promote the co-translational folding of the nascent peptide chain) under the action of homologous recombination ligase. The recombinant vector pCold-TF-CCR containing the CCR gene and the recombinant vector pCold-TF-CHS containing the CHS gene were constructed respectively, and DH5α competent Escherichia coli were transformed respectively, and spread on LB solid medium containing 100 μg / ml ampicillin sodium for resistance screening, and the positive colonies were picked and propagated for 12 hours, and the bacterial liquid PCR was performed with pCold-TF universal primers pCold-TF-F / pCold-TF-R (Table 1), and the positive clones were entrusted to Shanghai Shenggong Biotechnology Co., Ltd. for sequencing by Sanger sequencing. According to the sequencing results, the CCR and CHS amino acid sequences encoded by the ORF were deduced using EditSeq in the DNAStar software package and compared with the GenBank database using Blast (www.blast.ncbi.nlm.nih.gov / Blast.cgi).

[0024] 2. Analysis of the characteristics of reduction and oxidation reactions catalyzed by CCR proteins

[0025] The recombinant plasmid pCold-TF-CCR verified by sequencing was extracted and transformed into competent Rosetta (DE3) cells. After propagation, the recombinant protein expression was induced by isopropyl-β-D-thiogalactoside (IPTG) under low temperature (16°C) conditions. The purified recombinant CCR protein was obtained by nickel column purification. The specific operation was referred to the instructions of the relevant kit. The molecular weight of the recombinant CCR protein was 88.93 kDa (His tag + TF + HRV3C protease site carrier protein was 52.52 kDa, and the target protein CCR was 36.41 kDa). SDS-PAGE analysis showed that the target gene CCR was highly expressed and soluble (such as Figure 2 (shown in lane S1).

[0026] The recombinant CCR protein was treated with HRV3C protease to remove the carrier protein and recover CCR. p-Coumaryl-CoA, feruloyl-CoA and mustard CoA were used as substrates, and CCR and cofactor NADPH were added to the system. After the enzymatic reaction, 5 μL of trifluoroacetic acid was added to terminate the reaction. The generation was detected to clarify the reduction reaction characteristics catalyzed by the CCR protein. The results showed that CCR could catalyze p-Coumaryl-CoA, feruloyl-CoA and mustard CoA to generate the corresponding p-Coumaraldehyde, coniferaldehyde and mustardaldehyde. To further explore the oxidation reaction activity catalyzed by CCR, the specific operation was to use 4-hydroxyphenylpropanal as the substrate, and add CCR and cofactors NADP and CoA to it. After the enzymatic reaction, 10 μL of sodium hydroxide was added to hydrolyze the reaction product (sodium hydroxide can hydrolyze analogs such as hydroxycinnamoyl-CoA into the corresponding hydroxycinnamic acid analogs). The results showed that the product had a high abundance of dihydro-p-coumaric acid ( Figure 3 ). This indicates that CCR can catalyze the oxidation of 4-hydroxyphenylpropionaldehyde to dihydro-p-coumaryl-CoA. The study also showed that recombinant CCR that has not been treated with HRV3C protease can also effectively catalyze the oxidation of 4-hydroxyphenylpropionaldehyde to dihydro-p-coumaryl-CoA.

[0027] The optimal reaction conditions for the redox reaction of CCR protein were further analyzed. The specific operation was to use p-coumaroyl-CoA and 4-hydroxyphenylpropionaldehyde as substrates, respectively, to carry out enzymatic reactions in a series of pH buffer systems and at different temperatures, and to compare the product formation under different temperatures, buffer systems and acidity conditions. Finally, it was determined that the optimal reaction conditions for sweet tea CCR to substrate p-coumaroyl-CoA were: temperature 30°C, pH 6.0 phosphate buffer system ( Figure 4 ); The optimal reaction conditions for the substrate 4-hydroxyphenylpropionaldehyde are: temperature 25°C, pH 8.0 phosphate buffer system or pH 6.5 citric acid buffer system ( Figure 5 ). 3. Synthesis of Phloretin Using CCR and CHS Catalysis

[0028] The recombinant plasmid pCold-TF-CHS verified by sequencing was extracted and transformed into competent Rosetta (DE3) cells. After the OD value was expanded to between 0.6 and 0.8, the recombinant protein was expressed by inducing IPTG under low temperature conditions. The estimated molecular weight of the recombinant CHS protein was 95.26 kDa (His tag + TF + HRV3C protease site carrier protein was 52.52 kDa, and the target protein CHS was 42.75 kDa). SDS-PAGE analysis showed that the target gene CHS was highly expressed and soluble (such as Figure 2 As shown in lane S2 in the figure). With 4-hydroxyphenylpropanaldehyde as the substrate, recombinant CCR and CHS, coenzyme A, NADP, and malonyl-CoA were added to the system and reacted for 2 hours at 25°C and a citric acid buffer system pH 6.5. HPLC-MS detection showed that a large amount of phloretin was generated after the enzymatic reaction, accompanied by a small amount of by-products (by-product 1 was dihydro-bis-demethyl-yangonine, and by-product 2 was dihydro-coumaroyl triacetic acid lactone) ( Figure 6 ); when CCR protein is lacking in the system, phloretin cannot be produced. This indicates that CCR can catalyze 4-hydroxyphenylpropionaldehyde to dihydro-p-coumaroyl-CoA, and then produce phloretin under the action of CHS.

[0029] IV. Application of CCR Gene

[0030] After the Rosetta (DE3) engineering bacteria containing the recombinant plasmids pCold-TF-CCR and pCold-TF-CHS are propagated, the expression of the recombinant protein is induced by IPTG at low temperature, the engineering bacteria are ultrasonically broken, and the CCR and CHS purified by a nickel column are mixed with 4-hydroxyphenylpropionaldehyde, coenzyme A, NADP and malonyl-CoA, and reacted in a citric acid buffer at a temperature of 25°C and pH 6.5 for 4-8 hours. An equal volume of ethyl acetate is added to the mixture for extraction once, the upper ethyl acetate is taken, and the lower aqueous phase is extracted once with an equal volume of ethyl acetate, the two ethyl acetate layers are combined, the ethyl acetate is removed by reduced pressure distillation at 45°C, the paste is transferred to a culture dish, and a dry powder containing 75% phloretin is obtained by freeze drying. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] The specific implementation modes of the present invention are further described in detail below with reference to the accompanying drawings.

[0032] Figure 1 It is the RT-PCR electrophoresis diagram of the open reading frames of the CCR gene (S1) and CHS gene (S2) of sweet tea;

[0033] Figure 2 The results of SDS-PAGE Coomassie Brilliant Blue staining of recombinant CCR (S1) and CHS (S2) induced by low temperature;

[0034] Figure 3 It is the HPLC-DAD test result of the product of 4-hydroxyphenylpropionaldehyde oxidation reaction catalyzed by CCR;

[0035] Figure 4 Comparison of the effect of CCR catalysis on coumaroyl-CoA reduction under different acidity (A) and temperature (B) conditions;

[0036] Figure 5 The comparison of the effect of CCR catalyzing the oxidation of 4-hydroxyphenylpropionaldehyde under different acidity (A) and temperature (B) conditions;

[0037] Figure 6 This is the HPLC-MS test result of the synthesis of phloretin from substrate 4-hydroxyphenylpropionaldehyde by the combined catalysis of CCR and CHS;

[0038] Figure 7 It is the comparison result between CCR of the present invention and GenBank Blast. DETAILED DESCRIPTION

[0039] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:

[0040] Example 1: Cloning and sequence analysis of sweet tea CCR gene and CHS gene

[0041] In spring (March 20), the young leaves of sweet tea were harvested, the veins were removed and the leaves were ground in liquid nitrogen. The total RNA was extracted using the EasyPlant RNA kit (Zhejiang EasyPlant Biotechnology Co., Ltd.). After electrophoresis, the RNA was found to be intact and not degraded. UV analysis showed that the extracted RNA OD260 / OD280 was 1.9-2.0 and the concentration was about 1000 μg / ml, which met the requirements of subsequent experiments. Ultra TM Directional RNA Library Prep Kitfor The kit (New England Biolabs, Inc.) was used to separate mRNA and fragment it, and the transcriptome library was constructed through double-stranded cDNA synthesis, cDNA end repair and A addition, NEBNext Adaptor adapter ligation, selection of specific length fragment recovery, PCR amplification and enrichment. The specific operation refers to the relevant instructions of the kit. The constructed transcriptome library was commissioned to a sequencing company for sequence determination and assembly using the Illumina HiSeq 2500 platform.

[0042] According to the ORF sequences of CCR and CHS candidate genes obtained by transcriptome sequencing, primer pairs CCR-F / CCR-R (upstream and downstream primers for CCR gene ORF cloning) and primer pairs CHS-F / CHS-R (upstream and downstream primers for CHS gene ORF cloning) were designed. The total RNA extracted in the early stage was used as a template and HiScript TM II Q RT SuperMix Kit (Nanjing Novozyme Biotechnology Co., Ltd.) was used to synthesize the first-strand cDNA. The specific operation was referred to the instructions of the reverse transcription kit.

[0043] The first strand of cDNA was used as template and the primer pairs CCR-F / CCR-R and CHS-F / CHS-R were used respectively. TM PCR Master Mix reagent (Toyobo [Shanghai] Biotechnology Co., Ltd.) was used to amplify the candidate gene ORF sequence by RT-PCR. The specific operation was referred to the instructions of the relevant reagents. The above amplified products were electrophoresed on 1.0% agarose gel ( Figure 1 ), and the target band was cut out, and the band was recovered by TaKaRa Agarose Gel DNA Purification Kit Ver.2.0 (Takara Biotech [Dalian] Co., Ltd.), and the CCR complete ORF amplification product (SEQ ID NO: 1) and the CHS complete ORF amplification product (SEQ ID NO: 2) were exchanged and recombined with the linearized pCold-TF vector under the action of homologous recombination ligase to form circular pCold-TF-CCR and pCold-TF-CHS, respectively. The specific operation was referred to the relevant instructions of the kit. That is, the recombinant vector pCold-TF-CCR containing the CCR gene and the recombinant vector pCold-TF-CHS containing the CHS gene were constructed.

[0044] The recombinant plasmid was transformed into DH5α competent Escherichia coli and spread on LB solid medium containing 100 μg / ml ampicillin sodium for resistance screening. Positive clones were picked and amplified in LB liquid medium for 12 h. The pCold-TF universal primers (universal upstream and downstream primers for sequencing the pCold-TF vector insert sequence) were used to clone the pCold-TF vector using KOD One TMPCR Master Mix reagent (Toyobo [Shanghai] Biotechnology Co., Ltd.) was used for bacterial liquid PCR, and the positive recombinant bacteria were entrusted to Shanghai Shenggong Biotechnology Co., Ltd. for sequencing by Sanger sequencing. The ORF of the CCR gene (SEQ ID NO: 1) was verified to be 996 bp long, and the ORF of the CHS gene (SEQ ID NO: 2) was 1170 bp long. EditSeq in the DNAStar software package was used to deduce the CCR and CHS amino acid sequences encoded by the ORF. The CCR amino acid sequence (SEQ ID NO: 3) contained 331 amino acid residues and a relative molecular weight of 36.41 kDa; the CHS amino acid sequence (SEQ ID NO: 4) contained 389 amino acid residues and a relative molecular weight of 42.75 kDa. The CCR and CHS amino acid sequences were compared with the GenBank database using the Blast tool (www.blast.ncbi.nlm.nih.gov / Blast.cgi). The cloned CCR gene encoding product had 100% consistency with the unknown functional protein sequence numbered KAL0010863.1 derived from sweet tea in the database; the cloned CHS gene encoding product had 100% consistency with the unknown functional protein sequence numbered KAK9991562.1 derived from sweet tea in the database.

[0045] Table 1 Primer sequences

[0046] CCR-F ggtaggcatatggagatgcc agtttctgga caaac CCR-R ctcgagggtaccgagttaag actgaatatg aatagaatct tc CHS-F ggtaggcatatggagatggt gactgttgat gaagtac CHS-R ctcgagggtaccgagttaag cagagacact gtgg pCold-TF universal upstream primer ccactttcaacgagctgatg pCold-TF universal downstream primer ggcagggatc ttagattctg

[0047] Example 2: Analysis of the characteristics of reduction and oxidation reactions catalyzed by CCR protein

[0048] The pCold-TF-CCR positive colonies obtained in Example 1 and verified by sequencing were propagated in LB liquid culture medium for 12 hours, and the recombinant plasmid pCold-TF-CCR was extracted using the AFTSpin EndoFree Plasmid Midi Kit (Aibotek Biotechnology Co., Ltd.). For specific operations, see the instructions for plasmid extraction. The recombinant plasmid was transformed into competent Rosetta (DE3) cells and spread on LB solid culture medium containing 100 μg / ml ampicillin sodium and 34 μg / ml chloramphenicol for resistance screening. Positive clones were picked and inoculated in LB liquid culture medium, and cultured at 37°C with shaking until the OD value was 0.6-0.8. IPTG with a final concentration of 1 mM was added to the culture medium to induce the expression of the recombinant protein at 16°C. The estimated molecular weight of the recombinant CCR protein was about 88.93 kDa. SDS-PAGE analysis showed that the target gene CCR fused with the TF factor was highly expressed and highly soluble (such as Figure 2 (shown in lane S1).

[0049] The fusion recombinant protein was adsorbed on a nickel column using His-tagged protein agarose purification resin (Yisheng Biotechnology [Shanghai] Co., Ltd.), and purified recombinant CCR protein was obtained by elution. For specific operations, refer to the instructions of the relevant kit. The recombinant CCR was digested with HRV3C protease to remove the carrier protein, and the CCR protein was purified by nickel column. For specific operations, refer to the instructions of the relevant reagents.

[0050] 1mM aqueous solutions of p-coumaryl-CoA, feruloyl-CoA and mustard-CoA as substrates and 10mM NADPH (reduced nicotinamide adenine dinucleotide phosphate) solution were prepared respectively, and CCR protein was mixed with each substrate and NADPH solution respectively, so that the concentration of CCR protein in the system was 1mg / mL, and the final concentration of each substrate and NADPH was 200μM. The reaction system was shaken in a 30℃ metal bath for 10min, and 5μL trifluoroacetic acid was added to terminate the reaction. The catalytic activity analysis of the reduction reaction of CCR protein was carried out, and it was found that CCR protein can catalyze the reduction reaction of p-coumaryl-CoA, feruloyl-CoA and mustard-CoA to generate p-coumaraldehyde, coniferaldehyde and sinardaldehyde respectively.

[0051] To further explore the characteristics of CCR catalytic oxidation reaction, 20mM 4-hydroxyphenylpropionaldehyde, NADP and coenzyme A (4-aminopyrimidinimidazole) solution were prepared, and the recombinant CCR protein was mixed with the above substances to make the CCR protein concentration in the system 1mg / mL and the final concentration of each substance 500μM. After 2h of enzymatic reaction at 30℃, 10μL of sodium hydroxide (sodium hydroxide can hydrolyze dihydro-p-coumaryl-CoA into the corresponding dihydro-p-coumaric acid) was added to terminate the reaction. HPLC-DAD detection showed that dihydro-p-coumaric acid was generated after hydrolysis with sodium hydroxide. This shows that CCR can catalyze the reduction of p-coumaryl-CoA and the like to generate the corresponding aldehyde substances, and can also catalyze the oxidation of 4-hydroxyphenylpropionaldehyde to generate dihydro-p-coumaryl-CoA ( Figure 3 ).

[0052] The optimal reaction conditions for CCR catalytic reduction or oxidation reactions were analyzed using p-coumaryl-CoA and 4-hydroxyphenylpropionaldehyde as substrates, respectively. Specifically, 50mM citric acid buffer at pH 4.5-6.5, 50mM phosphate buffer at pH 6.0-8.0, and 50mMTris-hydrochloric acid buffer at pH 7.5-9.0 were prepared. In the reaction solution with a final concentration of CCR protein of 1mg / mL, p-coumaryl-CoA and NADPH at a final concentration of 200μM were added, or 4-hydroxyphenylpropionaldehyde, CoA and NADP at a final concentration of 500μM were added, and the volume was supplemented to 250μL with buffers of different pH values, and then reacted at 30℃ for 10min, and the product formation under different buffer systems and acidity conditions was compared. A similar reaction system was prepared under the optimal buffer system, reacted at a series of temperatures (10-50℃) for 10min, and the product formation at different temperatures was compared. Finally, it was found that:

[0053] The optimal catalytic conditions for CCR to react with coumaroyl-CoA are 30°C and pH 6.0 in a phosphate buffer system ( Figure 4 );

[0054] The optimal catalytic conditions for the substrate 4-hydroxyphenylpropanal are a temperature of 25°C and a phosphate buffer system with a pH of 8.0 or a citric acid buffer system with a pH of 6.5 ( Figure 5 );

[0055] This indicates that CCR can catalyze the reduction reaction of hydroxycinnamoyl-CoA substances (including p-coumaroyl-CoA, feruloyl-CoA and mustard-CoA, etc.) into corresponding hydroxycinnamic aldehydes, and can also catalyze the reverse oxidation reaction of 4-hydroxyphenylpropanal into dihydrop-coumaroyl-CoA (a precursor for the synthesis of phloretin), but the reaction conditions required are different.

[0056] Example 3: Synthesis of Phloretin Using CCR and CHS Catalysis

[0057] The pCold-TF-CHS positive colonies obtained by sequencing verification in Example 1 were shaken and cultured in LB liquid medium at 37°C for 12h, and the recombinant plasmid pCold-TF-CHS was extracted using the AFTSpin EndoFree Plasmid Midi Kit (Aibotek Biotechnology Co., Ltd.). For specific operations, see the plasmid extraction instructions. The recombinant plasmid was transformed into competent Rosetta (DE3) cells and coated on LB solid medium containing 100μg / ml ampicillin sodium and 34μg / ml chloramphenicol for resistance screening. After the positive clones were picked and expanded to OD between 0.6-0.8, the recombinant protein expression was induced by IPTG under low temperature conditions. The estimated molecular weight of the recombinant CHS protein was 95.26kDa (His tag + TF + HRV3C protease site carrier protein was 52.52kDa, and the target protein CHS was 42.75kDa). The target gene CHS was highly expressed and highly soluble by SDS-PAGE analysis. The obtained recombinant CHS was digested with HRV3C protease to remove the carrier protein, and the CHS protein was purified by nickel column. The removal of the carrier protein did not affect the enzyme activity. For details, please refer to the instructions of the relevant reagents.

[0058] Then, the experiment of in vitro synthesis of phloretin by prokaryotically expressed CCR and CHS proteins was carried out. Specifically, 4-hydroxyphenylpropionaldehyde, coenzyme A, NADP and malonyl-CoA with a final concentration of 500 μM were added to the mixed protein solution of CCR and CHS (the final concentration of each protein was 1 mg / mL), and pH 6.5 citric acid buffer was used to make up to 250 μL. After reacting at 25°C for 2 hours, 5 μL of trifluoroacetic acid was added to terminate the reaction. HPLC-MS detection showed that Figure 6 As shown in the figure, under the reaction conditions, a large amount of phloretin was generated, accompanied by a small amount of byproducts (byproduct 1 is dihydro-bis-demethyl-yanconin, byproduct 2 is dihydro-coumaroyl triacetic acid lactone); when CCR is missing in the system, the generation of phloretin and the two byproducts cannot be detected. This indicates that CCR can catalyze the conversion of 4-hydroxyphenylpropanal into dihydro-p-coumaroyl-CoA and generate phloretin under the action of CHS protein.

[0059] When CHS was lacking in the system, 4-hydroxyphenylpropionaldehyde was converted into dihydro-p-coumaroyl-CoA under the catalysis of CCR, but no phloretin and two by-products were generated.

[0060] Embodiment 4, practical application

[0061] The Rosetta (DE3) engineering bacteria containing the recombinant plasmid pCold-TF-CCR and the Rosetta (DE3) engineering bacteria containing the recombinant plasmid pCold-TF-CHS were inoculated into LB liquid culture medium, respectively, and expanded at 37°C until the OD value was 0.6-0.8. IPTG with a final concentration of 1mM was added to the culture medium and induced at 16°C for 16h to promote the expression of recombinant proteins. Centrifuge at 2000rpm for 20min, wash twice with 50μM phosphate buffer (pH8.0) equal to the volume of the engineering bacteria, collect the cultured engineering bacteria, and resuspend them with 50μM phosphate buffer (10mM imidazole, pH8.0) containing imidazole no more than 5 times the volume of the engineering bacteria.

[0062] After the engineering bacteria were ultrasonically disrupted for 30 minutes, the residue was removed by centrifugation at 8000 rpm for 20 minutes, and the supernatant was passed through a nickel column at a flow rate of 3 column volumes / h, and 10 column volumes of 50 μM phosphate buffer (20 mM imidazole, pH 8.0) were added to resuspend and wash to remove impurities, and then 5 column volumes of 50 μM phosphate buffer (250 mM imidazole, pH 8.0) containing imidazole were used to elute the recombinant CCR and CHS. The purified recombinant CCR and CHS were mixed with 4-hydroxyphenylpropanal, coenzyme A, NADP and malonyl-CoA, and reacted for 4-8 hours under the optimal reaction conditions (to make the reaction more thorough), and the optimal reaction conditions were: a final concentration of 1 mg / mL of CCR and CHS protein, a final concentration of 500 μM of 4-hydroxyphenylpropanal, coenzyme A, NADP and malonyl-CoA, pH 6.5 citric acid buffer was supplemented to 10 mL, and the reaction temperature was 25°C.

[0063] An equal volume of ethyl acetate was added to the obtained reaction mixture for extraction, the ethyl acetate layer was separated, and an equal volume of ethyl acetate was added to the reaction mixture after extraction for re-extraction, the two ethyl acetates were combined, and the ethyl acetate was removed by reduced pressure distillation at 45°C. The paste was transferred to a culture dish and freeze-dried (-50°C for 72h) to obtain a dry powder containing more than 75% phloretin.

[0064] Finally, it should be noted that the above examples are only some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments, and there are many variations. All variations that can be directly derived or associated with the content disclosed by a person skilled in the art should be considered as the protection scope of the present invention.

Claims

1. Sweet tea gene, characterized by: It comprises a sweet tea CCR gene and a sweet tea CHS gene. The nucleotide sequence of the sweet tea CCR gene is shown in SEQ ID No: 1, and the nucleotide sequence of the sweet tea CHS gene is shown in SEQ ID No:

2.

2. The protein encoded by the sweet tea gene of claim 1, characterized in that: The amino acid sequence of the protein encoded by the CCR gene of the sweet tea is shown in SEQ ID NO:3, and the amino acid sequence of the protein encoded by the CHS gene of the sweet tea is shown in SEQ ID NO:

4.

3. The use of the protein encoded by the sweet tea CCR gene, characterized in that: The protein encoded by the sweet tea CCR gene catalyzes the oxidation of 4-hydroxyphenylpropionaldehyde to form dihydro-p-coumaroyl-CoA, a precursor of phloretin synthesis.

4. The use of the protein encoded by the sweet tea CCR gene according to claim 3, characterized in that: It catalyzes the reaction of 4-hydroxyphenylpropionaldehyde and coenzyme A to produce dihydro-p-coumaroyl-CoA.

5. The use of the protein encoded by the sweet tea CCR gene according to claim 3 or 4, characterized in that: Phloretin is synthesized under the joint action of the protein encoded by the CHS gene of sweet tea.

6. A method for synthesizing phloretin, characterized in that: Phloretin is obtained by reacting a reaction system containing a protein encoded by a CCR gene of sweet tea, a protein encoded by a CHS gene of sweet tea, 4-hydroxyphenylpropionaldehyde, coenzyme A, NADP and malonyl-CoA.

7. The method for synthesizing phloretin according to claim 6, characterized in that: The reaction system consisted of the following components: a protein encoded by the CCR gene at a final concentration of 1 mg / mL, a protein encoded by the CHS gene at a final concentration of 1 mg / mL, 4-hydroxyphenylpropionaldehyde, coenzyme A, NADP, and malonyl-CoA at a final concentration of 500 μM, respectively, and the rest was a pH 6.5 citric acid buffer; React at 25±0.5℃ for 2-8h; The obtained product includes phloretin as a main product, and also includes dihydro-bis-demethyl-yangonine and dihydro-coumaroyl triacetic acid lactone as by-products.

Images