OsLRK19 gene and its application in enhancing rice resistance to sheath blight

Abstract

The application discloses an OsLRK19 gene and application thereof in enhancing rice resistance to sheath blight, and belongs to the technical field of plant genetic engineering. The application identifies a new gene OsLRK19 positively regulating rice resistance to sheath blight. The greenhouse sheath blight resistance identification proves that after the gene is overexpressed in rice plants, the rice becomes more resistant to sheath blight, and vice versa, after the gene is knocked out, the resistance of the rice to sheath blight is significantly reduced. Moreover, overexpression of the gene does not affect the main agronomic traits of the rice plants, which indicates that the OsLRK19 has potential breeding utilization value in rice breeding against sheath blight, and provides an important gene resource for the research on the sheath blight resistance mechanism of rice.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of plant genetic engineering, and particularly relates to an OsLRK19 gene and application thereof in enhancing the resistance of rice to sheath blight. BACKGROUND

[0002] Rice sheath blight is one of the main diseases in rice production, which poses a significant threat to yield and quality. In recent years, affected by global climate change and changes in agricultural farming patterns, the frequency and intensity of the disease have shown an increasing trend, which has seriously restricted the sustainable development of the rice industry. At present, the prevention and control of sheath blight mainly relies on chemical agents, which not only increases the production cost, but also causes serious pollution to the ecological environment, which is contrary to the concept of green development of modern agriculture. Therefore, using disease-resistant genes to breed disease-resistant varieties has become the most economical and effective strategy to control sheath blight.

[0003] However, as a quantitative trait controlled by multiple genes, there is currently no major resistance gene available for sheath blight resistance. So far, only a few sheath blight resistance QTLs have been finely mapped and used in practical applications, which makes it very difficult to breed sheath blight-resistant varieties through marker-assisted selection. At the same time, gene cloning and functional analysis using traditional genetics methods often require a large amount of experimental material and long-term phenotypic identification, and the research efficiency is low. In contrast, the combination of reverse genetics and genomics, transcriptomics and other omics technologies provides a new solution to this problem. By screening differentially expressed genes or gene sets related to specific traits through omics technologies, and then using reverse genetics techniques for systematic verification and cloning, more genes related to specific biological processes can be more comprehensively and efficiently mined. Therefore, mining and cloning more genes involved in regulating sheath blight resistance will provide a basis for further studying the molecular mechanisms of gene regulation of sheath blight resistance, and have important theoretical value. L-type Lectin Receptor-like Kinases (L-type LecRLKs) are an important class of receptor kinases in plants, although the functions of L-type LecRLKs in plant immune regulation have been extensively studied, their role in regulating rice sheath blight resistance has not been reported and needs to be further explored. SUMMARY

[0004] The present application provides a gene OsLRK19 that can enhance the ability of rice to resist sheath blight, identifies a new gene OsLRK19 that regulates the resistance of rice to sheath blight, and uses genetic engineering to obtain plants overexpressing the OsLRK19 gene, which significantly improves the ability to resist sheath blight without affecting major agronomic traits.

[0005] The application further provides the application of the rice sheath blight resistance gene OsLRK19.

[0006] Technical scheme: In order to achieve the above-mentioned purpose, the application provides a gene OsLRK19 capable of enhancing the rice sheath blight resistance, and the CDS sequence of the gene OsLRK19 is shown in SEQ ID NO. 1.

[0007] The primer pair for amplifying the gene OsLRK19 is as follows:

[0008] OsLRK19-F: 5'-ATGGCGAAGCAAGCAACC-3',

[0009] OsLRK19-R: 5'-TTATCCTTCTTCCAAGAG-3'.

[0010] The application contains the overexpression vector pU1301-OsLRK19 of the gene OsLRK19 capable of enhancing the rice sheath blight resistance.

[0011] The construction method of the overexpression vector pU1301-OsLRK19 is as follows: the CDS sequence of the OsLRK19 gene is amplified by using the primers OsLRK19_OE-F: CGAACGATAGCCGGTACCATGGCGAAGCAAGCAACC and OsLRK19_OE-R: GTCGACTCTAGAGGATCCTCCTTCTTCCAAGAGGC with the pU1301 vector linker, and then the CDS sequence is recombined and connected to the pU1301 vector, and then the Escherichia coli is transformed and sequenced to verify, and finally the overexpression vector pU1301-OsLRK19 is obtained.

[0012] The application is based on the gene knockout vector pOs-OsLRK19 of the gene OsLRK19 capable of enhancing the rice sheath blight resistance.

[0013] The construction method of the gene knockout vector is as follows: the sgRNA 5'-TCTCCGCCTCGTTCGTGTTCGG-3' for recognizing the target site is designed and synthesized, the first 19 base sequences of CGG are added with a linker according to the following method: OsLRK19_sg-F: 5'-TGTG-G(TCTCCGCCTCGTTCGTGTT)-3', OsLRK19_sg-R: 5'-AAAC-(AACACGAACGAGGCGGAGA)C-3', the intermediate product is obtained by primer annealing to introduce the knockout target point of OsLRK19, the intermediate product is connected with the linear vector pOs which is cut by an enzyme, the Escherichia coli is transformed and sequenced to verify, and finally the gene knockout vector pOs OsLRK19 is obtained.

[0014] The application provides the gene OsLRK19 capable of enhancing the ability of rice to resist sheath blight, or the overexpression vector or the gene knockout vector in cultivating strong sheath blight-resistant rice germplasm.

[0015] The ability of rice to resist sheath blight is enhanced and the susceptibility is reduced by overexpressing the OsLRK19 gene.

[0016] The ability of rice to resist sheath blight is reduced and the susceptibility is enhanced by editing the OsLRK19 gene through CRISPR / Cas9.

[0017] The application provides the gene OsLRK19 capable of enhancing the ability of rice to resist sheath blight, or the overexpression vector or the gene knockout vector in cultivating strong sheath blight-resistant rice germplasm.

[0018] The application provides a method for cultivating sheath blight-resistant transgenic rice, which comprises the following steps: introducing the sheath blight-resistant gene OsLRK19 provided by the application into plant cells by using any kind of vector capable of guiding the expression of an exogenous gene in plants, so as to obtain a transgenic cell line and a transgenic strain with enhanced sheath blight resistance. When the gene is constructed into a plant expression vector, any kind of general promoter, enhanced promoter or inducible promoter can be added before the transcription initiation nucleotide, such as a cauliflower mosaic virus (CAMV) 35S promoter, a maize ubiquitin promoter (Ubiquitin), which can be used alone or in combination with other plant promoters; in addition, when the gene is used to construct a plant expression vector, an enhancer can also be used, including a translation enhancer or a transcription enhancer, and the enhancer region can be an ATG initiation codon or an adjacent region initiation codon, but it is necessary to be the same as the reading frame of the coding sequence to ensure the correct translation of the whole sequence. The source of the translation control signal and the initiation codon is wide, and can be natural or synthetic. The translation initiation region can come from the transcription initiation region or the structural gene. In order to facilitate the identification and screening of the transgenic plant cells or plants, the plant expression vector can be processed, such as adding a gene capable of expressing an enzyme or a luminescent compound capable of causing color change (GUS gene, luciferase gene, etc.) in plants, a resistant antibiotic marker (gentamicin marker, kanamycin marker, etc.). The expression vector of the gene provided by the application can be used to transform plant cells or tissues by using conventional biological methods such as Agrobacterium mediation, Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, electrical conductivity, etc., and the transformed plant tissues are cultivated into plants.

[0019] The application identifies a new positive regulation rice sheath blight resistance gene OsLRK19, and the greenhouse sheath blight resistance identification proves that the rice becomes more resistant to sheath blight after overexpression of the gene in the rice plant, and vice versa, the resistance of the rice to sheath blight is significantly reduced after the gene is knocked out. Moreover, overexpression of the gene does not affect the main agronomic traits of the rice plant, which shows that OsLRK19 has potential breeding value in rice sheath blight resistance breeding.

[0020] Beneficial effects: Compared with the prior art, the application has the following advantages:

[0021] The application identifies a new rice sheath blight resistance gene OsLRK19, and the rice sheath blight resistance gene OsLRK19 positively regulates the rice sheath blight resistance, overexpression of the gene can significantly enhance the resistance of the rice to sheath blight, and knockout of the gene can significantly weaken the resistance of the rice to sheath blight. After investigating the agronomic traits of the transgenic lines of the gene, it is found that the plant height, tiller number, heading date, grain number per panicle, seed setting rate and thousand-grain weight of the overexpression line are not affected, the plant height, grain number per panicle and seed setting rate of the knockout line are reduced or decreased, and other traits have no significant difference, which shows that the gene has potential breeding application value in sheath blight resistance molecular breeding. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 Expression pattern of OsLRK19 gene: Figure A is the expression level of OsLRK19 gene in different tissues of rice; Figure B is the expression characteristics of OsLRK19 gene in wild type at different times of inoculation with sheath blight fungus.

[0023] Figure 2 RNA and protein level detection results of OsLRK19 gene overexpression line: Figure A is the protein level detection result of OsLRK19 gene T0 overexpression plant; Figure B is the RNA level detection result of OsLRK19 gene T0 overexpression plant OsLRK19-OE#2, OsLRK19-OE#11 and OsLRK19-OE#13 three lines.

[0024] Figure 3 Gene variation type and protein sequence change of three knockout lines of OsLRK19 gene: Figure A is the gene variation type of three knockout lines of OsLRK19 gene; Figure B is the protein sequence change of three knockout lines of OsLRK19 gene.

[0025] Figure 4The results of the greenhouse sheath blight resistance identification of three overexpression and three knockout strains of OsLRK19 gene and wild type are shown in the following figures: Figure A is the phenotype and lesion length of the greenhouse sheath blight resistance identification of three overexpression strains of OsLRK19 gene; Figure B is the phenotype and lesion length of the greenhouse sheath blight resistance identification of three knockout strains of OsLRK19 gene. "*" represents a significant difference at the 5% level, i.e. p≤0.05; "**" represents a very significant difference at the 1% level, i.e. P≤0.01. Scale = 5 cm.

[0026] Figure 5 The results of the main agronomic trait investigation of three overexpression and three knockout strains of OsLRK19 gene and wild type are shown in the following figures: Figure A is the whole plant phenotype of three overexpression and three knockout strains of OsLRK19 gene and wild type, scale = 10 cm; Figure B is the investigation results of plant height, heading date, tiller number, grain number per panicle, seed setting rate and 1000-grain weight of three overexpression and three knockout strains of OsLRK19 gene and wild type. "*" represents a significant difference at the 5% level, i.e. p≤0.05; "**" represents a very significant difference at the 1% level, i.e. P≤0.01. DETAILED DESCRIPTION

[0027] The present application is further illustrated in conjunction with the accompanying drawings and examples.

[0028] The materials, reagents and the like used in the following examples can be obtained from commercial channels unless otherwise specified.

[0029] The experimental methods in the examples not specified in the specific conditions are usually carried out according to the conventional conditions or the conditions recommended by the manufacturer.

[0030] The rice genetic transformation material in the present application is japonica rice variety Nip (NIP): provided by the Rice Germplasm Resource Bank of Yangzhou University.

[0031] The sheath blight strain used in the present application is the medium-strong pathogenic strain YN-7 provided by Yangzhou University (Lee DY et al, BMC Genomics. 2021 Apr 7; 22(1): 242.).

[0032] The knock-out vector pOs and the over-expression vector pU1301 are both well-known vectors, and are described in detail in Targeted mutagenesis in rice using CRISPR-cas system (Miao et al, Cell Research. 2013 Oct; 23(10): 1233-1236) and OsWRKY13 mediates rice disease resistance by regulating defense-related genes in salicylate-and jasmonate-dependent signaling (Qiu et al, Molecular Plant-microbe Interactions. 2007 May; 20(5): 492-499), respectively. Both are preserved and provided by Yangzhou University.

[0033] Example 1

[0034] Identification and cloning of OsLRK19 gene

[0035] The cloning method of the OsLRK19 gene comprises the following steps:

[0036] The PCR amplification primers of the OsLRK19 gene are designed with the genome of the rice variety NIP as the reference sequence:

[0037] OsLRK19-F: 5'-ATGGCGAAGCAAGCAACC-3',

[0038] OsLRK19-R: 5'-TTATCCTTCTTCCAAGAG-3',

[0039] The cDNA of the rice variety NIP is used as the template for PCR amplification, and the PCR amplification method is referred to the Novozyme PhantaMax Super-Fidelity DNA Polymerase High Fidelity Enzyme Instruction Manual. The PCR amplification product is recovered and purified (Tiangen ordinary agarose gel DNA recovery kit DP209), and sequenced (Qikang Biotechnology Co., Ltd.), so that the correct CDS sequence of the OsLRK19 gene can be obtained.

[0040] The CDS sequence of the rice OsLRK19 gene of the present application is shown as SEQ ID NO. 1, and the amino acid sequence of the encoded protein is shown as SEO ID NO. 2.

[0041] Example 2

[0042] Expression characteristic analysis of OsLRK19 gene

[0043] Total RNA was extracted from the different tissues (roots, stems, leaves, leaf sheaths, and panicles) of the susceptible rice variety NIP at the booting stage using the Trizol method. The first-strand cDNA was synthesized using the PrimeScript® The cDNA from the different tissues described above was used as a template, and the rice OsActin gene was used as an internal reference gene (OsActin gene quantitative primer qActin-F: 5'-CTAAGCCAAGAGGAGCTGTTAT-3' and qActin-R: 5'-ATAACAGATAGGCCGGTTGAAA-3'). Real-time quantitative PCR was performed using OsLRK19 gene-specific quantitative primers (qLRK19-F: 5'-TTCGGTCTCGCCAGATTGTACG-3' and qLRK19-R: 5'-TCCTATTGTGCCGACGACATGC-3') to detect the expression level of the OsLRK19 gene in different tissues of rice. The qRT-PCR reaction system was as follows: qPCR Master Mix (Nanjing Novozyme Biotech Co., Ltd.) 5 μL, 0.5 μL of primers (10 μmol / L) before and after, and 5 μL of cDNA template (100 ng / μl). The Bio-Rad CFX96 TouchTM fluorescent quantitative PCR instrument was used to perform qRT-PCR reaction, and the conditions were as follows: 95 °C pre-denaturation for 3 min; 95 °C denaturation for 15 s, 60 °C annealing and extension for 30 s, 40 cycles. The expression value data was converted and analyzed using the 2-△△ct method. The reaction conditions were as follows: 95 °C, 30 sec, 95 °C, 10 sec, 60 °C, 10 sec, 40 cycles; 95 °C, 15 sec, 60 °C, 60 sec, 95 °C, 15 sec to read the melting curve.

[0044] NIP was cultured in a normal field environment to the tillering end stage, and then inoculated with the sheath blight fungus YN-7 using the embedding method (Pan Xuebiao, Journal of Jiangsu Agricultural College, 1997, (03): 28-33). A piece of wood with a length of 1 cm and a width of 2 mm, which was attached with the mycelium of the sheath blight fungus YN-7 (the mycelium was soaked), was carefully embedded in the leaf sheath of the rice at a position of 1 cm-2 cm below the second leaf. The rice leaf sheath tissue was cut 1 cm above and below the inoculum at 0 h (before inoculation) and 6 h, 9 h, 12 h, 24 h, and 48 h after inoculation, and was stored in liquid nitrogen. The RNA extraction, reverse transcription, and qRT-PCR were performed according to the procedures described above for determining the expression level of rice tissues.

[0045] As Figure 1As shown in A, the OsLRK19 gene has higher expression mainly in roots, leaves and leaf sheaths, among which the expression in roots is the highest; as shown in B, the OsLRK19 gene presents the characteristics of sustained up-regulated expression after being infected by the sheath blight fungus. Figure 1 B, the OsLRK19 gene presents the characteristics of sustained up-regulated expression after being infected by the sheath blight fungus.

[0046] Example 3

[0047] Vector construction, genetic transformation and detection

[0048] 1. The construction steps of the CRISPR / Cas9 knockout vector of the rice OsLRK19 gene are as follows:

[0049] (1) Select a high-efficiency knockout target site, design and synthesize sgRNA that recognizes the target site, the sequence of which is sgRNA: 5'-TCTCCGCCTCGTTCGTGTTCGG-3'. Add a linker to the first 19 base sequences of CGG according to the following method, OsLRK19_sg-F: 5'-TGTG-G(TCTCCGCCTCGTTCGTGTT)-3', OsLRK19_sg-R: 5'-AAAC-(AACACGAACGAGGCGGAGA)C-3'.

[0050] (2) Obtain the intermediate product by primer annealing to introduce the knockout target of OsLRK19, and the reaction system and conditions are as follows: forward primer OsLRK19_sg-F (10 μM) 1 μL, reverse primer OsLRK19_sg-R (10 μM) 1 μL, Anneal Buffer (1x TE buffer, 50 mM NaCl) 8 μL, 95°C for 10 min, 0.1°C / sec to 20°C.

[0051] (3) Use restriction enzyme BsaI (Takara) to cut the specific enzyme site on pOs vector to linearize it, and the enzyme cutting reaction system and conditions are as follows: 1 μg of plasmid, 5 μL of 10x buffer, 1 μL of BsaI, ddH2O to 50 μL, 37°C for 2-3 h, and recover according to the DNA purification kit (Tiangen general agarose gel DNA recovery kit DP209).

[0052] (4) Connect the annealed intermediate product with the enzyme-cut pOs linear vector, and the connection reaction system and conditions are as follows: 2 μL of annealed product, 2 μL of linear vector, 0.5 μL of 10x T4 DNA Ligase Buffer, 0.5 μL of T4 DNA Ligase, and 15 min at room temperature.

[0053] (5) Transform E. coli DH5a, after DH5a is melted, add the ligation product of the previous step, ice bath 30 min, 42°C heat shock 90 sec, 2 min on ice, add 700 μL of LB liquid medium without antibiotics, 37°C 200 rpm for 1 h, 5000 rpm centrifugal 1 min, discard most of the supernatant, leave 100 μL liquid suction and mix, spread on LB solid medium containing kanamycin, 37°C for 12 h.

[0054] (6) Pick single colonies into liquid LB liquid medium containing kanamycin, 37°C for 6 h, perform bacterial liquid PCR reaction, PCR reaction is performed according to the Novozyme 2xTaq Master Mix (Dye Plus) regular PCR amplification instructions, wherein the primer sequence of the PCR reaction is:

[0055] M13F: 5'-TGTAAAACGACGGCCAGT-3',

[0056] OsLRK19_sg-R: 5'-AAACAACACGAACGAGGCGGAGAC-3',

[0057] The positive single colony liquid is expanded, the plasmid is extracted and sequenced to verify, and the gene knockout vector pOs-OsLRK19 is obtained, the plasmid extraction kit is (Novozyme Plasmid Mini Kit), and the sequencing company is Kebi Biotechnology Co., Ltd.

[0058] (7) Recombinant positive plasmid is transferred into Agrobacterium EHA105, the reaction system and conditions are as follows: 50 μL EHA105 competent cells, 1 μL recombinant plasmid, ice bath 5 min, liquid nitrogen freezing 5 min, 37°C water bath 5 min, ice bath 5 min. Add 700 μL of LB liquid medium without antibiotics, 28°C 200 rpm for 2 h, 5000 rpm centrifugal 1 min, discard most of the supernatant, leave 100 μL liquid suction and mix, spread on LB solid medium containing kanamycin and rifampicin antibiotics, 28°C for two days.

[0059] (8) Pick single colonies into liquid LB medium containing kanamycin and rifampicin, 28°C for two days, perform bacterial liquid PCR reaction, wherein the PCR reaction is synchronous step (6). The positive single colony liquid can be used for subsequent rice genetic transformation experiment.

[0060] 2, The construction steps of the overexpression vector are as follows:

[0061] (1) With OsLRK19 gene CDS as a reference sequence, a primer with a pU1301 vector linker was designed and synthesized, and the primer sequence was: OsLRK19_OE-F: CGAACGATAGCCGGTACCATGGCGAAGCAAGCAACC and OsLRK19_OE-R: GTCGACTCTAGAGGATCCTCCTTCTTCCAAGAGGC, then the CDS of the OsLRK19 gene was used as a template, and high-fidelity enzyme (Novozyme PhantaMax Super-Fidelity DNA Polymerase high-fidelity enzyme) was used for amplification, so as to obtain the CDS fragment of the OsLRK19 gene with the pU1301 vector linker.

[0062] (2) The overexpression vector pU1301 was linearized by restriction enzymes KpnI and BamHI (Takara), and the enzyme reaction system and conditions were the same as step 1 (3).

[0063] (3) The OsLRK19 gene CDS was connected to the linearized vector pU1301 by homologous recombination enzyme (Novozyme IIOne Step Cloning Kit), so as to obtain the recombinant plasmid pU1301-OsLRK19.

[0064] (4) The subsequent experimental operation was the same as step 1 (5)-1 (8), and the agrobacterium liquid of the overexpression vector was obtained, wherein the liquid PCR detection primer was:

[0065] OsLRK19-JCF: CCAGGTTATGCTGGTTGAC,

[0066] pU1301-R: GGACACGCTGAACTTGTG.

[0067] 3. The constructed knockout and overexpression vector agrobacterium liquid was sent to Unime Biotechnology Co., Ltd. for rice genetic transformation, and the receptor rice variety was Nipponbare (NIP). After the rice genetic transformation was completed, the knockout lines (oslrk19-ko1, oslrk19-ko2 and oslrk19-ko3) and the overexpression lines (OsLRK19-OE#2, OsLRK19-OE#11 and OsLRK19-OE#13) were obtained, and plant detection was performed.

[0068] 4. Transgenic rice plant detection

[0069] (1) For the knockout plant, primers were designed and synthesized on both sides of the knockout target point, and the obtained T0 transgenic plant was sequenced, and the sequencing primer sequence was:

[0070] OsLRK19-CXF: CCTAGTGCTCTGCGTGGTCG,

[0071] OsLRK19-CXR: GATGTCGCGGAACTCGTCC.

[0072] As shown in Figure 2 A, there are three types of variations in the transgenic knockout lines, in which oslrk19-ko1 inserts a base C, oslrk19-ko2 deletes two bases, and oslrk19-ko3 inserts a base A. All the three variations result in changes in the amino acid sequence, and the protein translation is terminated prematurely Figure 2 B).

[0073] (2) For the overexpression plants, first, Western Blot detection was performed on all T0 single plants using GFP antibody Figure 3 A); then, the RNA level of three single plants OsLRK19-OE#2, OsLRK19-OE#11 and OsLRK19-OE#13 with higher protein level expression was further detected, as shown in Figure 3 B. Compared with the wild type, the expression amount of the OsLRK19 gene of the three overexpression single plants was increased by 12.53, 14.13 and 12.40 times, respectively. The primer sequence of qRT-PCR was qLRK19-F: 5'-TTCGGTCTCGCCAGATTGTACG-3' and qLRK19-R: 5'-TCCTATTGTGCCGACGACATGC-3'.

[0074] Example 4

[0075] Resistance identification of transgenic rice plants to sheath blight

[0076] The wild type (WT, NIP), knockout lines (oslrk19-ko1, oslrk19-ko2 and oslrk19-ko3) and overexpression lines (OsLRK19-OE#2, OsLRK19-OE#11 and OsLRK19-OE#13) of the gene were subjected to resistance identification to sheath blight by using the greenhouse sheath blight inoculation method.

[0077] The greenhouse sheath blight resistance identification method is as follows:

[0078] When rice plants reach the three-leaf stage, they are transplanted into long pots, five plants per pot. After inoculation until the end of tillering, they are transferred to a glass greenhouse and inoculated using the embedding method when the rice plants reach the early stage of heading. Before inoculation, naturally diseased and dead plants, as well as small or redundant tillers, are pruned. Using tweezers, a 1 cm long and 2 mm wide piece of wood bark (covered with mycelium) containing Rhizoctonia solani YN-7 is carefully embedded into the inner side of the leaf sheath 1 cm below the third leaf occipital. Five stems of relatively consistent growth stages are inoculated per seedling. After inoculation, a water layer of at least 1 cm is maintained in the long pots. The greenhouse temperature and light conditions are set to 14 h light (30°C) / 10 h dark (24°C). A spray humidifier is used to maintain humidity at 75%–90%. Lesion length is measured 7 days after inoculation.

[0079] When artificial inoculation is used in the greenhouse, Figure 4 As shown, the average lesion lengths of the three transgenic overexpression lines, OsLRK19-OE#2, OsLRK19-OE#11, and OsLRK19-OE#13 (14.12 cm, 13.72 cm, and 12.75 cm, respectively) were significantly or extremely significantly lower than those of wild-type NIP plants (16.56 cm), while the average lesion lengths of the three transgenic knockout lines, oslrk19-ko1, oslrk19-ko2, and oslrk19-ko3 (12.55 cm, 12.96 cm, and 13.10 cm, respectively) were significantly or extremely significantly higher than those of wild-type NIP plants (10.55 cm). These results indicate that the OsLRK19 gene positively regulates rice sheath blight resistance and that overexpression of this gene can significantly enhance rice sheath blight resistance.

[0080] Example 5

[0081] Investigation of agronomic traits of transgenic rice plants

[0082] In the field, the main agronomic traits of each transgenic line of the gene were investigated at the rice maturity stage, and the measurements were made on a plant basis, including plant height, number of tillers, heading date, number of grains per panicle, seed setting rate and 1000-grain weight ( Figure 5 The results showed that the plant height, tiller number, heading date, number of grains per panicle, seed setting rate and 1000-grain weight of the OsLRK19 gene overexpression line were not affected, while the plant height, number of grains per panicle and seed setting rate of the knockout line were reduced or decreased, and there were no significant differences in other traits, indicating that the gene has potential application value in breeding rice for sheath blight resistance.

Claims

1. A gene that can enhance the ability of rice to resist sheath blight OsLRK19 characterized in that, The gene OsLRK19 The CDS sequence of the gene is shown as SEQ ID NO.

1.

2. A gene capable of enhancing the resistance of rice to sheath blight according to claim 1 OsLRK19 overexpression vector pU1301- OsLRK19 ; the construction method of the overexpression vector pU1301- OsLRK19 is to amplify the CDS sequence of the gene by designing primers with pU1301 vector adaptors OsLRK19 _OE-F: CGAACGATAGCCGGTACCATGGCGAAGCAAGCAACC and OsLRK19 _OE-R:GTCGACTCTAGAGGATCCTCCTTCTTCCAAGAGGC, OsLRK19 recombine and ligate to the pU1301 vector, transform E. coli, and verify by sequencing, to finally obtain the overexpression vector pU1301- OsLRK19 .

3. A gene capable of enhancing the ability of rice to resist sheath blight according to claim 1 OsLRK19 or the use of an overexpression vector according to claim 2 for enhancing the ability of rice to resist sheath blight.

4. Use according to claim 3, characterized in that, By overexpressing OsLRK19 genes, the ability of rice to resist sheath blight is increased and the susceptibility is reduced.

5. A gene capable of enhancing the ability of rice to resist sheath blight according to claim 1 OsLRK19 OsLRK19 or the use of the overexpression vector according to claim 2 in breeding a strong sheath blight resistant rice germplasm.

Images