Application of TMEM171 protein in preparation of antiviral drugs

Abstract

The invention discloses an application of a TMEM171 protein in preparation of an antiviral drug, an application of a reagent for improving the expression quantity of the TMEM171 protein in preparation of the antiviral drug, and an application of a reagent for detecting the expression quantity of the TMEM171 protein or the mRNA level of the TMEM171 protein in preparation of a diagnostic kit for the development degree of virus infectious diseases. The invention discloses a new application of the TMEM171 molecule in development judgment of infectious diseases and preparation of anti-infective drugs, provides a new thought and way for research, development and utilization of pattern recognition receptors, further provides a novel infectious disease diagnostic agent and / or therapeutic agent for the field, and has a certain clinical application prospect.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the application of TMEM171 protein in the preparation of antiviral drugs. Background Art

[0002] Innate immunity is the first line of defense against pathogens. After a long period of evolution, the innate immune system recognizes relatively conservative pathogen-associated molecular patterns (PAMPs) and damage-associated molecular patterns (DAMPs) from damaged cells in the body through a series of pattern recognition receptors (PRRs). Pattern recognition receptors (PRRs) mainly include Toll-like receptors (TLRs), RIG-I-like receptors (RLRs), NOD-like receptors (NLRs), cyclic GMP-AMP synthase (cGAS), etc. ([1] TAKEUCHI O, AKIRA S. Pattern recognition receptors and inflammation [J]. Cell, 2010, 140(6): 805-20. [2] WU J, CHEN Z J. Innateimmune sensing and signaling of cytosolic nucleic acids [J]. Annu Rev Immunol, 2014, 32: 461-88.).

[0003] Viral nucleic acids (including RNA and DNA) are pathogen-associated molecular patterns (PAMPs) in viral infections. When pattern recognition receptors recognize viral nucleic acids, they activate downstream signaling pathways, including the JAK-STAT signaling pathway and the TBK1-IRF3 signaling axis, and ultimately activate transcription factors such as NF-κB and IRF to drive the transcriptional activation of inflammatory cytokines and interferons, thereby achieving the body's killing and clearance of viruses, thereby protecting the body's health ([1] TAN X, SUN L, CHEN J, et al. Detection of Microbial Infections Through Innate Immune Sensing of Nucleic Acids [J]. Annu Rev Microbiol, 2018, 72: 447-78. [2] CAO X. Self-regulationand cross-regulation of pattern-recognition receptor signalling in health and disease [J]. Nat Rev Immunol, 2016, 16(1): 35-50. [3] FERREIRA AR, MARQUESM, RIBEIRO D. Peroxisomes and Innate Immunity: Antiviral Response and Beyond[J]. Int J Mol Sci, 2019, 20(15).).

[0004] As a member of the TMEM family, TMEM171 (Homo sapiens transmembrane protein 171, NCBI accession number: NM_001161342, TMEM171 protein encoding gene Gene ID: 134285; Mus musculus transmembraneprotein 171, NCBI accession number: NM_001025606, TMEM171 protein encoding gene Gene ID: 380863) has not been reported in terms of its biological function. The molecular structure of TMEM171 has many similarities with TMEM173 (also known as STING). TMEM171 and STING have similar molecular weights, and both TMEM171 and STING, as transmembrane proteins, span the membrane four times. Therefore, it is of positive significance to explore whether TMEM171 has similar antiviral functions as STING. Summary of the invention

[0005] In view of the above technical problems existing in the prior art, the present invention provides the use of TMEM171 protein in the preparation of antiviral drugs, thereby providing a new target for the development of antiviral drugs.

[0006] The inventors have found through research that TMEM171 molecules can significantly inhibit viral replication in vivo and in vitro, thereby playing an antiviral infection role. It can be inferred that the decline in the level of TMEM171 molecules is related to the occurrence and development of viral infectious diseases (thus used to determine whether the risk of death is higher) and treatment (which can positively increase the molecular level of TMEM171 in patients), so that it can be used as a molecular indicator for judging the development of infectious diseases and the preparation of anti-infective drugs, and the present invention is completed.

[0007] The present invention first provides the use of TMEM171 protein in the preparation of antiviral drugs. Preferably, the antiviral drug targets RNA viruses. More preferably, the RNA virus is vesicular stomatitis virus (VSV).

[0008] The present invention further provides the use of a reagent for increasing the expression of TMEM171 protein in the preparation of an antiviral drug, wherein the reagent for increasing the expression of TMEM171 protein is an expression cassette, an expression plasmid or an artificial chromosome comprising a gene encoding the TMEM171 protein. By transferring a gene sequence capable of expressing the TMEM171 protein into the body of a subject to be treated, the TMEM171 protein can be expressed, thereby also increasing the expression of the TMEM171 protein. Preferably, the antiviral drug targets an RNA virus. More preferably, the RNA virus is vesicular stomatitis virus (VSV).

[0009] The inventors discovered through experiments that the expression of TMEM171 would increase under viral stimulation and was positively correlated with IFN-β. Cell experiments and animal experiments showed that peritoneal macrophages and bone marrow-derived macrophages were infected with vesicular stomatitis virus coupled to green fluorescent protein (VSV-eGFP), and the replication of the virus was detected by flow cytometry. It was found that the level of viral replication was higher in primary peritoneal macrophages and bone marrow-derived macrophages of mice with TMEM171 gene defects. In primary peritoneal macrophages of mice with TMEM171 gene defects, the production of type I interferon Ifnb1 and interferon-stimulated gene Isg15 mediated by vesicular stomatitis virus (VSV) and hpRNA, as well as proinflammatory cytokines Il6 and Tnf, decreased. In the VSV-infected mouse model, compared with wild-type mice, the VSV replication levels in the liver, spleen, and lung tissues of TMEM171 myeloid knockout gene-deficient mice were higher, and HE staining results showed that the pulmonary edema, alveolar hemorrhage, alveolar wall thickening, and neutrophil infiltration were much more severe.

[0010] It can be seen that increasing the content of TMEM171 in the body helps to alleviate the above conditions. Therefore, the drug is an agent that increases the expression of TMEM171, which is used to promote the production of type I interferon. When used to fight viral infection, it is preferably used to inhibit viral replication and positively regulate the production of type I interferon.

[0011] Preferably, the TMEM171 protein or the gene encoding the TMEM171 protein is from: human, rat, mouse, dog, horse, cow, rabbit or monkey.

[0012] The present invention also provides the use of a reagent for detecting the expression amount of TMEM171 protein or the mRNA level of TMEM171 protein in preparing a diagnostic kit for the development degree of viral infectious diseases.

[0013] Preferably, the reagent for detecting the expression amount of TMEM171 protein comprises a monoclonal antibody against TMEM171 protein; The reagent for detecting the mRNA level of the TMEM171 protein includes a specific primer pair for amplifying the mRNA of the TMEM171 protein.

[0014] The diagnostic kit includes reagents for detecting the content of TMEM171 protein or mRNA in a biological sample, such as a reverse transcription system, a primer system, and an amplification system. Since the sequence of the TMEM171 molecule is known in the art, a person of ordinary skill in the art can extract and reverse transcribe total RNA using a commercial kit, prepare primers for amplifying TMEM171 cDNA based on conventional means or obtain them commercially available and amplify them.

[0015] Beneficial effects of the present invention: The present invention discloses a new use of TMEM171 molecules in determining the development of infectious diseases and in the preparation of anti-infective drugs, provides new ideas and approaches for the research, development and utilization of pattern recognition receptors, and further provides a novel infectious disease diagnostic agent and / or therapeutic agent in the art, which has certain clinical application prospects.

[0016] In terms of technology, the detection of TMEM171 is essentially a quantitative PCR test of the blood genome, which has the characteristics of simple operation, sensitive detection, good specificity and high repeatability. It has been increasingly used in clinical testing technology.

[0017] In addition, the decrease in the molecular level of the indicator TMEM171 involved in the present invention in infectious disease tissues is closely related to the occurrence and development of infectious diseases. The occurrence and development of infectious diseases can be assisted in diagnosis by detecting the expression abundance of TMEM171 in the patient's peripheral blood genomic RNA, and the expression level of TMEM171 in the patient can be targetedly increased according to the test results to carry out anti-infection treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 It shows that the expression level of TMEM171 increases under viral stimulation and is positively correlated with IFN-β. Figure 1 The ac in the figure is macrophage THP-1 ( Figure 1 a), PM ( Figure 1 b), BMDM ( Figure 1 (c) After VSV virus stimulation for 0, 4, and 8 hours, the mRNA level of TMEM171 was detected by real-time fluorescence quantitative PCR. Figure 1 (d) shows the protein level of TMEM171 detected by Western Blot in HEK293T cells after VSV virus stimulation for 0, 4, and 8 hours. Figure 1 The eg in the figure is a peripheral blood sample from a clinical influenza A patient. The mRNA levels of TMEM171 and IFN-β were detected by real-time fluorescence quantitative PCR, and correlation analysis was performed. The mRNA levels of TMEM171 ( Figure 1 e in the figure), IFN-β mRNA level ( Figure 1 f), the correlation between TMEM171 and IFN-β ( Figure 1 g). The results show the mean ± SD (n = 3), *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

[0019] Figure 2 The expression of TMEM171 in peritoneal macrophages, bone marrow-derived macrophages, and HEK293T cells was shown to be correlated with viral replication. Figure 2 Ab in the figure represents the replication of VSV-eGFP in primary peritoneal macrophages (PM) of normal and TMEM171 gene-deficient mice after 0 and 8 hours of VSV-eGFP virus stimulation. Flow cytometry was used to detect the replication of VSV-eGFP in PM cells. Figure 2 The cd in the figure indicates the replication of VSV-eGFP in bone marrow-derived macrophages (BMDM) of normal and TMEM171 gene-deficient mice after 0 and 8 hours of VSV-eGFP virus stimulation. The replication of VSV-eGFP in BMDM cells was detected by flow cytometry. Figure 2Figure ef in the figure shows the replication of VSV-eGFP in HEK293T cells after TMEM171 overexpression for 0 and 8 hours. The results are mean ± standard deviation (n=3), *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0020] Figure 3 The expression of TMEM171 was shown to be correlated with the production of type I interferon, interferon-stimulated genes, and inflammatory cytokines induced by vesicular stomatitis virus (VSV) and hpRNA (0.3 μg / μL). Figure 3 af in the figure represents the expression levels of Tmem171, VSV, Ifnb1, Isg15, Il6 and Tnf detected by real-time fluorescence quantitative PCR in normal and TMEM171-deficient primary mouse peritoneal macrophages 0, 4, and 8 hours after infection with VSV (MOI=1). Figure 3 gk in the figure is the expression levels of Tmem171, Ifnb1, Isg15, Il6 and Tnf detected by real-time fluorescence quantitative PCR in primary mouse peritoneal macrophages with normal and TMEM171 deficiency after infection with hpRNA (0.3μg / μL) for 0 and 8 hours; the results show the mean ± standard deviation (n=3), *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. The p value was calculated by unpaired Student's t test and two-way ANOVA in GraphPad Prism.

[0021] Figure 4 The correlation between TMEM171 expression and viral infection was shown. Figure 4 The ac in the figure is the real-time fluorescence quantitative PCR detection of the lungs of the two groups of mice ( Figure 4 a) in the spleen ( Figure 4 b) and liver ( Figure 4 c) The RNA replication level of VSV. Figure 4 Figure d is HE staining of mouse lung tissue, and the results show that the edema, alveolar hemorrhage, alveolar wall thickening and neutrophil infiltration in the lungs of TMEM171 gene-deficient mice are much more severe. The results show the mean ± standard deviation (n = 5); *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. DETAILED DESCRIPTION

[0022] The reagents and raw materials used in the present invention are all commercially available or can be prepared according to literature methods. The experimental methods in the following examples without specifying specific conditions are usually carried out according to conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to conventional conditions, or according to the conditions recommended by the manufacturer. Unless otherwise specified, percentages and parts are calculated by volume.

[0023] Example 1

[0024] It was verified that the expression level of TMEM171 gene increased under viral stimulation and was positively correlated with IFN-β.

[0025] The NCBI accession number of the mouse TMEM171 gene is: NM_001025606, and the Gene ID of the gene encoding the mouse TMEM171 protein is: 380863.

[0026] lysm + Tmem171 f / f Myeloid conditional knockout mice were purchased from Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd. The Tmem171 gene was conditionally knocked out in the myeloid lineage using Cas9 technology. The genetic changes were as follows: (1) Loxp was inserted at both ends of the Tmem171 gene exon; (2) the Cre enzyme gene driven by the myeloid cell-specific promoter Lysm was inserted into the mouse genome. lysm + Tmem171 f / f Myeloid conditional knockout mice were raised in an SPF environment, and 6-8 week old wild-type mice and TMEM171 gene-deficient mice were obtained by hybridization.

[0027] 1. Acquisition and culture of mouse peritoneal macrophages: Intraperitoneal injection of 3 ml of 3% (mass-volume ratio) thioglycolate solution (autoclaved in advance). Three days later, the mice were killed by cervical dislocation, soaked in 75% ethanol for 5 minutes, and transferred to a sterile operating table. The peritoneum was exposed, and 10 ml of sterile PBS was drawn with a 10 ml syringe to rinse the peritoneal cavity 3-5 times. After aspiration, centrifugation was performed at 1000 rpm for 5 minutes. The supernatant was discarded, and the cells were resuspended in DMEM (Basal Media) containing 10% FBS (ExCellBio) and counted. Peritoneal macrophages were inoculated in 24-well plates at a cell density of 1×10 6 / well, placed in an incubator at 37°C, 5% CO2, and infected with VSV the next day.

[0028] 2. Obtaining and culturing mouse bone marrow-derived macrophages: 6-8 week old mice were killed by cervical dislocation, soaked in 75% ethanol for 5 minutes, and transferred to a sterile operating table. With the ventral surface facing up, gently lift the epidermis at the root of the thigh, open a small incision with ophthalmic scissors, tear the epidermis from the root of the femur to the sole of the foot, and cut the humerus and femur between the humerus and the sole of the foot with ophthalmic scissors. Separate the bilateral humerus and femur and place them in a 6cm culture dish. Add 2ml sterile PBS, use a 1mL syringe to blow out the bone marrow, and repeatedly blow and aspirate until the bone turns white. Transfer the bone marrow suspension to a centrifuge tube, centrifuge at 1000rpm for 5min at room temperature, discard the supernatant, add 1mL red blood cell lysis buffer (Beyotime) to resuspend the cells, mix well, and stand at room temperature for 5min. Centrifuge at 1000rpm for 5min at room temperature, remove the supernatant, and resuspend with BMDM induction medium (2% L929 cell culture supernatant + 98% DMEM complete medium). BMDM was inoculated in a 24-well plate with a cell density of 1×10 6 / well, place in an incubator at 37°C, 5% CO2 for culture, supplement with 100 μL of induction medium on the 3rd day after plating, replace the induction medium on the 5th day, and VSV infection can be carried out after the 7th day.

[0029] 3. Culture and polarization of THP-1 cells: The cells were cultured in RPMI-1640 (Basal Media) medium containing 10% FBS (ExCellBio) in an incubator at 37°C and 5% CO2. The cell suspension was transferred to a centrifuge tube and centrifuged at 1000 rpm for 5 min at room temperature. The supernatant was removed and the cells were resuspended and counted. PMA (MedChemExpress, final concentration of 50 ng / mL) was added to the cell suspension for polarization. THP-1 containing PMA was inoculated in a 24-well plate at a cell density of 5×10 5 / well, replace with fresh culture medium after overnight polarization for subsequent VSV infection.

[0030] 4. Construction process of TMEM171 full-length overexpression plasmid: Log in to the NCBI website to query the human TMEM171 gene sequence (NCBI accession number: NM_001161342), copy the CDS sequence in the mRNA sequence and part of the 5'-UTR sequence adjacent to the promoter. Use the NEB cutter online restriction site analysis tool to analyze the potential restriction sites in the constructed plasmid target gene, obtain the potential restriction sites already contained in the target gene, and compare the restriction sites provided in the multiple cloning site of the plasmid expression vector used. Eliminate the restriction sites in the target gene, and the remaining vector restriction sites are the available restriction sites. Design cloning primers (the forward primer starts from before the promoter, and the reverse primer removes the last stop codon to obtain the reverse complementary sequence), calculate the annealing temperature of the forward sequence and the reverse complementary sequence, generally control the temperature to 60 degrees, and the temperature difference is not higher than 2 degrees. The lower the temperature difference, the better. The bases at the end of the sequence are preferably C and G. The primer sequences are as follows: Human TMEM171 upstream primers: 5'-ATTA GCGGCCGC AATGTCTCCTGCAGCTG-3', Human TMEM171 downstream primers: 5'-ATTA GCGATCG CCGGTGGGGAAGGC-3', ATTA is a protective base, the underlined part is a restriction site, and the bold base A in the forward primer is an additional base added by aligning the reading frame to ensure that the reading frame will not shift. The cDNA of human macrophage THP-1 was used as a template to amplify the target gene fragment according to the following reaction system and procedure.

[0031] The PCR amplification system is shown in Table 1 below.

[0032] Table 1

[0033] The PCR amplification program is shown in Table 2 below.

[0034] Table 2

[0035] After the PCR is completed, take 5μl of the PCR product for agarose gel electrophoresis, and judge whether the PCR amplification is successful based on the size of the band. If the amplification is successful and the product is single, the remaining PCR reaction solution can be directly recovered using the product purification kit, and the purified product and the empty template plasmid are double-digested. After the digestion product is subjected to agarose gel electrophoresis, the corresponding target band is cut and gel recovered. Determine the concentration of the target fragment and the vector, and add the reaction system for connection according to the vector / fragment molar ratio of 1:4 to 1:10, where the connection reagent buffer is 2μl, T4 DNA ligase is 1μl, and the vector DNA is 50ng. Calculate the required volume of the target fragment according to the molar ratio and make up to 20μl system with sterilized ddH2O. Connect overnight at 16℃, mix the connection product with 50μl of DH5α competent cells, heat shock at 42℃ for 90s after 30min on ice, and then place on ice for 5min. Add 900μl of non-resistant LB medium and place in a bacterial shaker for 1 hour at 37℃ and 220rpm, centrifuge at 5000rpm for 5min, discard part of the supernatant, and leave 100μl of bacterial solution to be coated on a solid LB culture plate with corresponding resistance of the plasmid. After culturing overnight at 37℃ in the bacterial incubator, take out, pick a monoclonal colony and shake the bacteria to extract the plasmid. The extracted plasmid is identified by enzyme digestion and sequenced. If the sequence is correct, the plasmid is transfected into HEK293T cells to verify whether the plasmid can be successfully expressed. After successful expression, a large number of amplified extracted plasmids are stored at -20℃ for standby use.

[0036] 5. Cytokine detection: (1) Real-time fluorescence quantitative PCR detection of type I interferon and inflammatory factor expression: Total RNA was extracted using Trizol reagent (Acori Biotechnology Co., Ltd.) according to the product instructions.

[0037] Reverse transcription PCR used Takara reverse transcription kit with the following program: 42°C, 60 min; 72°C, 5 min; 25°C, 5 min; 4°C, 5 min.

[0038] Real-time fluorescence quantitative PCR: SYBR Green quantitative PCR reagent (Aicore Biotechnology Co., Ltd.) was used.

[0039] The primers used were synthesized by Shanghai Jierui Bioengineering Co., Ltd. The specific sequences are as follows: Mouse β-actin: Upstream: 5'-ATGCTCCCCGGGCTGTAT-3', Downstream: 5′-CATAGGAGTCCTTCTGACCCATTC-3′.

[0040] Mouse Tmem171: Upstream: 5'-TCAGATTGGGCACAGGAACC-3', Downstream: 5′-GGAGTTGGGGTCCCGTAGTT-3′.

[0041] Mouse Ifnb1: Upstream: 5'-ATGAGTGGTGGTTGCAGGC-3', Downstream: 5′-TGACCTTTCAAATGCAGTAGATTCA-3′.

[0042] Mouse Isg15: Upstream: 5'-AGAAGCAGATTGCCCAGAAG-3', Downstream: 5′-TGCGTCAGAAAGACCTCATAGA-3′.

[0043] Mouse Tnf: Upstream: 5'-GCCACCACGTCTTCTGTCT-3', Downstream: 5′-TGAGGGTCTGGGCCATAGAAC-3′.

[0044] Mouse Il6: Upstream: 5'-ACAACCACGGCCTTCCCTAC-3', Downstream: 5′-CATTTCCACGATTTCCCAGA-3′.

[0045] Human GAPDH: Upstream: 5'-ACAGTCAGCCGCATCTTCTT-3', Downstream: 5′-ACGACCAAATCCGTTGACTC-3′.

[0046] Human TMEM171: Upstream: 5'-GGACAGACACGTCAGCAAACT-3', Downstream: 5′-GGGAGGGGCTTATATTGGCAT-3′.

[0047] Human IFNB1: Upstream: 5'-ATGACCAACAAGTGTCTCCTCC-3', Downstream: 5′-GGAATCCAAGCAAGTTGTAGCTC-3′.

[0048] VSV: Upstream: 5'-ACGGCGTACTTCCAGATGG-3', Downstream: 5′-CTCGGTTCAAGATCCAGGT-3′.

[0049] The results are as follows Figure 1 As shown in a-c, macrophage THP-1 ( Figure 1 a), PM ( Figure 1 b), BMDM ( Figure 1 (c) After VSV virus stimulation for 0, 4, and 8 hours, the mRNA level of TMEM171 was detected by real-time fluorescence quantitative PCR. The mRNA level of TMEM171 increased with viral stimulation.

[0050] (2) Western Blot detection of TMEM171 protein expression level: HEK293T cell transfection: HEK293T cells were counted and plated in a 24-well plate, 3 × 10 4 / well, placed in an incubator at 37°C, 5% CO2, and cultured overnight. The next day, jetPRIME ® Transfect plasmid (500 ng / well), perform experimental operations according to the product instructions, and replace fresh culture medium 6 hours after transfection. 36 hours after transfection, stimulate cells with VSV (MOI = 0.025) for 0, 4, and 8 hours, discard the supernatant, collect cells with 1× loading buffer, and perform Western Blot experiments.

[0051] Antibody catalog numbers and sources used in Western Blot: TMEM171 (P45-59943) was purchased from Invitrogen, and β-actin (F009) was purchased from ORIGENE.

[0052] The results are as follows Figure 1 As shown in (d), VSV stimulation induced an increase in the expression of TMEM171 protein.

[0053] (3) Real-time fluorescence quantitative PCR (same method as above) was used to detect the expression of TMEM171 and IFN-β in the patient's peripheral blood (clinical samples were obtained from the Second Affiliated Hospital of Zhejiang University School of Medicine): The results are as follows Figure 1 As shown in Figures e and f, for peripheral blood samples of clinical influenza A patients, the mRNA levels of TMEM171 and IFN-β were detected by real-time fluorescence quantitative PCR, showing that the mRNA level of TMEM171 ( Figure 1 e) and IFN-β mRNA levels ( Figure 1 f) in both increased with viral infection, and the expression levels were higher in critically ill patients; Figure 1The g in Figure 2 shows that TMEM171 and IFN-β are positively correlated.

[0054] The above results show that the expression of TMEM171 is increased by virus stimulation and is positively correlated with IFN-β, suggesting that TMEM171 can positively regulate the virus-mediated innate immune response in macrophages.

[0055] Example 2

[0056] Verify that the TMEM171 gene inhibits the replication of VSV virus.

[0057] Flow cytometry detection of VSV-eGFP replication: Peritoneal macrophages and bone marrow-derived macrophages were infected with vesicular stomatitis virus conjugated with green fluorescent protein (VSV-eGFP) 0 and 8 hours later, the supernatant was discarded, the cells were collected with PBS and centrifuged at 5000 rpm for 5 min, the supernatant was discarded, the cells were resuspended in PBS and filtered into a flow tube, and the FITC channel was detected by flow cytometry. The proportion of the positive group in the FITC channel reflected the replication of the VSV-eGFP virus.

[0058] The results are as follows Figure 2 As shown in af, TMEM171 gene deletion can promote VSV-eGFP expression in peritoneal macrophage PM ( Figure 2 a, b) and replication in bone marrow-derived macrophages BMDM ( Figure 2 c, d); TMEM171 gene overexpression can inhibit the replication of VSV-eGFP in HEK293T cells ( Figure 2 e, f).

[0059] The above results show that when TMEM171 expression is defective, the expression levels of type I interferon and inflammatory factors induced by VSV infection are significantly lower than those in the control group, and the viral replication level is higher; at the same time, overexpression of TMEM171 can inhibit the replication of VSV-eGFP virus in HEK293T cells. This suggests that TMEM171 can positively regulate the innate immune response induced by RNA viruses in cells.

[0060] Example 3

[0061] We further verified that TMEM171 promoted the inflammatory response induced by VSV stimulation in vitro.

[0062] lysm + Tmem171 f / f Myeloid conditional knockout mice were purchased from Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd. and raised in an SPF environment. 6-8 week old wild-type mice and TMEM171 gene-deficient mice were obtained by hybridization.

[0063] The hpRNA sequence is: 5'-pppGGAGCAAAAGCAGGGUGACAAAGACAUAAUGGAUCCAAACACUGUGUCAAGCUUUCAGGUAGAUUGCUUUCUUUGGCAUGUCCGCAAAC-3'. hpRNA is a hairpin RNA purchased from InvivoGen. It is a transcription of the influenza A (H1N1) virus sequence and is a RIG-I agonist. RIG-I can activate type I interferon to trigger an antiviral immune response.

[0064] After obtaining mouse peritoneal macrophages according to the method of Example 1 (including detection primers of corresponding genes), PM cells were stimulated with VSV (MOI=1) for 0, 4, and 8 hours, and the mRNA expression levels of type I interferon and inflammatory factors were detected by real-time fluorescence quantitative PCR ( Figure 3 PM cells were stimulated with hpRNA (0.3 μg / μL) for 0 and 8 hours, and the mRNA expression levels of type I interferon and inflammatory factors were detected by real-time fluorescence quantitative PCR ( Figure 3 The cytokine detection method is the same as that in Example 1.

[0065] The results are as follows Figure 3 As shown in gk, TMEM171 gene deletion can inhibit the mRNA expression levels of type I interferon Ifnb1, interferon-stimulated gene Isg15, proinflammatory cytokine Il6, and Tnf induced by VSV and hpRNA infection.

[0066] The results showed that primary peritoneal macrophages from mice with TMEM171 gene deficiency significantly inhibited the production of type I interferon Ifnb1 and interferon-stimulated gene Isg15 mediated by vesicular stomatitis virus (VSV) and hpRNA, as well as the decreased production of proinflammatory cytokines Il6 and Tnf, thereby promoting the viral replication rate.

[0067] Example 4

[0068] TMEM171 inhibits viral replication in vivo.

[0069] lysm + Tmem171 f / f Myeloid conditional knockout mice were purchased from Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd. and raised in an SPF environment. Wild-type mice and TMEM171 gene-deficient mice of the same litter aged 6-8 weeks were obtained by hybridization. VSV virus (5×10 7pfu / g), and the mice were killed by cervical dislocation 18 hours later and immersed in 75% ethanol for 5 minutes. The liver, spleen, and lungs of the mice were taken out in a biosafety cabinet, and total RNA was extracted using Trizol (Acori Biotechnology Co., Ltd.) according to the steps in the product manual.

[0070] Reverse transcription and real-time fluorescence quantitative PCR detection were the same as the above method, and the VSV primer sequences were: upstream: ACGGCGTACTTCCAGATGG; downstream: CTCGGTTCAAGATCCAGGT. Real-time fluorescence quantitative PCR was used to detect the mRNA level of VSV in liver, spleen and lung tissues to reflect the proliferation rate of the virus.

[0071] The results are as follows Figure 4 As shown in (ac), VSV viral replication levels were elevated in the liver, spleen, and lungs of TMEM171 conditional knockout-deficient mice compared with wild-type mice.

[0072] The lung tissues were fixed and sent to Hangzhou Haoke Biological Co., Ltd. for HE section staining.

[0073] The results are as follows Figure 4 As shown in (d), the edema, alveolar hemorrhage, alveolar wall thickening, and neutrophil infiltration in the lungs of TMEM171-deficient mice were much more severe than those of wild-type mice.

[0074] The results show the mean ± SD (n = 5), *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

[0075] p values ​​were calculated using unpaired Student's t test and two-way ANOVA in GraphPad Prism.

[0076] The results showed that TMEM171 gene deletion significantly promoted viral replication rate and promoted lung tissue damage.

[0077] From the above experiments, we can see that as pathogen-associated molecular patterns (PAMPs) recognized by the body, viral VSV and hpRNA as well as influenza A virus can induce the biological body to produce an innate immune response, which is a common reaction when the body is infected by the virus. Based on this, it can be clearly inferred that when the body is infected by the virus, increasing the expression level of TMEM171 in the body can effectively resist viral infection, inhibit viral replication, and thus protect the body.

[0078] In summary, the decrease in the molecular level of the indicator TMEM171 involved in the present invention in infectious disease tissues is closely related to the occurrence and development of infectious diseases. The occurrence and development of infectious diseases can be assisted in diagnosis by detecting the expression abundance of TMEM171 in the patient's peripheral blood genomic RNA, and the expression level of TMEM171 in the patient can be targetedly increased according to the test results to carry out anti-infection treatment.

[0079] Therefore, the present invention discloses the use of TMEM171 molecules in the judgment of the development of infectious diseases and the preparation of anti-infective drugs, provides new ideas and approaches for the research, development and utilization of pattern recognition receptors, and further provides a novel infectious disease diagnostic agent and / or therapeutic agent for the field, which has certain clinical application prospects.

Claims

1. Application of TMEM171 protein in the preparation of antiviral drugs.

2. The use according to claim 1, characterized in that: The antiviral drug targets RNA viruses.

3. The use according to claim 2, characterized in that: The RNA virus is vesicular stomatitis virus.

4. Use of a reagent for increasing the expression of TMEM171 protein in the preparation of an antiviral drug, characterized in that: The reagent for increasing the expression of TMEM171 protein is an expression cassette, an expression plasmid or an artificial chromosome containing a gene encoding the TMEM171 protein.

5. The use according to claim 4, characterized in that: The antiviral drug targets RNA viruses.

6. The use according to claim 5, characterized in that: The RNA virus is vesicular stomatitis virus.

7. Use of a reagent for detecting the expression of TMEM171 protein or the mRNA level of TMEM171 protein in the preparation of a diagnostic kit for the degree of development of viral infectious diseases.

8. The use according to claim 7, characterized in that: The reagent for detecting the expression amount of TMEM171 protein includes a monoclonal antibody against TMEM171 protein; The reagent for detecting the mRNA level of the TMEM171 protein includes a specific primer pair for amplifying the mRNA of the TMEM171 protein.

Images