A strain of Aspergillus terreus JM-F5-6 and its application in promoting tomato growth and improving soil nutrients

Through screening and applying Aspergillus JM-F5-6, the problems of decreasing soil fertility and frequent pests and diseases were solved, the improvement of soil nutrients and tomato growth were achieved, and efficient biological agents were provided to fight diseases, and the sustainable development of agricultural production was promoted.

CN119931851BActive Publication Date: 2025-07-29WEIFANG UNIV OF SCI & TECH
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510412715.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-03
Publication Date
2025-07-29
Estimated Expiration
2045-04-03

AI Technical Summary

Technical Problem

In the prior art, soil fertility declines and frequent pests and diseases affect crop yield and quality, and there is a lack of efficient and sustainable solutions for Aspergillus strains to promote plant growth and improve soil fertility.

Method used

A strain of Aspergillus phytonus JM-F5-6 was screened out, which has strong protein decomposition and acid production ability. It can improve soil hydrolyzable nitrogen, effective phosphorus, fast-acting potassium and organic matter content, promote tomato growth and antagonize tomato specialized bacteria of Fusarium oxysporus, and enhance plant photosynthesis and nitrogen absorption.

Benefits of technology

Significantly improve soil fertility, promote tomato roots and leaves growth, enhance plant health, improve the dissolution efficiency of insoluble nutrients in the soil, provide biological agents to fight soil-borne diseases, and achieve green and efficient agricultural production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119931851B_ABST
    Figure CN119931851B_ABST
Patent Text Reader

Abstract

The present invention provides a strain of Aspergillus terreus JM-F5-6 and its application in promoting tomato growth and improving soil nutrients, belonging to the field of microbial technology. The preservation number of the Aspergillus terreus JM-F5-6 is CCTCC NO: M20232616. The conidia of the Aspergillus terreus JM-F5-6 are spherical or oval, with a smooth surface. The hyphae are colorless or slightly colored, with thick walls and septa. The hyphal branches are laterally connected to form a reticular topology. The Aspergillus terreus JM-F5-6 has strong proteolytic ability and acid-producing ability, which helps to improve the soil environment, enhance plant photosynthesis and nitrogen absorption, improve plant health and growth, and at the same time effectively increase the contents of hydrolyzable nitrogen, available phosphorus, available potassium and organic matter in the soil, improve soil fertility, and has broad market application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of microbiology, and particularly relates to an Aspergillus terreus strain JM-F5-6 and its application in promoting tomato growth and improving soil nutrients. Background Art

[0002] Aspergillus terreus belongs to the genus Aspergillus in the family Trichocomaceae, order Eurotiales, class Eurotiomycetes, phylum Ascomycota. Aspergillus terreus, an important component of the soil microbial community, is widely distributed in nature and thrives better in soil environments rich in organic matter. The abundant carbon and nitrogen sources for Aspergillus terreus come from the decomposition of plant residues such as fallen leaves and dead branches, enabling it to reproduce in large numbers. Aspergillus terreus participates in the regulation of soil fertility and the transformation of organic matter, and there is a potential interaction with the growth and development of crops.

[0003] Currently, agricultural production faces challenges such as declining soil fertility and frequent occurrence of pests and diseases, which affect crop yield and quality. In the agricultural ecosystem, the role of microorganisms is crucial. Aspergillus terreus is a fungus widely distributed in soil and has potential agricultural application value. However, there are many species of Aspergillus terreus in the natural environment with different functions, and some of them are important plant pathogens that can cause diseases in various crops, such as wheat crown rot and ear blight.

[0004] Due to the significant differences in the physiological characteristics, enzyme activities, and functional performances of Aspergillus terreus in the environment, there is an urgent need to carry out targeted screening work to obtain Aspergillus terreus strains with specific excellent functions and deeply explore their functional mechanisms, including the decomposition of organic and inorganic substances in the soil, salt and alkali resistance, soil-borne diseases, and the growth-promoting effect on plants, so as to provide technical support for plant growth promotion and soil fertility improvement, open up a new path for green, efficient, and sustainable development, and have far-reaching significance for improving agricultural production efficiency, reducing the use of chemical inputs, and promoting the balance of the agricultural ecological environment. Summary of the Invention

[0005] The object of the present invention is to provide an Aspergillus terreus strain JM-F5-6 and its application in promoting tomato growth and improving soil nutrients. The Aspergillus terreus strain JM-F5-6 described in the present invention has strong protein decomposition ability and high acid production ability, which helps to improve the soil environment, and at the same time effectively increases the contents of hydrolyzable nitrogen, available phosphorus, available potassium, and organic matter in the soil, improves soil fertility, and provides technical support for plant growth promotion and soil fertility improvement.

[0006] To achieve the above object of the invention, the present invention is implemented by adopting the following technical solutions:

[0007] The present invention provides a strain of Aspergillus terreus JM-F5-6, whose taxonomic name is Aspergillus terreus , and it is deposited in the China Center for Type Culture Collection with the deposit number of CCTCC NO: M20232616.

[0008] Furthermore, the conidia of the Aspergillus terreus JM-F5-6 are spherical or oval, with a smooth surface, and the color is green, pink or reddish-brown. The hyphae are colorless or slightly colored, with thick walls and septa, and a reticular topology is constructed through lateral connections between the hyphal branches.

[0009] The present invention also provides the application of the Aspergillus terreus JM-F5-6 in a biological agent for promoting the growth of tomatoes.

[0010] Furthermore, the growth of the tomatoes includes an increase in tomato nutrients and the growth of tomato roots.

[0011] Furthermore, the Aspergillus terreus JM-F5-6 can increase the length, surface area and volume of the roots, and improve the root length and root area of the roots.

[0012] Furthermore, the Aspergillus terreus JM-F5-6 can increase the chlorophyll content and nitrogen content in tomato leaves.

[0013] The present invention also provides the application of the Aspergillus terreus JM-F5-6 in improving soil nutrients.

[0014] Furthermore, the Aspergillus terreus JM-F5-6 has the ability to produce high yields of protease, neutral phosphatase and cellulase.

[0015] Furthermore, the Aspergillus terreus JM-F5-6 has the ability to secrete organic acids and is resistant to salt and alkali.

[0016] Furthermore, the Aspergillus terreus JM-F5-6 can increase the contents of hydrolyzable nitrogen, available phosphorus, available potassium and organic matter in the soil.

[0017] The present invention also provides the application of the Aspergillus terreus JM-F5-6 in a biological agent for preparing a biological agent for inhibiting Fusarium oxysporum f. sp. lycopersici.

[0018] Compared with the prior art, the advantages and beneficial technical effects of the present invention are:

[0019] 1. The Aspergillus terreus JM-F5-6 screened by the present invention has a high enzyme-producing ability, specifically including neutral phosphatase, protease and cellulase, and also has the ability to secrete organic acids, which also shows its role in promoting the dissolution of insoluble nutrients, further improving the nutrients in the soil and increasing soil fertility.

[0020] 2. The soil fungus JM-F5-6 screened in the present invention has the biological function of antagonizing Fusarium oxysporum f. sp. lycopersici, providing a theoretical basis for the research and development and application of related biological agents in the later stage.

[0021] 3. The soil fungus JM-F5-6 screened in the present invention has a strong plant growth-promoting ability, especially has a positive effect on the roots and leaves of tomatoes. The soil fungus JM-F5-6 can enhance plant photosynthesis and nitrogen absorption, improve plant health and growth, and the research and development of these substances will provide new ideas and methods for agricultural production. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 is a morphological diagram of the soil fungus JM-F5-6 inoculated on Rose Bengal medium;

[0023] Figure 2 is a colony morphological diagram of the soil fungus JM-F5-6 inoculated on protein medium;

[0024] Figure 3 is a content diagram of protease secreted by the soil fungus JM-F5-6;

[0025] Figure 4 is a diagram of the activation of inorganic phosphorus by the soil fungus JM-F5-6;

[0026] Figure 5 is a diagram of the activation of organic phosphorus by the soil fungus JM-F5-6;

[0027] Figure 6 is a data diagram of the production of neutral phosphatase by the soil fungus JM-F5-6;

[0028] Figure 7 is a diagram of the identification result of the cellulose decomposition function plate of the soil fungus JM-F5-6;

[0029] Figure 8 is a data diagram of the production of cellulase by the soil fungus JM-F5-6;

[0030] Figure 9 is a morphological diagram of the soil fungus JM-F5-6 inoculated into saline-alkali medium;

[0031] Figure 10 is a morphological diagram of the antagonism between the soil fungus JM-F5-6 and Fusarium oxysporum f. sp. lycopersici strain;

[0032] Figure 11 is a growth diagram of tomato roots after being treated with the bacterial solution of the soil fungus JM-F5-6;

[0033] Figure 12 is a scanning diagram of tomato roots after being treated with the bacterial solution of the soil fungus JM-F5-6;

[0034] Figure 13 Data graph of the change in chlorophyll in the leaves of potted tomatoes after applying the soil Aspergillus JM-F5-6 bacterial solution;

[0035] Figure 14 Data graph of the change in nitrogen content in the leaves of potted tomatoes after applying the soil Aspergillus JM-F5-6 bacterial solution. Detailed implementation mode

[0036] The following further describes the present invention in combination with the detailed implementation mode. It should be noted that the following implementation mode is only an illustrative explanation of the present invention in the form of examples, but the protection scope of the present invention is not limited thereto. All equivalent replacements made by those skilled in the art in the spirit of the present invention fall within the protection scope of the present invention.

[0037] Example 1: Strain source and screening

[0038] 1. Strain source

[0039] The sample was collected from the soil in a certain greenhouse in Qingtianhu Village, Daotian Town, Shouguang City. During sampling, the five-point sampling method was used for operation, and the sample was mixed evenly and refined to obtain the original sample. After returning to the laboratory, part of the sample was stored at -80°C for the isolation and screening of strains.

[0040] 2. Strain isolation and purification

[0041] (1) Rose Bengal medium

[0042] Glucose 10g, peptone 5g, potassium dihydrogen phosphate 1.0g, magnesium sulfate (anhydrous) 0.5g, Rose Bengal (concentration 10g / L) 3.3ml, agar 15g / L, dissolved in 1000ml of distilled water. Before use, 0.1g / streptomycin 3.3ml was added to each liter of the medium.

[0043] (2) Fungal isolation and screening

[0044] Primary screening: Select the Rose Bengal medium. Take 1mL of the soil solution diluted to 10 -4 and coat it on the plate medium, with 3 replicates. The plate was placed in an incubator at 28°C for 3 - 5 days to observe the colony growth. And through microscopic observation, its conidial chains and hyphal structures were observed. Strains with typical Aspergillus terreus morphological characteristics were screened out, and the colony numbers were recorded for purification.

[0045] Re-screening: Pure cultures were obtained by the single-spore isolation method to ensure the purity of the strains. The purified strains were inoculated onto the Rose Bengal slant medium and stored at 4°C for later use.

[0046] (3) Purification culture of fungi

[0047] Purify and culture the colonies of suspected Aspergillus terreus obtained by screening to obtain pure Aspergillus terreus strains. To ensure the purity of the strains, multiple purification cultures may be required. After each purification, the strains should be identified by microscopy to confirm whether they are single Aspergillus terreus strains. Finally, a suspected Aspergillus terreus strain was selected and named Aspergillus terreus JM-F5-6.

[0048] Example 2: Strain Identification

[0049] 1. Morphological Identification

[0050] Aspergillus terreus can form characteristic colonies on suitable Rose Bengal medium. After identification as Figure 1 ... The surface of the colony appears velvet-like or granular, with irregular or feathery edges. Combining the observation of microscopic structures such as hyphae and spores under the microscope, the conidiophores are usually straight or slightly curved, and conidial heads are formed at the top. The conidial heads are radiate or spherical, which is an important morphological feature of Aspergillus terreus. The conidia of Aspergillus terreus are usually spherical or oval, with a smooth surface, and the color may be green, pink or reddish-brown. The hyphae of Aspergillus terreus are colorless or slightly colored, with thick walls and are septate. Under the microscope, the septation of the hyphae can be clearly seen, which is a common feature of fungi in the genus Aspergillus. The hyphae branch and build a reticular topology through lateral connections, which significantly increases the contact area with the medium and promotes the nutrient absorption efficiency.

[0051] 2. Strain Identification by ITS Method

[0052] (1) The sequences of the primers ITS rDNA used for PCR amplification are as follows (synthesized by TSINGKE, 5’→3’):

[0053] ITS1: CCGTAGGTGAACCTGCGG (SEQ ID No.1);

[0054] ITS4: TCCTCCGCTTATTGATATGC (SEQ ID No.2).

[0055] (2) Method for extracting genomic DNA from fungi using a kit: Since the outer layer of fungal cells has a relatively thick cell wall, the method of thermal lysis has poor effects, so generally a dedicated silica gel binding column method is used to extract the genome. In this experiment, the Solarbio Fungal Genomic DNA Extraction Kit (D2300) was used.

[0056] (3) PCR Reaction System (50ul)

[0057] Table 1: PCR Reaction System

[0058]

[0059] (4)PCR reaction conditions

[0060] 95°C, 5 min; (95°C, 15 s; 58°C, 30 s; 72°C, 10 s) 30 cycles; 72°C, 10 min; 4°C, ∞.

[0061] (5)Single strain sequencing analysis

[0062] The purified PCR product was subjected to base sequence determination (the product sequence is shown in SEQ ID No. 3). The forward and reverse sequences with good peak maps after successful sequencing were spliced to obtain the 16s rDNA sequence of the strain. After sequence alignment, it was confirmed that the Aspergillus terreus JM-F5-6 belongs to Aspergillus terreus.

[0063] The screened Aspergillus terreus JM-F5-6 strain was preserved. Preservation unit: China Center for Type Culture Collection; Address: Wuhan University, Wuhan, China; Preservation date: December 21, 2023; Aspergillus terreus The preservation number of JM-F5-6 is CCTCC NO: M 20232616.

[0064] Example 3: Identification of the proteolytic function of Aspergillus terreus JM-F5-6

[0065] 1. Preparation of protease identification medium:

[0066] A: 5 g of skim milk powder was dissolved in 500 ml of distilled water and autoclaved at 115°C for 10 min;

[0067] B: 15 g of agar powder was dissolved in 500 ml of distilled water and autoclaved at 121°C for 20 min.

[0068] The sterilized A and B were mixed and poured into plates for standby. After inoculation, it was cultured in an incubator at 30°C for 3 d to observe the presence of clear zones and record the sizes.

[0069] 2. Proteolytic characteristics

[0070] In a laminar flow hood, the Aspergillus terreus strain was inoculated into the protein medium to ensure that the operating area was in a sterile state. After inoculation, the plate was inverted and placed in a constant temperature incubator and cultured at 28°C, the suitable growth temperature of Aspergillus terreus, for 3 - 5 days. The colony growth and the formation of clear zones were observed daily.

[0071] As Figure 2As shown, Humicola insolens secretes protease during growth, gradually decomposing the protein in the culture medium to form a clear zone (observing the front and back views of the strain). The size and clarity of the clear zone are proportional to the enzyme activity. The higher the enzyme activity, the larger and clearer the clear zone.

[0072] 3. Protease production

[0073] Using commercially available Bacillus subtilis as the CK, the purified Humicola insolens JM-F5-6 and CK were respectively inoculated into Rose Bengal liquid medium, cultured with shaking at 28°C and 150 rpm for 3 - 5 days, the fermentation broth was collected and centrifuged (4000 rpm, 10 min), and the supernatant was taken for enzyme activity determination. The total protease was determined using a plant neutral phosphatase (NLP) enzyme-linked immunosorbent assay kit.

[0074] The results are shown as Figure 3 shown. The average enzyme content of Humicola insolens JM-F5-6 was 42.09 μg / L, significantly higher than that of the control group (13.81 μg / L), indicating that Humicola insolens JM-F5-6 has a strong ability to secrete protease.

[0075] Example 4: Identification of the phosphorus-solubilizing function of Humicola insolens JM-F5-6

[0076] 1. Identification of the ability of Humicola insolens to decompose inorganic phosphorus

[0077] Preparation of calcium phosphate medium: 10 g of glucose, 0.5 g of (NH4)2SO4, 0.3 g of NaCl, 0.3 g of KC1, 0.3 g of MgSO 4· 7H2O, 0.03 g of FeSO 4· 7H2O, 0.03 g of MnSO 4· 4H2O, 5.0 g of Ca3(PO4)2, 20 g of agar. 1000 ml of distilled water, pH 7.0, sterilized at 121°C for 20 min.

[0078] Inoculation: Perform aseptic operation in a laminar flow hood, and inoculate Humicola insolens onto the calcium phosphate plate medium. After inoculation, invert the plate and place it in an incubator at 28°C, the suitable growth temperature of Humicola insolens, and culture for 3 - 5 days. Observe the colony growth and the formation of the phosphorus-solubilizing zone every day.

[0079] Observation: As Figure 4 shown, when Humicola insolens is inoculated into a medium containing a poorly soluble phosphorus source (such as calcium phosphate), the hyphae rapidly expand and form a dense network structure. Obvious colony formation can be observed within 48 hours after inoculation, and a clear zone is formed around the colony. This indicates that the Humicola insolens enzyme has an activation effect on inorganic phosphorus.

[0080] 2. Identification of the ability of Aspergillus terreus to decompose organophosphorus

[0081] Preparation of phytate calcium medium: 10 g of glucose, 0.5 g of (NH4)2SO4, 0.3 g of NaCl, 0.3 g of KCl, MgSO 4· 7H2O 0.3 g, FeSO 4· 7H2O 0.03 g, MnSO4H2O 0.03 g, 5.0 g of phytate calcium, 15 g of agar, 1 L of distilled water, pH 7.0.

[0082] Inoculation: Perform aseptic operation in a laminar flow hood, and inoculate Aspergillus terreus into the phytate calcium plate medium. After inoculation, invert the plate and place it in a constant temperature incubator, and culture it at 28 °C suitable for the growth of Aspergillus terreus for 3 - 5 days. Observe the colony growth and the formation of phosphorus-dissolving circles every day.

[0083] Observation: As Figure 5 shown, when Aspergillus terreus is inoculated into the phytate calcium medium, obvious colony formation can be observed within 3 days after inoculation. Observe its front and back, and a transparent circle is formed around the colony, indicating that the strain has a strong ability to decompose organophosphorus.

[0084] 3. Determination of the ability of Aspergillus terreus to produce neutral phosphatase

[0085] Using commercially available Bacillus subtilis as CK, inoculate the purified Aspergillus terreus JM-F5-6 and CK into Rose Bengal liquid medium respectively, and culture them at 28 °C and 150 rpm for 3 - 5 days. Collect the fermentation broth and centrifuge (4000 rpm, 10 min), and take the supernatant for enzyme activity determination. The neutral phosphatase activity is determined by using a plant neutral phosphatase (NLP) enzyme-linked immunosorbent assay kit.

[0086] As Figure 6 shows the neutral phosphatase production of Aspergillus terreus strains and CK. The neutral phosphatase production of Aspergillus terreus strains is significantly higher than that of the control group. The neutral phosphatase production of Aspergillus terreus strains is 80.00 ng / L, while that of the control group is 38.41 ng / L, indicating that Aspergillus terreus strains have a strong ability to produce neutral phosphatase, can significantly increase the available phosphorus content in the culture solution and soil, and enhance the activation effect of phosphorus.

[0087] Example 5: Cellulose decomposition characteristics of Aspergillus terreus

[0088] 1. Identification of the ability of Aspergillus terreus to decompose cellulose

[0089] Preparation of cellulose medium: 10 g of peptone, 10 g of yeast powder, 10 g of sodium carboxymethyl cellulose, 5 g of sodium chloride, 1 g of potassium dihydrogen phosphate, 15 g of agar powder, dissolved in 1000 ml of distilled water, and autoclaved at 121 °C for 20 min.

[0090] In a laminar flow hood, inoculate the purified Aspergillus terreus JM-C14-2 into a cellulase medium and culture it at 28 °C for 3 - 5 days. Regularly observe and record the colony diameter, color, edge characteristics, and surface structure. If a clear hydrolysis zone forms around the colony, it indicates that the cellulase secreted by the strain has the ability to degrade the cellulose substrate.

[0091] As Figure 7 shown, Aspergillus terreus JM-F5-6 can reproduce rapidly in the cellulose medium, cover the medium in 2 days, make the cellulose medium transparent, and has strong cellulose decomposition ability.

[0092] 2. Characteristics of cellulase secreted by Aspergillus terreus

[0093] Using commercially available Bacillus subtilis as the CK, inoculate the purified Aspergillus terreus JM-F5-6 and CK into Rose Bengal liquid medium respectively, culture them at 28 °C and 150 rpm on a shaker for 3 - 5 days, collect the fermentation broth and centrifuge (4000 rpm, 10 min), and take the supernatant for enzyme activity determination. Use a plant cellulase (CE) enzyme-linked immunosorbent assay kit to measure the total amount of cellulase.

[0094] As Figure 8 shows the cellulase production of Aspergillus terreus JM-F5-6 and CK. The cellulase production of the control group is 26.95 ng / L, and the Aspergillus terreus strain can produce a cellulase production of 99.20 ng / L, which is significantly higher than that of CK. It shows that Aspergillus terreus JM-F5-6 has strong cellulase-producing ability and plays an important role in decomposing and transforming organic matter in the soil.

[0095] Example 6: Function of Aspergillus terreus in secreting organic acids

[0096] 1. Czapek liquid medium: 5 g peptone, 10 g glucose, 1.0 g potassium dihydrogen phosphate, 0.5 g magnesium sulfate (anhydrous), 3.3 ml Rose Bengal (concentration 10 g / L), dissolve in 11 ml distilled water, and add 0.1 g / streptomycin 3.3 ml to each liter of medium before use.

[0097] 2. Strain culture:

[0098] Dispense the above-prepared liquid medium into 250 mL conical flasks, 100 mL per flask, sterilize at 121 °C for 20 minutes, and cool to room temperature. Under sterile conditions, dip a small amount of Aspergillus terreus mycelium with an inoculation loop and inoculate it into the liquid medium. Place the inoculated conical flask in a constant temperature shaker, set the temperature to 28 °C, the rotation speed to 150 rpm, and culture for 3 - 5 days.

[0099] 3. Determination of oxalic acid production by the strain

[0100] After the cultivation was completed, 10 mL of the culture solution was taken, centrifuged (3000 rpm, 10 minutes) to remove the bacteria, 5 mL of the supernatant was taken and placed in a 100 mL conical flask, 10 mL of 1:1 sulfuric acid solution was added, and the conical flask was heated on an electric furnace to 70 - 80 °C to promote the reaction between oxalic acid and potassium permanganate. While it was hot, it was titrated with 0.02 mol / L potassium permanganate standard solution. Initially, it was added dropwise slowly. After the purple-red color faded, titration was continued until the solution turned slightly red and did not fade within 30 seconds, and the volume of potassium permanganate consumed (V1) was recorded. At the same time, a blank control was set up, using distilled water instead of the supernatant, and the above steps were repeated, and the volume of potassium permanganate consumed (V0) was recorded.

[0101] The calculation formula for the oxalic acid content is:

[0102]

[0103] Parameter description:

[0104] V1: Volume of potassium permanganate standard solution consumed in the titration of the sample (mL)

[0105] V0: Volume of potassium permanganate standard solution consumed in the blank test (mL)

[0106] C: Concentration of potassium permanganate standard solution (mol / L)

[0107] 90.03: Molar mass of oxalic acid (g / mol)

[0108] V: Volume of the sample (mL)

[0109] 4. Analysis of oxalic acid production and pH value

[0110] From the data in Table 2, it can be seen that there are significant differences in both the oxalic acid content and the pH value between Aspergillus terreus and the CK treatment group. The oxalic acid content of Aspergillus terreus is as high as 42.88 g / L, much higher than 6.05 g / L of the CK treatment group, indicating that this Aspergillus terreus has a strong oxalic acid synthesis ability. The pH value of the Aspergillus terreus strain treatment is 6.51, significantly lower than 7.05 of the CK treatment group, which is related to the synthesis and secretion of a large amount of oxalic acid by Aspergillus terreus. The oxalic acid secreted by Aspergillus terreus plays an important role in the dissolution of soil nutrients and the decomposition of organic matter.

[0111] Table 2: Oxalic acid production and pH value

[0112]

[0113] Example 7: Identification of the salt and alkali resistance function of Aspergillus terreus

[0114] 7.5% Sodium Chloride Medium: 3.0 g of beef extract, 5.0 g of peptone, 75.0 g of sodium chloride, 15.0 g of agar, 1000 mL of distilled water, pH 7.0, 1000 ml of distilled water, sterilized at 121 °C for 20 min.

[0115] Inoculation: Take the activated Aspergillus terreus strain and inoculate it onto the saline-alkali plate by the spot inoculation method. Incubate at 28 °C for 3 - 5 days and observe the colony growth status.

[0116] Observation: As Figure 9 shown, under saline-alkali conditions, observe the front and back morphologies of the Aspergillus terreus strain. It can still maintain relatively stable growth and morphological construction. The overall colony maintains a relatively regular circular contour, without obvious damage or growth inhibition, indicating that its cell structure and physiological functions can remain relatively complete and stable within a certain range of saline-alkali concentrations, and it has the ability to carry out material metabolism and reproduction under saline-alkali conditions. This shows that this Aspergillus terreus can be used for soil improvement in saline-alkali land.

[0117] Example 8: Identification of the resistance of Aspergillus terreus JM-F5-6 to soil-borne diseases

[0118] PDA Medium: 200 g of potatoes, 15 - 20 g of glucose, 15 - 20 g of agar powder, 1000 ml of distilled water.

[0119] Inoculation: In a laminar flow hood, aseptically operate to spot inoculate the pathogenic bacteria onto the PDA solid medium, and then use a pipette gun to inoculate 3 ml of a 10-fold dilution of the Aspergillus terreus supernatant. Set 3 replicates for each treatment. Under aseptic conditions, spot inoculate the Fusarium oxysporum f. sp. lycopersici strain as the treatment group, and also set 3 replicates. Incubate in an incubator at 28 °C for 3 - 5 days. Regularly observe and record the growth of the colonies in the two treatments.

[0120] As Figure 10 shown, compared with the control group (right), around the inoculation point of Aspergillus terreus JM-F5-6 and on the overall plate in the treatment group (left), it can be seen that the growth of the Aspergillus terreus colony is relatively vigorous, and it significantly inhibits the growth of Fusarium oxysporum f. sp. lycopersici ( Fusarium oxysporum f. sp. Lycopersici,FOL ), preventing it from spreading at the inoculation point, indicating that the substances secreted by Aspergillus terreus JM-F5-6 can prevent the spread and growth of pathogenic bacteria, and have a strong effect against soil-borne Fusarium oxysporum f. sp. lycopersici diseases.

[0121] Example 9: The effect of Aspergillus terreus on soil nutrient decomposition

[0122] Take 500 g of soil samples and evenly load them into 1L plastic cups, ensuring the same soil compactness. Randomly divide the plastic cups into an experimental group and a control group, with 5 replicates in each group. Add 30 mL of Aspergillus terreus bacterial liquid (OD 600= 0.3), then add 180 ml of sterile water. The control group was added with an equal amount of 210 ml of sterile water to make the soil reach the saturated water holding capacity and ensure that the soil was in a suitable humidity condition. A layer of film was covered on the plastic cup and sealed, and then placed in a constant temperature incubator and cultured for 30 days at 25 °C and 60%. During the culture period, the weight was measured regularly and sterile water was supplemented to maintain the constant soil humidity. After the culture ended, the soil indexes were measured by soil agrochemical analysis methods.

[0123] Table 3: Soil fertility of different treatments

[0124]

[0125] As can be observed from Table 3, compared with CK, when Aspergillus terreus was applied to the soil, the contents of hydrolyzable nitrogen, available phosphorus, available potassium, and organic matter in the soil could be significantly increased. There was no significant difference in pH between the Aspergillus terreus treatment and CK, indicating that Aspergillus terreus could significantly increase the contents of hydrolyzable nitrogen, available phosphorus, available potassium, and organic matter in the soil, promote the decomposition and transformation of nutrients, and had a positive effect on improving soil fertility.

[0126] Example 10: Effect of Aspergillus terreus on tomato growth

[0127] 1. Indoor sand culture experiment

[0128] Material preparation: The sand was washed with clear water several times and air-dried, and then filled into 500-ml plastic cups. Each cup was filled with 200 g of sand. Four-leaf tomato seedlings with consistent growth vigor were washed to remove all the matrix from their roots and then planted in the sand for the sand culture experiment. The nutrient solution used was Hoagland nutrient solution.

[0129] Inoculation treatment: First, 30 ml of nutrient solution was poured into each pot to fully moisten the sand. Then, 30 ml of the activated strain was taken in each group, diluted 10 times for standby, and 30 ml of the diluted bacterial solution was poured into each treatment. One of the groups was the control group, which was only poured with 30 ml of nutrient solution and 30 ml of sterile water. Each treatment had 5 replicates.

[0130] Growth index determination: After the tomato plants grew for 15 days, a plant nutrient rapid detector was used to measure the chlorophyll content and nitrogen content of the leaves. A root scanner was used to measure the root growth status.

[0131] 2. Effect of the strain on the growth of tomato seedlings

[0132] (1) Effect on tomato root growth

[0133] By setting a control (CK, without adding bacterial solution) and a treatment group (adding Aspergillus terreus suspension), the research was carried out from two perspectives: root morphology comparison and data analysis after scanning.

[0134] Root morphology comparative analysis, fromFigure 11 and Figure 12 It can be intuitively seen that there are obvious differences in the morphology of the roots of tomato plants treated with the soil Aspergillus liquid compared with the control (CK). The roots of the tomato plants in the treatment group are more developed, with longer main roots and relatively more lateral roots, showing a more vigorous growth trend; while the roots of the control group are relatively thin and weak, with fewer lateral roots. This morphological difference indicates that the soil Aspergillus plays a promoting role in the growth and development of tomato roots.

[0135] According to the analysis of the scanned root data, for multiple root indexes, the numerical values of the root indexes of the treatment group and the control group (CK) are shown in Table 4.

[0136] Table 4: Root indexes of tomato plants in the experimental group and the control group

[0137]

[0138] Combined with Table 4 and Figure 12 The data shows that there are significant differences in the root indexes of tomato plants in the experimental group with the addition of the soil Aspergillus liquid compared with the control group. The indexes such as the total root length, total root surface area, total root projected area, total root volume, root average diameter, and total root tip number in the soil Aspergillus treatment are all significantly higher than those of the control group CK. This indicates that the soil Aspergillus promotes the formation of a larger surface area of tomato roots, increases the contact area between the roots and the soil, further improves the acquisition efficiency of various resources in the soil by the plants, improves the morphological structure and function of the roots, and can have a positive impact on the growth and development of tomato plants.

[0139] (2) Effects on tomato leaf nutrients

[0140] The nutrient content of tomato seedling leaves was measured using a leaf nutrient rapid tester, as Figure 13 and Figure 14 shown.

[0141] From Figure 13 and Figure 14 it can be seen that, as Figure 13 , in terms of the chlorophyll SPAD value, the average value of the treatment group (soil Aspergillus) is 41.22, which is higher than 37.30 of the control, indicating that applying the bacterial liquid can increase the chlorophyll content of tomato leaves and enhance photosynthesis; according to Figure 14 the results show that in terms of nitrogen content, the average value of the treatment group is 2.83 mg / kg, which is greater than 2.56 mg / kg of the control, indicating that the soil Aspergillus can promote the absorption and accumulation of nitrogen elements by tomato leaves, and nitrogen elements are the components of important substances such as proteins and nucleic acids in plant growth and development, which helps the growth and development of leaves and promotes plant growth.

[0142] The above embodiments merely illustrate the technical solutions of the present invention and do not limit it; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements for some of the technical features; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions required to be protected by the present invention.

Claims

1. A strain of Aspergillus terreus JM-F5-6, characterized in that, Its classification name is Aspergillus terreus , deposited in the China Center for Type Culture Collection, with the deposit number of CCTCC NO: M20232616.

2. Use of Aspergillus terreus JM-F5-6 according to claim 1 in the preparation of a biological agent for promoting the growth of tomatoes.

3. The application according to claim 2, wherein The tomato growth described above includes an increase in tomato nutrients and tomato root growth.

4. Use of the soil fungus JM-F5-6 according to claim 1 for improving soil nutrients, characterized in that, Aspergillus terreus JM-F5-6 can produce protease, neutral phosphatase, and cellulase; Aspergillus terreus JM-F5-6 can secrete organic acids and can increase the contents of hydrolyzable nitrogen, available phosphorus, available potassium, and organic matter in the soil.

5. Use of Aspergillus terreus JM-F5-6 according to claim 1 in the preparation of a biological agent for inhibiting Fusarium oxysporum f. sp. lycopersici.

Citation Information

Patent Citations

  • Multifunctional broad-spectrum composite microbial agent and preparation and application thereof

    CN108690817A

  • Salt-resistant and alkali-resistant soil aspergillus strain as well as ITS sequence and application thereof

    CN108949584A