Construction method of gastric cancer transcriptional component type related tumor organoid model

Abstract

The embodiment of the invention relates to the technical field of organoid construction, and provides a construction method of a mouse tumor organoid model related to gastric cancer transcriptional component typing. According to the method, a mouse organ model capable of simulating three clinical different transcriptional component type gastric cancer patients is successfully constructed by editing specific genes. The models not only fill the blank of lack of mouse cell lines in gastric adenocarcinoma research, but also can simulate transcriptome characteristics of different types of gastric cancer patients to a certain extent, and provide a powerful tool for molecular mechanism research and clinical treatment of gastric cancer.

Description

Technical Field

[0001] The present application relates to the technical field of organoid construction, and specifically to a method for constructing a tumor organoid model related to gastric cancer transcriptome profiling. Background Art

[0002] Gastric cancer, as a global health challenge, is known for its high morbidity and mortality. Currently, the diagnosis and treatment of gastric cancer mainly rely on traditional histological analysis and molecular biological testing. These methods help clinical decision-making to a certain extent, but they are still insufficient in predicting patient prognosis and guiding individualized treatment. With the breakthrough progress of transcriptomics technology, studies have revealed the close connection between the transcriptome characteristics and clinical phenotypes of gastric cancer patients. In addition, the heterogeneity of gastric cancer has been widely recognized, and typing based on transcriptome characteristics provides a new perspective for disease management. However, there is currently a lack of gastric cancer research models that can accurately simulate these different molecular subtypes, which poses a major challenge in clinical practice. Summary of the invention

[0003] The present application embodiment provides a method for constructing a tumor organoid model related to gastric cancer transcriptome typing, which can successfully construct a mouse organoid model that can simulate three different transcriptome typing gastric cancer patients in the clinic by editing specific genes. These models not only fill the gap of the lack of mouse cell lines in gastric adenocarcinoma research, but also can simulate the transcriptome characteristics of gastric cancer patients of different typing to a certain extent, providing a powerful tool for the molecular mechanism research and clinical treatment of gastric cancer.

[0004] A first aspect of an embodiment of the present application provides a method for constructing a tumor organoid model related to gastric cancer transcriptome profiling, the method comprising:

[0005] Dissect and isolate genotypes for Trp53 fl / fl ,Kras LSL-G12D / + and Rosa26-CAG LSL-Cas9-tdTomato / + (TK-tdCas9) mouse stomach tissue;

[0006] Gastric organoids were obtained by culturing mouse gastric tissue;

[0007] In vitro, a preset recombinase was used to induce gene recombination in the gastric organoid to obtain a genotype of Trp53 fl / fl ,Kras G12D / + gastric organoids, expressing the Cas9 enzyme and tdTomato molecules, and overexpressing the Myc gene;

[0008] The genotype was Trp53 fl / fl , Kras G12D / +The gastric organoids with overexpression of Myc gene were cultured in a preset conditioned medium to obtain a cultured gastric organoid with Trp53 fl / fl , Kras G12D / + , gastric organoids with overexpression of Myc gene;

[0009] The lentiviral vector V2G is infected into 293T cells to construct a lentiviral supernatant, wherein the lentiviral vector V2G expresses sgRNA and green fluorescent protein;

[0010] The genotype after culture was Trp53 fl / fl , Kras G12D / + After dissociation, the gastric organoids overexpressing the Myc gene were resuspended with the supernatant of lentivirus expressing two different sgRNAs, incubated in an incubator at 37°C for 2 hours, and then planted in Matrigel to obtain two gastric organoids infected with lentivirus expressing sgRNA and green fluorescent protein.

[0011] In this example, three types of gastric organoids were constructed, representing three different transcriptome types of gastric cancer patients in the clinic. These models not only fill the gap of lack of mouse cell lines in gastric adenocarcinoma research, but also can simulate the transcriptome characteristics of gastric cancer patients of different types to a certain extent, providing a powerful tool for the molecular mechanism research and clinical treatment of gastric cancer.

[0012] In a specific implementation, the step of culturing mouse gastric tissue to obtain gastric organoids comprises:

[0013] Genotype Trp53 fl / fl ,Kras LSL-G12D / + and Rosa26-CAG LSL -Cas9 -tdTomato / + (TK-tdCas9) mouse stomach tissue was minced to a diameter of less than 1 mm;

[0014] Washed three times with DPBS (Gibco, #C14190500BT), and digested with Trypsin-EDTA (Gibco, #C25200-056) at 37°C for 10 min;

[0015] The extracted fresh cell pellet was filtered through a 100 mm cell sieve (Biofil, #CSS013100) and collected by centrifugation;

[0016] The cells collected by centrifugation were resuspended in Matrigel (Corning, #356234) and seeded in a 24-well plate to obtain gastric organoids.

[0017] In a specific implementation, the preset recombinase includes Cre recombinase.

[0018] In a specific implementation, the preset conditioned medium includes the following components: advanced DMEM / F12 (Gibco, #12634-010), containing 1% penicillin-streptomycin (Gibco, #15140-122), 1x B27 (Gibco, #17504-044), 1x N2 (Gibco, #17502-048), 10mM nicotinamide (Sigma, #N3376), 10mM HEPES (ThermoFisher, #15630080), 1x Glutamax (Thermo Fisher, #35050061), 1.25mM acetylcysteine ​​(Sigma, #A7250), 500nM A83-01 (Sigma, #SML0788), 200ng / ml FGF10 (Peprotech, #AF100-26), 50ng / ml EGF (Peprotech, #315-09), 10 nM Gastrin (R&D, #3006), 10 uM Y-27632 (R&D, #1254), 1x Primocin (InvivoGen, #ant-pm-05) and 50% Wnt-3A / R-Spondin / Noggin.

[0019] In a specific implementation, the genotype is Trp53 fl / fl , Kras G12D / + The gastric organoids with overexpression of Myc gene were cultured in the preset conditioned medium, and the genotype after culture was Trp53 fl / fl , Kras G12D / + , Myc-overexpressing gastric organoids, including:

[0020] The genotype was Trp53 fl / fl , Kras G12D / + The gastric organoids with overexpression of Myc gene were cultured in the preset conditioned medium. fl / fl , Kras G12D / + The gastric organoids were washed with ice-cold DPBS and then digested with TrypLE (Gibco, #12605028) at 37°C for 8-13 min;

[0021] After incubation, add advanced DMEM / F12 to neutralize TrypLE activity and centrifuge at 400xg for 5 minutes. fl / fl , Kras G12D / +The gastric organoids with Myc overexpression were resuspended in Matrigel and seeded into new 24-well plates. The genotype after culture was Trp53 fl / fl , Kras G12D / + , gastric organoids with overexpression of Myc gene.

[0022] In a specific implementation, the lentiviral vector V2G is infected into 293T cells to construct a lentiviral supernatant, comprising:

[0023] The lentiviral vector V2G plasmid was transfected into 293T cells together with the auxiliary plasmids psPAX2 (Addgene, #12260) and pMD2.G (Addgene, #12259) by PEI MAX (Polysciences, #24765), and the lentiviral supernatant was constructed to obtain the lentiviral supernatant;

[0024] Lentiviral supernatants were recovered 36 and 48 hours after transfection.

[0025] In a specific implementation, the sequence of the sgRNA includes Pten and Smad4;

[0026] Pten: GGATCGTTAGCAGAAACAAA;

[0027] Smad4:GCCAAGTAATCGCGCATCAA.

[0028] In a specific implementation, after obtaining two gastric organoids infected with lentivirus expressing sgRNA and green fluorescent protein, the method further comprises:

[0029] Three days later, the two gastric organoids infected with lentivirus expressing sgRNA and green fluorescent protein were digested into single cells by TrypLE, and the green fluorescent protein was detected by flow cytometry and T7EI (Vazyme, #EN303-01) mismatch detection test was used to verify whether the above genes were successfully edited, and the verification results were obtained.

[0030] In a specific implementation, the two gastric organoids infected with lentivirus expressing sgRNA and green fluorescent protein include a TKMP subtype obtained by editing Pten and a TKMS subtype edited by Smad4. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0032] Figure 1 The present invention provides a schematic diagram of three transcriptome profiles of gastric cancer patients, wherein Figure 1 A shows the three gastric cancer transcriptome subtypes based on TCGA-STAD and Hallmarks, and determines the high and low levels of the PI3K pathway and TGFβ pathway in the three subtypes ( Figure 1 BD), which provided a basis for the subsequent construction of three subtypes of mouse gastric organoids by editing different genes, and verified the above three subtypes from the perspective of single-cell transcriptome sequencing data ( Figure 1 EF);

[0033] Figure 2 The embodiments of the present application provide Figure 1 A schematic diagram for supplementary explanation, wherein Figure 2 AD shows the typing situation based on ACRG and Hallmarks, verifying Figure 1 The results in this study indicate the importance of the PI3K pathway and the TGFβ pathway in patients with different subtypes of gastric cancer. Figure 2 EF is for Figure 1 The single-cell sequencing data shown are supplemented;

[0034] Figure 3 The present invention provides three methods for constructing mouse gastric organoid models and schematic diagrams of the construction results, wherein Figure 3 A briefly shows three methods for constructing mouse gastric organoids. Figure 3 B shows that all three organoid models can form tumors in nude mice. Figure 3 CH showed the multi-level differences among the three mouse gastric organoid models, and the results based on the PCA algorithm showed ( Figure 3 D) The three can correspond to the three transcriptomic subtypes of gastric cancer patients mentioned above in TCGA-STAD;

[0035] Figure 4 The embodiments of the present application provide Figure 3 A schematic diagram for supplementary explanation, wherein Figure 4 A shows that gastric cancer patients have co-activation of the three pathways of P53, KRAS, and MYC, providing a basis for constructing mouse gastric organoids with specific genotype modifications. Figure 4B and D show that Pten and Smad4 were successfully edited when constructing TKMP and TKMS subtype mouse gastric organoids. Figure 4 Figure C verifies from the perspective of ACRG data that the three types of mouse gastric organoids can represent patients with three different subtypes of gastric cancer to a certain extent, while Figures EF supplement the characteristics of the three types of mouse gastric organoids after tumor formation in vivo. DETAILED DESCRIPTION

[0036] The following will be combined with the drawings in the embodiments of the present application to clearly and completely describe the technical solutions in the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, not all of the embodiments. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of this application.

[0037] The terms "first", "second", etc. in the specification and claims of this application and the above-mentioned drawings are used to distinguish different objects, rather than to describe a specific order. In addition, the terms "including" and "having" and any variations thereof are intended to cover non-exclusive inclusions. For example, a process, method, system, product or device that includes a series of steps or units is not limited to the listed steps or units, but optionally includes steps or units that are not listed, or optionally includes other steps or units inherent to these processes, methods, products or devices.

[0038] Reference to "embodiments" in this application means that a particular feature, structure, or characteristic described in conjunction with the embodiments may be included in at least one embodiment of the present application. The appearance of the phrase in various locations in the specification does not necessarily refer to the same embodiment, nor is it an independent or alternative embodiment that is mutually exclusive with other embodiments. It is explicitly and implicitly understood by those skilled in the art that the embodiments described in this application may be combined with other embodiments.

[0039] In order to better understand the method for constructing a tumor organoid model related to gastric cancer transcriptome typing provided in the embodiments of the present application, the existing gastric cancer research models are first briefly introduced. Existing gastric cancer research models, including two-dimensional cell culture, animal models, and patient-derived xenograft models (PDX), have shown their inherent limitations in simulating the microenvironment, genetic heterogeneity, and transcriptome characteristics of tumors. Although the two-dimensional cell culture technology is easy to operate, it cannot reproduce the three-dimensional structure and complex microenvironment of the tumor. Animal models, especially gene-edited mouse in situ tumor models, can provide certain biological information, but are limited by cost, cycle, and the feasibility of high-throughput drug screening. Although the PDX model can retain the original characteristics of the tumor to a certain extent, it is limited by the high heterogeneity of the patient's tumor and the low repeatability of the model.

[0040] As a revolutionary three-dimensional cell culture technology, organoid models can culture miniature structures with organ characteristics from adult or tumor tissues. These models have attracted much attention for their potential in simulating the biological characteristics of tumors. They can not only simulate the tumor microenvironment more realistically, but also maintain the genetic and phenotypic characteristics of tumor cells, providing a new perspective for oncology research. Organoid models have demonstrated their value in gastric cancer research, including the exploration of the mechanisms of tumor occurrence and development, as well as their application in drug screening and the development of personalized treatment strategies. However, existing models still need further optimization and improvement in simulating different gastric cancer transcriptome phenotypes.

[0041] In response to the above technical problems, the present application provides a method for constructing a tumor organoid model related to gastric cancer transcriptome typing, which can construct three gastric organoids, which respectively represent three different transcriptome typings of gastric cancer patients in the clinic. These models not only fill the gap of lack of mouse cell lines in gastric adenocarcinoma research, but also can simulate the transcriptome characteristics of gastric cancer patients of different typings to a certain extent, providing a powerful tool for the molecular mechanism research and clinical treatment of gastric cancer.

[0042] The present application embodiment provides a method for constructing a tumor organoid model related to gastric cancer transcriptome profiling. The method comprises:

[0043] S10. Dissect and isolate genotyped Trp53 fl / fl ,Kras LSL-G12D / + and Rosa26-CAG LSL-Cas9-tdTomato / + (TK-tdCas9) in mouse stomach tissue.

[0044] Among them, the mouse stomach tissue can be obtained by using a common anatomical separation method.

[0045] S20. After culturing mouse gastric tissue, gastric organoids were obtained.

[0046] The specific cultivation and treatment method may include the following steps:

[0047] S201, genotype is Trp53 fl / fl ,Kras LSL-G12D / + and Rosa26-CAG LSL-Cas9-tdTomato / + (TK-tdCas9) mouse stomach tissue was minced to a diameter of less than 1 mm;

[0048] S202, washed three times with DPBS (Gibco, #C14190500BT), and digested with Trypsin-EDTA (Gibco, #C25200-056) at 37°C for 10 min;

[0049] S203, filtering the extracted fresh cell mass through a 100 mm cell sieve (Biofil, #CSS013100) and collecting by centrifugation;

[0050] S204. Resuspend the cells collected by centrifugation in Matrigel (Corning, #356234) and inoculate them in a 24-well plate to obtain gastric organoids.

[0051] S30, in vitro using a preset recombinase to induce gene recombination of the gastric organoid to obtain a genotype of Trp53 fl / fl ,Kras G12D / + gastric organoids, expressing the Cas9 enzyme and tdTomato molecules, and overexpressing the Myc gene.

[0052] Among them, the preset recombinase includes Cre recombinase.

[0053] S40, the genotype is Trp53 fl / fl , Kras G12D / + The gastric organoids with overexpression of Myc gene were cultured in the preset conditioned medium, and the genotype after culture was Trp53 fl / fl , Kras G12D / + , gastric organoids with overexpression of Myc gene.

[0054] The preset conditioned medium includes the following ingredients: advanced DMEM / F12 (Gibco, #12634-010), containing 1% penicillin-streptomycin (Gibco, #15140-122), 1x B27 (Gibco, #17504-044), 1x N2 (Gibco, #17502-048), 10mM nicotinamide (Sigma, #N3376), 10mM HEPES (Thermo Fisher, #15630080), 1xGlutamax (Thermo Fisher, #35050061), 1.25mM acetylcysteine ​​(Sigma, #A7250), 500nM A83-01 (Sigma, #SML0788), 200ng / ml FGF10 (Peprotech, #AF100-26), 50ng / ml EGF (Peprotech, #315-09), 10 nM Gastrin (R&D, #3006), 10 uM Y-27632 (R&D, #1254), 1x Primocin (InvivoGen, #ant-pm-05) and 50% Wnt-3A / R-Spondin / Noggin.

[0055] The specific cultivation method may include the following steps:

[0056] S401, the genotype is Trp53 fl / fl , Kras G12D / + The gastric organoids with overexpression of Myc gene were cultured in the preset conditioned medium. fl / fl , Kras G12D / + , Myc-overexpressing gastric organoids were washed with ice-cold DPBS and then digested with TrypLE (Gibco, #12605028) at 37°C for 8–13 min;

[0057] S402, after incubation, add advanced DMEM / F12 to neutralize TrypLE activity and centrifuge at 400xg for 5 minutes. fl / fl , Kras G12D / + The gastric organoids with Myc overexpression were resuspended in Matrigel and seeded into new 24-well plates. The genotype after culture was Trp53 fl / fl , Kras G12D / + , gastric organoids with overexpression of Myc gene.

[0058] The ones that can be successfully cultivated here include the genotype Trp53 fl / fl ,Kras G12D / + , Myc gene overexpression (TKM) gastric organoids. In the subsequent steps, the TKMP isoforms obtained by editing Pten and the TKMS isoforms edited by Smad4 were cultivated.

[0059] S50, infecting 293T cells with the lentiviral vector V2G, and constructing a lentiviral supernatant, wherein the lentiviral vector V2G expresses sgRNA and green fluorescent protein.

[0060] In order to better simulate gastric cancer with different transcriptomic subtypes, the transcriptomic data of the TCGA-STAD and ACRG cohorts were classified, and it was found that the gastric cancer transcriptome can be divided into three subtypes based on Hallmarks, among which the three subtypes can be distinguished based on the activation of the PI3K and TGF-β pathways, and this classification can be verified in the single-cell transcriptome. Based on this, we edited the Pten and Smad4 genes on the basis of the above-mentioned genotype gastric organoids, and obtained gastric organoids that can simulate the above three subtypes respectively. The specific genome editing includes steps S50 and S60.

[0061] Among them, the sequence of sgRNA includes Pten and Smad4; Pten: GGATCGTTAGCAGAAACAAA; Smad4: GCCAAGTAATCGCGCATCAA.

[0062] The method for constructing and obtaining a lentiviral supernatant may specifically include the following steps:

[0063] S501, transfecting the lentiviral vector V2G plasmid together with auxiliary plasmids psPAX2 (Addgene, #12260) and pMD2.G (Addgene, #12259) into 293T cells by PEI MAX (Polysciences, #24765), and constructing lentiviral supernatant to obtain lentiviral supernatant;

[0064] S502, lentiviral supernatant was recovered 36 hours and 48 hours after transfection.

[0065] S60, the genotype after culture is Trp53 fl / fl , Kras G12D / + After dissociation, the gastric organoids overexpressing the Myc gene were resuspended with the supernatant of lentivirus expressing two different sgRNAs, incubated in an incubator at 37°C for 2 hours, and then planted in Matrigel to obtain two gastric organoids infected with lentivirus expressing sgRNA and green fluorescent protein.

[0066] The final gastric organoids included Trp53 fl / fl ,Kras G12D / + , gastric organoids with Myc overexpression (TKM isoform), TKMP isoform obtained after editing Pten, and TKMS isoform edited Smad4.

[0067] Three days after obtaining the final gastric organoids, the final TKMP subtype and TKMS subtype gastric organoids were digested into single cells by TrypLE, and the green fluorescent protein was detected by flow cytometry and the T7EI (Vazyme, #EN303-01) mismatch detection test was used to verify whether the above genes were successfully edited to obtain verification results.

[0068] The organoid models in the embodiments of the present application are able to simulate the three main transcriptome types of gastric cancer at the molecular level, providing an accurate in vitro research platform for the heterogeneity of clinical gastric cancer; and by providing these accurate in vitro models, the present invention fills the gap in the field of gastric adenocarcinoma research in terms of animal in vitro models, providing an important tool for future research and drug development.

[0069] The embodiments of the present application are introduced in detail above. Specific examples are used in this article to illustrate the principles and implementation methods of the present application. The description of the above embodiments is only used to help understand the method and core idea of ​​the present application. At the same time, for general technical personnel in this field, according to the idea of ​​the present application, there will be changes in the specific implementation method and application scope. In summary, the content of this specification should not be understood as a limitation on the present application.

Claims

1. A method for constructing a tumor organoid model related to gastric cancer transcriptome profiling, characterized in that: The method comprises: Dissect and isolate genotypes for Trp53 fl / fl ,Kras LSL-G12D / + and Rosa26-CAG LSL -Cas9 -tdTomato / + (TK-tdCas9) mouse stomach tissue; Gastric organoids were obtained by culturing mouse gastric tissue; In vitro, a preset recombinase was used to induce gene recombination in the gastric organoid to obtain a genotype of Trp53 fl / fl ,Kras G12D / + gastric organoids, expressing the Cas9 enzyme and tdTomato molecules, and overexpressing the Myc gene; The genotype was Trp53 fl / fl , Kras G12D / + The gastric organoids with overexpression of Myc gene were cultured in a preset conditioned medium to obtain a cultured gastric organoid with Trp53 fl / fl , Kras G12D / + , gastric organoids with overexpression of Myc gene; The lentiviral vector V2G is infected into 293T cells to construct a lentiviral supernatant, wherein the lentiviral vector V2G expresses sgRNA and green fluorescent protein; The genotype after culture was Trp53 fl / fl , Kras G12D / + After dissociation, the gastric organoids overexpressing the Myc gene were resuspended with the supernatant of lentivirus expressing two different sgRNAs, incubated in an incubator at 37°C for 2 hours, and then planted in Matrigel to obtain two gastric organoids infected with lentivirus expressing sgRNA and green fluorescent protein.

2. The method for constructing a tumor organoid model related to gastric cancer transcriptome profiling according to claim 1, characterized in that: The method of culturing the mouse gastric tissue to obtain a gastric organoid comprises: Genotype Trp53 fl / fl ,Kras LSL-G12D / + and Rosa26-CAG LSL -Cas9 -tdTomato / + (TK-tdCas9) mouse stomach tissue was minced to a diameter of less than 1 mm; Washed three times with DPBS (Gibco, #C14190500BT), and digested with Trypsin-EDTA (Gibco, #C25200-056) at 37°C for 10 min; The extracted fresh cell pellet was filtered through a 100-mm cell sieve (Biofil, #CSS013100) and collected by centrifugation; The cells collected by centrifugation were resuspended in Matrigel (Corning, #356234) and seeded in a 24-well plate to obtain gastric organoids.

3. The method for constructing a tumor organoid model related to gastric cancer transcriptome profiling according to claim 2, characterized in that: The preset recombinase includes Cre recombinase.

4. The method for constructing a tumor organoid model related to gastric cancer transcriptome profiling according to any one of claims 1 to 3, characterized in that: The preset conditioned medium includes the following components: advanced DMEM / F12 (Gibco, #12634-010), containing 1% penicillin-streptomycin (Gibco, #15140-122), 1xB27 (Gibco, #17504-044), 1x N2 (Gibco, #17502-048), 10mM nicotinamide (Sigma, #N3376), 10mM HEPES (Thermo Fisher, #15630080), 1xGlutamax (Thermo Fisher, #35050061), 1.25mM acetylcysteine ​​(Sigma, #A7250), 500nM A83-01 (Sigma, #SML0788), 200ng / ml FGF10 (Peprotech, #AF100-26), 50ng / ml EGF (Peprotech, #315-09), 10 nM Gastrin (R&D, #3006), 10 uM Y-27632 (R&D, #1254), 1x Primocin (InvivoGen, #ant-pm-05) and 50% Wnt-3A / R-Spondin / Noggin.

5. The method for constructing a tumor organoid model related to gastric cancer transcriptome profiling according to claim 4, characterized in that: The genotype is Trp53 fl / fl , Kras G12D / + The gastric organoids with overexpression of Myc gene were cultured in a preset conditioned medium to obtain a cultured gastric organoid with Trp53 fl / fl , Kras G12D / + , Myc-overexpressing gastric organoids, including: The genotype was Trp53 fl / fl , Kras G12D / + The gastric organoids with overexpression of Myc gene were cultured in the preset conditioned medium. fl / fl , Kras G12D / + , Myc-overexpressing gastric organoids were washed with ice-cold DPBS and then digested with TrypLE (Gibco, #12605028) at 37°C for 8–13 min; After incubation, add advanced DMEM / F12 to neutralize TrypLE activity and centrifuge at 400xg for 5 minutes. fl / fl , Kras G12D / + The gastric organoids with Myc overexpression were resuspended in Matrigel and seeded into new 24-well plates. The genotype after culture was Trp53 fl / fl , Kras G12D / + , gastric organoids with overexpression of Myc gene.

6. The method for constructing a tumor organoid model related to gastric cancer transcriptome profiling according to claim 5, characterized in that: The method of infecting the lentiviral vector V2G into 293T cells and constructing a lentiviral supernatant comprises: The lentiviral vector V2G plasmid was transfected into 293T cells together with the auxiliary plasmids psPAX2 (Addgene, #12260) and pMD2.G (Addgene, #12259) by PEI MAX (Polysciences, #24765), and the lentiviral supernatant was constructed to obtain the lentiviral supernatant; Lentiviral supernatants were recovered 36 and 48 hours after transfection.

7. The method for constructing a tumor organoid model related to gastric cancer transcriptome profiling according to claim 6, characterized in that: The sequences of sgRNA include Pten and Smad4; Pten: GGATCGTTAGCAGAAACAAA; Smad4:GCCAAGTAATCGCGCATCAA.

8. The method for constructing a tumor organoid model related to gastric cancer transcriptome profiling according to claim 6 or 7, characterized in that: After obtaining two gastric organoids infected with lentivirus expressing sgRNA and green fluorescent protein, the method further comprises: Three days later, the two gastric organoids infected with lentivirus expressing sgRNA and green fluorescent protein were digested into single cells by TrypLE, and the green fluorescent protein was detected by flow cytometry and T7EI (Vazyme, #EN303-01) mismatch detection test was used to verify whether the above genes were successfully edited, and the verification results were obtained.

9. The method for constructing a tumor organoid model related to gastric cancer transcriptome profiling according to claim 8, characterized in that: The two gastric organoids infected with lentivirus expressing sgRNA and green fluorescent protein include the TKMP subtype obtained by editing Pten and the TKMS subtype edited Smad4.

Images