Enzyme composition, product and application of enzyme composition in preparation of Ectoine

Abstract

The invention relates to the field of bioengineering, in particular to an enzyme composition, a product and application of the enzyme composition in preparation of Ectoine. The invention provides an enzyme composition. The enzyme composition comprises a mutant of 2-hydroxy-4-aminobutyric acid oxidase, a mutant of keto transaminase, a mutant of hydroperoxide hydrolase, a mutant of Ectoine synthetase, a mutant of pyruvic acid-CoA oxidase and lactobacillus helveticus lactic dehydrogenase. According to the method disclosed by the invention, a plurality of mutant enzymes are utilized for combined transformation for the first time, and cheap 2-hydroxy-4-aminobutyric acid is taken as a starting raw material to quickly and efficiently produce Ectoine; the enzyme method has the characteristics of easiness in control, short conversion time, few generated impurities and the like, so that the method has unique advantages in the aspects of low-cost and large-scale mass production of Ectoin.

Description

Technical field

[0001] The present invention relates to the field of bioengineering, and in particular to enzyme compositions, products and their applications in the preparation of Ikedoin. Background technology

[0002] Ectoine (also known as tetrahydropyrimidine) is a cellular all-purpose protective agent and a multifunctional active molecule that exhibits excellent performance in anti-compression protection, preventing cell aging, and repairing regeneration aged or damaged cells. In terms of cosmetics applications, IKO has radiation-proof, moisturizing and whitening effects; its long-term moisturizing properties reach 7 days, antioxidant prevents aging, and protects cells from ultraviolet damage; IKOO can also protect cells as a whole through the characteristics of osmotic pressure compensation, balancing the protection of cells under adversity such as high temperature, freezing or drying. Based on the above characteristics, Ikedoin has shown broad commercial application prospects in many fields such as bioprotection, biomedicine and biotechnology.

[0003] The preparation method of ektoin (tetrahydropyrimidine) on the market is mainly concentrated in strain fermentation. For example, the prior art has modified Escherichia coli. E.coli BW-pBAD ektoin synthesizes the gene ectABC, and then uses sodium L-aspartate as raw material to convert E. coli to ektoin high yield. Some people have prepared ektoin fermentation strains by modifying Corynebacterium glutamate by removing the feedback inhibitor gene lysC, resetting the synthase promoter and inserting the gene into ectABC. Some people have announced a strain with ektoin secretion characteristics isolated from the coastal mud along Rizhao. Later, after mutation screening and stabilizing genetic characteristics, the Bacillus ektoin's ektoin's (Bacillus ektoin) was transformed into (Bacillus ektoin) Halobacillus sp.FL2423 ). The preparation method of the prior art is complex, the conversion time is long, and it is not easy to produce on a large scale. Contents of invention

[0004] In view of this, the present invention provides enzyme compositions, products and their applications in the preparation of Ikedoin. The present invention uses a combination of multiple mutant enzymes for the first time, and uses cheap 2-hydroxy-4-aminobutyric acid as the starting material to produce Ikedoin quickly and efficiently; since the enzyme method has specific characteristics such as easy control, short conversion time and few impurities generated, this method has unique advantages in inexpensive mass production of Ikedoin.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The invention provides enzyme compositions including: mutants of 2-hydroxy-4-aminobutyrate oxidase, mutants of keto aminotransferase, mutants of hydrogen peroxide hydrolase, mutants of ektoin synthase, mutants of pyruvate-CoA oxidase and Lactobacillus Swiss lactate dehydrogenase;

[0007] Mutation sites of the mutant of the 2-hydroxy-4-aminobutyrate oxidase include: T34N, S70I, T101Q, I102A, M103W, D260N, and R290K;

[0008] Mutation sites of the mutant of the keto aminotransferase include: Q123G, H144T, W232N, P233D, K369V and S390H;

[0009] Mutation sites of the mutant of the hydrogen peroxide hydrolase include: R7H, F61M, V184S, L205D, and F287I;

[0010] The mutation sites of the mutant of the ektoin synthase include: V23Q, C73S, Y90L, R215E, N223D, E266T and Y326V;

[0011] Mutation sites of the pyruvate-CoA oxidase mutant include: Y66L, C89S, D180A, K183M, H186V, H196E, Q276N, M395I, N466H, V494Y, D568T and K575G.

[0012] In some embodiments of the invention, in the above-mentioned enzyme composition, the 2-hydroxy-4-aminobutyrate oxidase is derived from kiwi fruit (Actinidia chinensis var. chinensis);

[0013] The keto aminotransferase is derived from Burkholderia cenocepacia;

[0014] The hydrogen peroxide hydrolase is derived from the archaeophenia (Pyrobaculum calidifontis);

[0015] The ektogen synthase is derived from Halomonas elongata;

[0016] The pyruvate-CoA oxidase is derived from Guillardia theta;

[0017] The Lactobacillus lacticate dehydrogenase is derived from Lactobacillus helveticus.

[0018] In some embodiments of the invention, in the above-mentioned enzyme composition, the amino acid sequence of the mutant of the 2-hydroxy-4-aminobutyrate oxidase is shown in SEQ ID NO: 1;

[0019] The amino acid sequence of the mutant of the keto aminotransferase is shown in SEQ ID NO:2;

[0020] The amino acid sequence of the mutant of the hydrogen peroxide hydrolase is shown in SEQ ID NO:3;

[0021] The amino acid sequence of the mutant of the ektoin synthase is shown in SEQ ID NO:4;

[0022] The amino acid sequence of the pyruvate-CoA oxidase mutant is shown in SEQ ID NO:5;

[0023] The amino acid sequence of the Lactobacillus Swiss lactate dehydrogenase is shown in SEQ ID NO:6.

[0024] The present invention also provides immobilized enzymes, including the above-mentioned enzyme composition.

[0025] The present invention also provides nucleic acid molecules encoding the enzyme composition and / or the immobilized enzyme.

[0026] In some embodiments of the invention, the nucleotide sequence of the nucleic acid molecule encoding the mutant of the 2-hydroxy-4-aminobutyrate oxidase in the above-mentioned nucleic acid molecule is as shown in SEQ ID NO:7;

[0027] The nucleotide sequence of the nucleic acid molecule encoding the mutant of the ketotransaminase is shown in SEQ ID NO:8;

[0028] The nucleotide sequence of the nucleic acid molecule encoding the mutant of the hydrogen peroxide hydrolase is shown in SEQ ID NO:9;

[0029] The nucleotide sequence of the nucleic acid molecule encoding the mutant of the ektoin synthetase is shown in SEQ ID NO:10;

[0030] The nucleotide sequence of the nucleic acid molecule encoding the pyruvate-CoA oxidase mutant is shown in SEQ ID NO: 11;

[0031] The nucleotide sequence encoding the nucleic acid molecule of Lactobacillus Swiss lactate dehydrogenase is shown in SEQ ID NO: 12.

[0032] The present invention also provides biological materials, including at least one of the following (1) to (3):

[0033] (1) Recombinant vector containing the above-mentioned nucleic acid molecules;

[0034] (2) Transform or transfection of host cells of recombinant vectors as described in (1);

[0035] (3) Cultivate the mixture obtained by culturing the host cells as described in (2).

[0036] The present invention also provides the use of the above-mentioned enzyme composition, the above-mentioned immobilized enzyme, the above-mentioned nucleic acid molecule and / or the above-mentioned biological material in the preparation of Ikedoin.

[0037] The present invention also provides products including: the enzyme composition, the immobilized enzyme, the nucleic acid molecule and / or the biological material, as well as acceptable additives, auxiliary materials and / or carriers.

[0038] In some embodiments of the invention, the above-mentioned products include one or more of skin care products, sun protection products, hair care products, toiletries and makeup products.

[0039] The present invention also provides a preparation method of ictoin, using 2-hydroxy-4-aminobutyric acid, pyruvate and β-alanine as raw materials, and ictoin is produced by any of the following conversion;

[0040] (4) The above-mentioned enzyme composition;

[0041] (5) The above immobilized enzyme;

[0042] (6), the above-mentioned nucleic acid molecule; or

[0043] (7) The above biological materials;

[0044] (8) The above products.

[0045] In some embodiments of the present invention, the above-mentioned preparation method includes the steps of: using the raw material 2-hydroxy-4-amino butanoic acid (2-hydroxy-4-amino butanoic acid), and generating 2-carbonyl-4-amino butanoic acid (L-DaB) under the action of α-hydroxy short-chain carboxylic acid oxidase (belonging to glycolate oxidase, EC 1.1.3.15, i.e., mutant of 2-hydroxy-4-amino butanoic acid), and then generating 2,4-diaminobutyric acid (L-DaB) under the action of transaminase (belonging to beta-alanine-dependent transaminase family pfam00202, i.e., keto amino butanoic acid (L-DaB); finally 2,4-diaminobutyric acid is in the bifunctional synthase of Ektoin (EC 4.2.1.108, EC 2.3.1.178, i.e. mutant of Iktoin synthase) is transformed.

[0046] In some embodiments of the present invention, in the above-mentioned preparation method, the raw material pyruvate is circulated to regenerate acetyl-CoA under the action of Coenzyme A-dependent pyruvate oxidase (GtPyOxi).

[0047] In some embodiments of the present invention, the above-mentioned preparation method uses lactate dehydrogenase (LhLDH) to regenerate coenzyme NAD+, and uses catalase (PcCatal) to decompose hydrogen peroxide in the system.

[0048] In some embodiments of the present invention, in the above-mentioned preparation method, the enzyme activity of the mutant of the 2-hydroxy-4-aminobutyrate oxidase is 1500~2000U; the enzyme activity of the mutant of the keto aminotransferase is 1000~1500U; the enzyme activity of the mutant of the ektogenin synthetase is 1000~2000U; the enzyme activity of the mutant of the hydrogen peroxide hydrolase is 800~1000U; the enzyme activity of the mutant of the pyruvate-CoA oxidase is 3000U; the enzyme activity of the Lactobacillus Swiss lactate dehydrogenase is 1000~1500U.

[0049] The present invention uses a combination of multiple mutant enzymes to transform, and uses cheap 2-hydroxy-4-aminobutyric acid as the starting material to produce ictokines quickly and efficiently; since the enzyme method has specific characteristics such as easy control, short conversion time and few impurities generated, this method has unique advantages in cheap mass production of ictokines. Attached description of the drawings

[0050] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings required for use in the embodiments or the prior art description will be briefly described below.

[0051] Figure 1 Show the preparation roadmap of Ikedoin of the present invention;

[0052] Figure 2 A roadmap for preparation of Example 1 is shown;

[0053] Figure 3 A roadmap for preparation of Example 2 is shown;

[0054] Figure 4 The preparation roadmap of Example 3 is shown;

[0055] Figure 5 The preparation roadmap of Example 5 is shown;

[0056] Figure 6 Show the preparation roadmap of comparative examples;

[0057] Figure 7 The SDS-PAGE gel detection diagram after purification of the enzyme prepared in the present invention is shown; in which: 1 lane is NBAOxi, 2 lane is LhLDH, 3 lane is BcATA, 4 lane is HeEcAS, 5 lane is GtPyOxi, and 6 lane is PcCatal;

[0058] Figure 8 2,4-diaminobutyric acid 1 H-NMR,D 2 O as solvent, Varian 600 megamagnetic;

[0059] Figure 9 Shikdoin 1 H-NMR,D 2 O as solvent, Varian 600 megamagnetic;

[0060] Figure 10 Shikdoin 13 C-NMR,D 2 O as solvent, Varian 600 megamagnetic;

[0061] Figure 11 Show Ikedoin HPLC standard product picture. Specific implementation methods

[0062] The invention discloses enzyme compositions, products and their applications in the preparation of Ikedoin.

[0063] It should be understood that the expression "one or more of" separately includes each object described after the expression and various different combinations of two or more of the described objects unless otherwise understood from the context and usage. The expression "and / or" in combination with three or more narrative objects should be understood to have the same meaning unless otherwise understood from the context.

[0064] The use of the terms "including", "having" or "containing", including its grammatical synonyms, should generally be construed as open and non-limiting, such as not excluding other undescribable elements or steps unless otherwise stated or understood from the context.

[0065] It should be understood that the order of steps or the order in which certain actions are performed is not important as long as the invention is still operable. In addition, two or more steps or actions may be performed simultaneously.

[0066] Any and all example or exemplary languages ​​herein, such as "for example" or "including", are intended to better illustrate the invention and are not intended to limit the scope of the invention unless the claims are made. No language in this specification should be construed as indicating that any unclaimed elements are essential to the practice of the invention.

[0067] Furthermore, the numerical range and parameters used to define the invention are both approximate numerical values, and the relevant numerical values ​​in the specific embodiments have been presented as accurately as possible. However, any numerical value inevitably contains standard deviations due to individual testing methods. Therefore, unless otherwise explicitly stated, it is to be understood that all ranges, quantities, values ​​and percentages used in this disclosure have been modified "approximately". Here, "about" generally means that the actual value is within plus or minus 10%, 5%, 1%, or 0.5% of a particular value or range.

[0068] The present invention provides a simple and clear method for preparing icodon enzymes, such as Figure 1 As shown, the bulk raw material 2-hydroxy-4-aminobutyric acid is used to form an α-carbonyl carboxylic acid intermediate under the oxidation of the α-hydroxycarboxylic acid oxidase NBAOxi, which then forms 2,4-diaminobutyric acid (L-Dab) under the action of the β-alanine-dependent transaminase BcATA; finally, 2,4-diaminobutyric acid is highly efficiently converted to 2,4-diaminobutyric acid under the action of the ictoin bifunctional synthase (HeEcAS) and acetyl-CoA (Acetyl-CoA). This route can be distributed, or can be completed in one step using mixed crude enzyme liquid, or prepared by recyclable immobilized enzymes; it should be noted that since acetyl-CoA is very expensive, the development of its regeneration system is very important; in the present invention, inexpensive bulk pyruvate (pyruvate) is used to recycle and regenerate acetyl-CoA raw material under the action of Coenzyme A dependent pyruvate oxidase (GtPyOxi), which greatly reduces its actual usage and thus reduces production costs; in addition, In the preparation route, lactate dehydrogenase (LhLDH) is also used to regenerate coenzyme NAD+, and catalase (PcCatal) is used to decompose hydrogen peroxide in the decomposition system; since different enzyme catalysis has good compatibility, each enzyme that adjusts the active ratio can be added at one time to achieve direct conversion from 2-hydroxy-4-aminobutyric acid to ictogen; therefore, the process of preparing ictogen in the plenum method of the present invention has many advantages such as green, simple process, cheap production and easy to produce on a large scale.

[0069] The enzyme compositions of the present invention include:

[0070] 2-hydroxy-4-aminobutyrate oxidase (NBAOxi): derived from kiwi (Actinidia chinensis var.chinensis, Uniprot ID: A0A2R6P2W5), the natural enzyme (WTNBAOxi) is active on multiple alpha-hydroxy short-chain carboxylic acids. After sequence structure design and transformation (NBAOxi), its soluble expression and activity on 2-hydroxy-4-aminobutyrate substrate are significantly improved. The specific mutation sites are: T34N, S70I, T101Q, I102A, M103W, D260N, R290K.

[0071] Keto aminotransferase (BcATA): Burkholderia cenocepacia, Uniprot ID: B4EHM2. This natural enzyme (WTBcATA) has high activity on beta-alanine and has certain activity on different alpha-keto acids. After modification (BcATA), its expression and activity have been improved. The specific mutation sites are: Q123G, H144T, W232N, P233D, K369V, S390H.

[0072] Hydrogen peroxide hydrolase (PcCatal): Archaeophytes (Pyrobaculum calidifontis, Uniprot ID: Q6LA34), the natural enzyme (WTPcCatal) has a high activity of hydrolyzing hydrogen peroxide, but its expression is relatively poor. By modifying the enzyme structure (PcCatal), its activity is partially improved and the enzyme expression is significantly increased. The mutation sites are: R7H, F61M, V184S, L205D, F287I.

[0073] Ectomonas synthetase (HeEcAS): Halomonas elongata (Uniprot ID: O52249-O52251), this natural enzyme (WTHeEcAS) has a higher Ictomonas synthesis function, but the two independent enzymes, through fusion and partial mutation, the expression of this engineered enzyme (HeEcAS) is increased, and it also has dual functions. The mutation sites are: V23Q, C73S, Y90L, R215E, N223D. E266T, Y326V.

[0074] Pyruvate-CoA oxidase (GtPyOxi): Guillardia theta (Uniprot ID: L1JII2). This natural enzyme (WTGtPyOxi) can use pyruvate and NADP to generate acetyl-CoA (Acetyl-CoA), but the enzyme is very large and difficult to ferment and expression. Through systematic sequence rearrangement and mutation modification, a mutant enzyme (GtPyOxi) that can effectively express and utilize NAD is finally obtained. The specific mutation sites are: Y66L, C89S, D180A, K183M, H186V, H196E, Q276N, M395I, N466H, V494Y, D568T, K575G.

[0075] Lactobacillus helveticus, Uniprot ID: O32765, which naturally has high activity against pyruvate.

[0076] Table 1 Summary of the enzyme properties involved in the present invention

[0077]

[0078] Table 2 The amino acid sequence of the enzymes involved in the present invention

[0079]

[0080] Table 3 Nucleotide sequences of enzymes according to the invention

[0081] Abbreviation and English DNA sequence of enzyme NBAOxi atggaaattaccaacgtgaccgaattgatgcgattgcgcgccagaaactgccgaaaatggtgttatgattattgcgagcggcgcggaagatcagtggaacctgcaggaaaaccgcaacgcgtttagccgcattctgttcgcccgcgcattctgattgatgtgagcaaaattgatgatgaccaccaccgtgctggctttaaaatttattgccgaccgcgaattgcgaattgcgaccgcgaatgcagaaaatggcgcatccggaattgcgaattgcgaccgcgaattgcgaattgcgaccgcgaattgcgaattgcgaccgcgcgaattgcgaattgcgaccgcgcgcagaaaatggcgcatccggaattgcgaattgcgaccgcgcgcgcgcagaaaatggcgcgcggaattgcgaattgcgaccgcgcgcgcgcg gcgcgcggcgagcgcggcggcggcggcggcggcggcggtggccggtggaccctgagcagctggcgaccagcagcgtgggaaggaagtggcgagcaccgcggcggcggcattcgcttttttcagctgttgtttcagctgttgtataaagatcgcaacgtggtggcgcagctggtgcgccgcgcggcggcttttgaaaaaccgctttgaaggcctgaaccgcctggccgccgcgaagcggatattaaaaaccgcttttgaagcctgaaaactttgaagccttgaagcctttgaagcctttgaaaaactttgaagcct ggatctgggcaaaatggatgataaagcggcctggcgagctatgtggcggccggccgattgatcgcagattgaatcgcagcctgagctggcagctggcaaagtgtgaaatggctgcagaccattaccaaactgccgattctggtgaaaggcgtgctgaaaggcgcggccgccgcattattgtgaaaggcggcgcggcggccgctgaactattgtgaaagtggcggcgccgccgctgaaggaagtggtgaaaggcggcgccgccgctgaactattgtgaaaggcggcgccgccgctgaactattgtgccggcgcgccgctgaaggaagtggtgaaaggcggcgcgccgccgctgaactattgtgccggcgcgcgcg cgtgccggtgtttctggatggcggcgtgcgcgcaaaggcaccgatgtgtttaaagcgctggcgcgcgagcggcggcggcatttttattggccgccgcccggtggtgttttagcctggcggcggcgaaggcggcgtgcgcaaagtgctgcagatttgaactgaccatggcgctgcgcgaagcctgaagaatttgaactgaccatggcggctgccgcagcctgaaagaatttctgaccgcggctgccgcagcctgaaagaatttctgaccgcggctgccgcagcctgaaagaatttctgaccgcgattgggattagccgccgcgcgcctgcagcctgaaagaatttctgaccgcccgcagccggtggcgcgcctgtaa (like SEQ ID NO:7) PcCatal atgtatctgcgcattgatcatctgcagattcagctgccggcgccgaaaagaaccggatccgatccgaacgcggcggcggcggtgagcgaactgctgggcggccgctttggcgaaatgaacccctgatgaccttaacctatcagagctttaactttcgcatgcataaaacccggggcgattaaaccgatgcgcgatctggtgagcacattgcgaccgaagaactggggccat attgaactggtgagcgcggtggtgaacgcgctgtgaacgcgctgttgggcagccaaaccggcgccgccggatcatcaggcgccgctgaaaccgctgaaagatgtgcgcaaccctatttctgtaacacccggcctggcgcgtttccgatggattagccatggcaccccgtggcgcggcggcgattaattttttttgtgagcggcaacctggtgctggattttttttttgtgagcggcaacctggtgctggattttttttttttc tggagtgggcgcgcgcctggcgaaaattcgcgaaaattcgcgtgtatgaaatgaccgataacccggtggcgcgcgaaattggctatctgctggtgcgcggcagccatgcgaattgaattgaaagcgctggaagcgctggaagcggcgtggagtggaagtgtggcgcatggatggatccgatccgatccgatccgatccgaattgaagttccgaaattgaagttccggaagcggcgaaattatgaaattgaaattccggaagcggcgaaattatgaaaatgggcgcg tgcatcgcaccctgtatcgctttagccgagcgattataaagatttgaaaaaatttggaaaagcgcgcatccggcggcggatggccgctgcaggtgcatgatggccgccgccggaaggcggcgaattctggcatgaactgccggaaggtgccggaaggcggcgaattctgggaactgccggaagttgccggaagttgccggaagggaagttgccgggcctgtataaagatttgcgccggcctgtataaagattgaacgcattgcgaaacgcctggcattaacctgtga (such as SEQ ID NO:9) BcATA atgagctatagcgaaagccgcttttggcatccgcgccgccgccgccgccgccgccgccgccgccggtgcgccggccggtgcgcattacccgcggcgaaggctgctatctgtatgatgataccggccgccgttaggtggcctgccgccgtttaacgtgtggccatggccgcctgtttaacgtgtggccatggcc gccgcgaaattaaagaagcgattattcgccagctggatgatgaactggatgaatatcatccgggtgtttgcggggctttagccgcgcggaagaactgagcgcgcctggtggcatgctgcagccggaagatatgagccgcgtgattttggcagccgcgcgcatgcggaagatatgagccgcgtgattttggcagcggcggcatgcgcgcgatttttggcagcggcgcgcgatgc ggtggaggaagcggcgctgatgattgcgcgcggcggctattgggaaagtgagcggccgccggaacgccgggaacgcaaccaaattttgcgctgcgccagccaggcgttaccggcagccattttggcggcagcagcgtgaccggcaacccgtgtatcgccgcaactatgaaccgacctggcggcgccaactatgaaccgacctggcggcgc tgctttcatgtgggaaacccgtggatttatcgcaacccgtttaccatgatccggaagaactggggccgcctgtgcgcgagcctggtgggaacgcgaaattctgtttcagggccggaaattctgttcagggcccgtggcggcgttttgcgggaaccggtgcaggcggcggcattattg tgccgccggcgaactattaacgatctggtgcgcgaagtgtgcgaagccatggcgtgctgctgattgcggatgatgaagtggtgaccggctttggccgcaccggcggcggcgttggcgcgttggcagccgcggctggcgccggtgatattatgtgcctggcgaaaggcgtgagcag cggctatctgccgctgggcgcgaccgtggtgaaccgccgcgcgcgcgcgctggcgaacctgcagacctgcattgtgtgcgcggcgcgctggcgaacctgcattgcatggcatggctataccttagtgcggcggcggcgctggcgaacctgcagattgtgtgtggaagatctg gcggggcaacgcggcgcgcgaaggcgcgaaggcgcgcgtatctgctgggaacgcctgcagccgctggtggcttgggcgatgtgcgcggcgtggcctgctggtggtggtgaaagtaaagtgaccgcgaaagcattgatccgcatgatccgcatgatggctatgcgggcgggcgggcgg cggcgctggcggatgcggcgcgcgcgcgcgtgctgattcgcagcctggcacctggcaccgcgctggcgcgctggcgcgcgctggcgcgcgctggtgattggccgcgaagatgtggcatgcatgcgattgaacatgcgttgaagcggtgccgcgctggaccgcgctaa (such as SEQ ID NO:8) HeEcAS atgaacgcgaccaccgaaccgtttacccgagcggatctggcgaaaccgagcgtggcggatgcggatgcgcaggtggccatgaagcgagcccgctgtttattcgcaaaccgagcccggatgatggctggcatttatgaactggtgaaaagctgcccgccgctggggcatttatgaactggtgaaaagctgcccgccgctggtgggcgcgtggcgttggcgccaacgaagaaggcgaaattgtgggcgcgttggcgccaacgaagaaggcgaaattgtgggcgcgttggc tttgtgagcggcctggtgaaaagcaacgcgccgggaatacctatttttctgtggcaggtggcggtggcgaaaaagcgcggccggccggccggcctggcgaaaaagcgcggccggcctggtgggaagcggcgccgcctggtggaggaagcggcccggaaatggcgcgaatttttagcaccgatcgaatcgattttagcaccgatcgatcgatcgatccaggcgatcgcctgggcctggtttcgcctggcggcctggctggcggccgctgaacagccgcgaattttttagcaccgatcgatcgcctggcggccgctggcgctgaacagccgcgaattttttagcaccgatc agctgggcggcgaacatgatccgggaaaacctggtgcgcattggcccgtttcagaccgatcagattagcagcggcctggtgccgcggcagcatgattgcgcggcagcatgattgtgcgcaacctggaagaagcgccgaccgatgaactggtgaccgcgaaacggcgattgggatagcaccgcctgaagcctgaagcctgaaggcggcaactgcagctttcattcattcattcattgaaggcaccgaaacccatttcattata aacatcattttgaagcggtgttgcattaccggcgaaggcgaagtggaaaccctggcggatggatggcaaaatttggccgattaaaccgggcgatttaaaccgggcgatttaatttctggatcagcatgaatgaacatctgctgcgcgagcaaaaccatgcatctggcgtgcgtgtttacccccggcaacgaagtgcagcagcgtggcggcggcggcggatgatgaagcggcggcggcggatgatgaagcggtgatgaaaccgctgtga (such as SEQ ID NO:10) GtPyOxi atggcgctgagcgaagtgagctttattatccgattacccccgagcagcccgatggcgaaatggtggcgaaatggtggatgaatggcggcgaacggcctgaaaaacatttttggccgaaccctgaaaccctgaagcgaagcgaagcggcggcggcggcgcgcgcgctgcatggcatggcagcctgaaagcgggcggcgcgcgctgcatggcagcctgaaagcggcggcgcgcgctgctgctgatgaattccgaacatgtataaaattgcgggcgaactgct gccgagcgtgatgcatgtgagcgcgcgcgcgcaccctgtgcgcgcatgcgcgctgacatttttggcgatcatcatagcgatgtgatggcggcgcgcgccaccacccggctgggtgatgctggcgagcgaaaacccgcatggtgatgatcaggcgctggtgagccatctggcgaccatggatggattgcgtgccggtgctgcattttttttgatggctttcgcaccatgaagtgaagtgaacaagtgcgcgtgattaactatgatgatgatgattata aaaaatttttccgtgggcgagcgtgatgaccatgtggatagtggatagcgcgctgagccgatgaacccggaaattcagggcccggaattcagggcccggaattgttttttcaggcggcgggaagcgaacgcgaacgcgattcataaccattccggcgttgattagcagaaatggcgaaaagtggcggccgccgctatggctttttttttagctatgaaggccggaaaacgtgattgtgattgattggattgcagcgggcgggccgctatggctttttttttagctatgaaggccggaaaacgtgattgtgattggattgcagcggggcggg cgcggtgaaccgtgcatgaaaccgtgaaatatctgaacagccataaccagaaagtggcgtgctgaaagtgcgtgctgaaagtgcgcctgttcgcccgtggttcgcccgtggattaccgaacgcttttatggcggcggcgagcgtgaaacgcattgcggcgccgtgaaacgcattgcggcgccgctgtggcgaaccgcttttgcgaaccgctgtttgcgaaccccctgcatctgagcggcatggatcattaaagtgtgtggcggccgccgctgcctggcctgcatggcatgagcggcatggattataaagtgtgtgcggccgcctgttttgcgatgtgcacccctgcatgagcggcatggatcattataaagtgtgtgcggccgcctgtgcggcctgtgccct gggcggcaaagatttttacccccggcatggtgctgagcgtgtttaaaaacctgggaagcggcgtgtttaaaacctgggaagcggcgcatccgaaaaccaaatttaccgtggcattgtggatgatgatgtgaaccaacctgaacgtgggaaggaagtggatttctgccgagcggcggcattcattcagtgcctgatttatggcctggcagcgatggcaccgtggcgcgaacaaagcgtgggcgcgaacaaagcgcgattaaaaccattgcgcagaacaccataactttgcgcaggcta ttttgaatatgatagcaaaaaaagcggcggcctgaccgtgagccatctgcgctttggccgcatccgattaacgcgccgttggtgaaacatgcggccgttggtgaaacatgcggattaattggcattcataaaaagctatctgagccgcctggattgcaaaaacggcaccgtgtattaactgcaccttggccggaaaaacggcaccgtgtattaactgcaccttggccggaaaaagtggaaaaacatgctgccgccgcgcatgaaatatatcagctggcgagcaaaaaagcgag cctgtatctgattaacgcggtgaaagtggccgcgaaaccggcatggcaaacgcattaacatggtgatgcagagcgtgttttttaaactgagccgcgtgccgtttgaaaaagcgattgaactgctgaaaaaaccgtgcagaaaatgtgcagaaaagtggcggcaaagtggtgaaacgcaactgggatgcatgatgcagcattggcatggcaccggccgccgtggcgccgcgcgcgctgaccagcatcatggcatggcatggcatggcatggcaccggccgccgtggcgcgcgcgcgctgaccccgcgcgcgctgacccccatcat tgcgctgaaacagcaggcattgatgtggcccgtgcaccattttattggcgcgcgcaaaggcgaccgaattctgttgcgcgaagattctgttgaaaaatatgaaaaatgggcgtgctgcgcatggtttagccgcatcagccgcagaaaattttagtgcagcatcgcattcgcgaagatttatgaaaacgtgttcgccgctgatgaaagaacagggcagcttttatgtgcggcagcagctaa (such as SEQ ID NO:11) LhLDH atggcgcgcgaagaaaaaccgcgcaaagtgattctggtgggcgatggcgatggcgcggcggtggcagcacctttgcgtttagcatggtgcagcaggcattgcggaagaactgggcatttgattgattgcgaaagaacatgtggaaggcgattgatctggcggattgattaggcgatgcgattgattaggcgatgcgattgattaggcgatgcccccgaaaaacattttatgcggcggtggtgattaccg cgggcgccgccgcagaaaccggcgaaacccgccgcctggatctggtgaaccaaaaacctgaaaaattctgagcagcattggaaccggtggtggtgggaaagcggctttgaaagcatttttctggtggcgaacccggtggcagaaagtgaacctggcggcatgattggcaaaat ggaaaacgtggatccgagcagcgtgaacgcgtgaacgcgttaatgctgggcgaacatggcgaatccgaatttccggcgtgggcgtggctagctataacacgtggcgggtgaaagtggcggtgaaagtggcggtgaaagtggcgaaagcaaacatgccgggaaagcaaactggaagattcatcaggaagtgaaagtgaaagtgaaagtggcgtgaatttgaaaaaaggcgtgaatttgcgcgcgcgatgattttatggcattggcaccgcgcgatgattgcg aaagcgattctgaacgaatcgcgtgctgccgctgagcgctgagcgtgccgatggcgaatggcgaattggcgaattggcctgcatgatctgcattggcaccccggcggtggtggccgcaaaggcctggaacaggtgaattgaatgccgctggaaaggtgattgaaatgccgctgataaaagaactgatgaccgcgagcgcggatcagctgaaaaaagtgatgatggataaagcgtttaaaaccggcgtgaaagtgcgccgtgaaagtgcgccgtcagctgaaaaaagtgatggataaaagcgtttaaaaccggcgtgaaagtgcgccagtaa (such as SEQ ID NO:12)

[0082] Ektoin HPLC test conditions: Column: Water X-Bridge HILIC (4.6x250 mm, 5μM) 40℃, 210nm detection; Mobile phase: 5 mM KH 2 PO 4 Isotropic with acetonitrile.

[0083] In the Preparation Example 1 to Preparation Example 2, Example 1 to Example 5 and Comparative Examples, the raw materials and reagents used are all commercially available.

[0084] The present invention will be further explained in the following in connection with the examples:

[0085] Preparation Example 1 Fermentation and Production of Enzymes

[0086] The enzymes used in the present invention are produced by fermenting themselves in the laboratory. The following is the basic operating procedure for preparing the enzyme. First, the gene sequence corresponding to the enzyme was synthesized by Gene Company (Anhui General Biologics), and then subcloned on the pET28a plasmid through the NdeI / XhoI enzyme cleavage site, and the plasmid was transferred to E. coli (BL21) (Qingke Biologics) cells for plate culture. Finally, the monoclonal clone was selected for liquid amplification and culture.

[0087] The following is the basic process of cell amplification and culture. First, the single colonies on the plate are transferred into 5 mL of LB culture medium containing 50 μM kanamycin (37°C) for culture. When the cells grow to the logarithmic phase, the cells are seeded into 250 mL of LB culture medium containing the same antibiotics, and finally transferred to a 5 L culture fermenter for culture. When the cells are OD ~25, 0.5 mM isopropyl-β-D-thiogalactopyranoside (IPTG) was added to 30°C for 6 hours, and then 20-35g of wet cells were collected by centrifugation (4000 rpm, 15 minutes). To verify the expression of enzyme, a small amount of cells were first mixed with trimethylolamide hydrochloride (Tris.HCl) buffer (50 mM, pH 8.0), and then the cells were broken by freeze-thawing method. After high-speed centrifugation, the supernatant was taken to run on SDS-PAGE protein gel (sodium dodecyl sulfonate-polyacrylamide gel) to determine the soluble expression of the protein; confirm the correct remaining cells were first mixed with the buffer (10 grams of wet cells mixed with about 200 mL of the above buffer), and then high-pressure rupture of cells, high-speed centrifugation (16,000 rpm, 45 minutes) to remove the cell wall. Finally, the enzyme-containing serum obtained was directly used for subsequent use (the liquid enzyme activity is between 200~1,200 U / mL, U is the amount of enzyme required to convert 1 μmol of substrate in one minute at room temperature) or after further purification and immobilization (during solid enzyme reaction). The LB medium consists of 1% tryptone, 0.5% yeast powder, 1% NaCl, 1% dipotassium hydrogen phosphate, 1% dipotassium hydrogen phosphate and 5% glycerol.

[0088] Preparation Example 2 Mixed Immobilization of Enzymes

[0089] The crude enzyme solution collected in Preparation Example 1 was added to the 2-hydroxy-4-aminobutyrate oxidase (NBAOxi), keto amino transaminase (BcATA), hydrogen peroxide hydrolase (PcCatal), ektoin synthase (HeEcAS), pyruvate-CoA oxidase (GtPyOxi) and Lactobacillus Swiss lactate dehydrogenase (LhLDH) collected in Preparation Example 1, ammonium sulfate solid was added in amount until the enzyme precipitated (40%~60%, w / v ammonium sulfate / buffer solution). The enzyme solid was then collected by centrifugation (10000 rpm, 12 min) and slowly dissolved into 25 mM Tris buffer at pH 8.0. Finally, it was desalted by G25 size exclusion chromatography column (purified from Sigma) and separated by DEAE Seplite FF (Xi'an Lanxiao Company) anion exchange column to obtain the primary purified liquid enzymes NBAOxi, PcCatal, BcATA, HeEcAS, GtPyOxi, and LhLDH. In the immobilized mixed enzyme, the above-mentioned primary purified enzyme was mixed and fixed using LX-1000EP epoxy resin (Xi'an Lanxiao Company) according to the active unit 4:2:3:4:6:3.

[0090] The basic method of fixation is: 10,000U mixed enzyme mixed in the above unit of vitality is dissolved in 2L of 50 mM potassium phosphate solution with pH 8.0, then 60 mM phenoxyacetic acid and 900 grams of LX-1000 EP epoxy resin are added to the buffer solution, stir at room temperature for 8 hours, filter out the immobilized enzyme, and finally wash three times with clean water and 25 mM pH 8.0 phosphate buffer, then dry at low temperature for later use; NBAOxi / PcCatal / BcATA / HeEcAS / GtPyOxi / LhLDH immobilized enzyme has 75-90% activity of the corresponding liquid enzyme.

[0091] Example 1 2,4-diaminobutyric acid (L-DaB) was prepared in one-time using 2-hydroxy-4-aminobutyric acid and β-alanine as raw materials.

[0092] Preparation routes such as Figure 2 In the 1L 25 mM pH 8.0 trihydroxymethylaminomethane hydrochloric acid (Tris. HCl) solution, 11.9 g 2-hydroxy-4-aminobutyric acid (100 mM), 9.8 g β-alanine (110 mM) and 10.1 g magnesium chloride hexahydrate (5 mM) were added to 1500 U NBAOxi crude enzyme solution, 1000 U BcATA crude enzyme solution and 800 U PcCatal crude enzyme solution were started. The reaction was slightly stirred at 30°C. During the reaction, diluted aqueous hydrochloric acid solution or aqueous sodium hydroxide solution was continuously added to maintain the pH of the reaction system between 7.0-9.0; at the same time, air (500~1000 ml of air / min) was continuously poured into the reaction liquid system to promote the reaction. After 3 hours, the reaction was completed. The reaction solution was adjusted to acidic (~pH 1.0) by adding an excess hydrochloric acid solution to inactivate, denature and precipitate the enzyme. The protein precipitation was quickly centrifuged (~10000rpm, 10 minutes). Then, the pH value of the clear solution was adjusted back to 7.0 and purified using D101 non-polar resin and collected the crude product. Finally, desalted, concentrated and crystallized using reverse osmosis membrane (ethanol:H 2 O = 2:1, V:V) gives 10.6 g of 2,4-diaminobutyric acid as a white solid (final yield 89%).

[0093] Example 2 The liquid enzyme HeEcAS synthesised Ikedoin using 2,4-diaminobutyric acid (L-DaB) and acetyl-CoA (Acetyl-CoA) as raw materials

[0094] Preparation routes such as Figure 3 In 1L 25 mM pH 8.0 trimethylolamide aminomethane hydrochloric acid (Tris. HCl) solution was added to 3.6 grams of 2,4-diaminobutyric acid (30 mM), 20 grams of acetyl-CoA (25 mM) and 10.1 grams of magnesium chloride hexahydrate (5 mM) to adjust the pH value of the solution back to 8.0 in 1L 25 mM pH 8.0 trimethylolamide aminomethane hydrochloric acid (Tris. HCl) solution prepared in Example 1, and the pH value of the solution was adjusted to 8.0. Then, 1000U of HeEcAS crude enzyme solution was added. The reaction was slightly stirred at 30°C for 2 hours. After 2 hours, hydrochloric acid was added to terminate the reaction, precipitated and centrifuged proteins, and then the solution was adjusted to pH 7.0 and then the product was removed by using D201 anion exchange resin to remove the impurities containing CoA. The effluent containing the product was then purified and collected by D101 non-polar resin. Finally, the crude product was desalted, concentrated, and crystallized using reverse osmosis membrane (ethanol: H 2 O=1:1, V:V) gives 3.5 g of ektogen white solid (final yield 93%).

[0095] Example 3 Use 2,4-diaminobutyric acid and pyruvate as raw materials and prepare ektoin by liquid mixed enzymes (HeEcAS, GtPyOxi, LhLDH).

[0096] Preparation routes such as Figure 4 As shown, similar to Example 2, the reaction solution was also added to the reaction solution to regenerate it.

[0097] After adding 11.9 g of 2,4-diaminobutyric acid (100 mM), 0.77 g of Coenzyme A (CoA, 1 mM), 26.4 g of sodium pyruvate (240 mM), 1.4 g of nicotinamide adenine dinucleotide NAD+ monosodium salt (2 mM), and 10.1 g of magnesium chloride hexahydrate (5 mM) to the solution pH value was adjusted to 8.0; then 3000 U GtPyOxi crude enzyme solution, 1500 U HeEcAS crude enzyme solution and 1000 U The reaction was started; the reaction solution was slightly stirred at 30°C, and the pH of the reaction system was maintained between 7.0-9.0 with acid and alkali during the reaction. After 4 hours, the reaction was completed. The enzyme was added in the reaction solution, and the enzyme was quickly centrifuged (~10,000rpm, 10 minutes) to remove the enzyme precipitation. Then, the pH value of the clarified liquid was adjusted back to 7.0 and then the D201 anion exchange resin was used to remove the phosphoric acid impurities such as Coenzyme A and NAD+. The effluent containing Ektoin was then purified and collected by D101 non-polar resin. Finally, the crude product was desalted, concentrated, and crystallized using reverse osmosis membrane (ethanol:H 2 O=1:1, V:V) gives 12.8 g of ektogen white solid (final yield 90%).

[0098] Example 4: One-pot method for preparing Ikedoin by liquid mixed enzymes (NBAOxi, PcCatal, BcATA, HeEcAS, GtPyOxi, LhLDH) using 2-hydroxy-4-aminobutyric acid, β-alanine and pyruvate as raw materials

[0099] Preparation routes such as Figure 1 In 1L 25 mM pH 8.0 trimethylolamide aminomethane hydrochloric acid (Tris. HCl) solution, 11.9 g 2-hydroxy-4-aminobutyric acid (100 mM), 9.8 g β-alanine (110 mM), 0.77 g Coenzyme A (CoA, 1 mM), 13.2 g sodium pyruvate (120 mM), 1.4 g nicotinamide adenine dinucleotide NAD+ monosodium salt (2 mM), and 10.1 g magnesium chloride hexahydrate (5 mM) were added to the solution pH value to 8.0; then 2000 U NBAOxi crude enzyme solution, 1500 U BcATA crude enzyme solution, 1000 U PcCatal crude enzyme solution, 3000 U GtPyOxi crude enzyme solution, 2000 U HeEcAS crude enzyme solution and 1500U LhLDH crude enzyme solution initiate the reaction; the reaction solution was slightly stirred at 30°C, and the pH of the reaction system was maintained between 7.0-9.0 with acid and alkali during the reaction. After 6 hours, the reaction was completed, and the enzyme was added to precipitate the reaction solution, and the enzyme was quickly centrifuged (~10000rpm, 10 minutes) to remove the enzyme precipitation. Then, the pH value of the clarified liquid was adjusted back to 7.0 and then the D201 anion exchange resin was used to remove the phosphoric acid impurities such as Coenzyme A and NAD+. The effluent containing Ektoin was then purified and collected by D101 non-polar resin. Finally, the crude product was desalted, concentrated, and crystallized using reverse osmosis membrane (ethanol: H 2 O=1:1, V:V) gives 11.8 g of ektogen white solid (final yield 83%).

[0100] Example 5 Immobilized mixed enzymes in one-time preparation of Ikedoin using 2-hydroxy-4-aminobutyric acid, β-alanine and pyruvate as raw materials

[0101] Preparation routes such as Figure 5 As shown, the reaction is similar to Example 4 above, but the immobilized enzyme is used, so it can be recycled and utilized multiple times.

[0102] After adding 11.9 g of 2-hydroxy-4-aminobutyric acid (100 mM), 9.8 g of β-alanine (110 mM), 0.77 g of Coenzyme A (CoA, 1 mM), 13.2 g of sodium pyruvate (120 mM), 1.4 g of nicotinamide adenine dinucleotide NAD+ monosodium salt (2 mM), and 10.1 g of magnesium chloride hexahydrate (5 mM), the pH value of the solution was adjusted back to 8.0, and the last 10,000 U of immobilized mixed enzyme was added at one time to start the reaction; the reaction was slightly stirred at 35°C, and the reaction pH was maintained during the entire reaction process About 7.0-8.5, after 8 hours, the reaction was complete, and then the immobilized mixed enzyme was collected by filtration (the mixed enzyme still retained 85% of its initial vitality after 6 use); the filtrate was first used to remove phosphate-containing Coenzyme A, NAD+ impurities, etc., and then purified by D101 non-polar resin to collect the crude product. Finally, it was desalted using reverse osmosis membrane, concentrated and crystallized (ethanol: H 2 O=1:1, V:V) yielded 12.6 grams of white solid (final yield 89%).

[0103] Comparative Example Preparation of Ikedoin by one pot method using 2-hydroxy-4-aminobutyric acid, β-alanine and pyruvate as raw materials and liquid mixed enzymes (WTNBAOxi, WTPcCatal, WTBcATA, WTHeEcAS, WTGtPyOxi, WTLhLDH) by one pot method

[0104] Preparation routes such as Figure 6 As shown, similar to Example 4 above, the mutant enzymes were replaced with natural enzymes:

[0105] In 1L of 25 mM pH 8.0 trimethylolamide aminomethane hydrochloric acid (Tris. HCl) solution, 6.0 grams of 2-hydroxy-4-aminobutyric acid (50 mM), 4.9 grams of β-alanine (55 mM), 0.77 grams of Coenzyme A (CoA, 1 mM), 6.6 grams of sodium pyruvate (60 mM), 1.4 grams of nicotinamide adenine dinucleotide NAD+ monosodium salt (2 mM), and 10.1 grams of magnesium chloride hexahydrate (5 mM), and then the pH value of the solution was adjusted to 8.0; then 3000U WTNBAOxi crude enzyme solution, 2000U WTBcATA crude enzyme solution, 1500U WTPcCatal crude enzyme solution, 4000U WTGtPyOxi crude enzyme solution, 3000U The reaction was started; the reaction was slightly stirred at 30°C, and the pH of the reaction system was maintained between 7.0-9.0 with acid and alkali during the reaction. After 12 hours, the enzyme was added to the reaction solution, and the enzyme was quickly centrifuged (~10,000rpm, 10 minutes) to remove the enzyme precipitation. Then, the pH value of the clarified liquid was adjusted back to 7.0 and then the D201 anion exchange resin was used to remove the phosphoric acid impurities such as Coenzyme A and NAD+. The effluent containing icodon was then purified and collected by D101 non-polar resin. Finally, the crude product was desalted, concentrated, and crystallized using reverse osmosis membrane (ethanol:H) 2 O=1:1, V:V) gives 0.36 g of Ikedogen gray solid (final yield 5.2%).

[0106] The above is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and retouches can be made without departing from the principles of the present invention. These improvements and retouches should also be regarded as the protection scope of the present invention.

Claims

1. An enzyme composition, characterized in that include: mutants of 2-hydroxy-4-aminobutyrate oxidase, mutants of ketotransaminase, mutants of hydrogen peroxide hydrolase, mutants of ectoine synthetase, mutants of pyruvate-CoA oxidase, and Lactobacillus helveticus lactate dehydrogenase; The mutation sites of the mutant of the 2-hydroxy-4-aminobutyrate oxidase include: T34N, S70I, T101Q, I102A, M103W, D260N and R290K; The mutation sites of the mutant of the ketotransaminase include: Q123G, H144T, W232N, P233D, K369V and S390H; The mutation sites of the hydrogen peroxide hydrolase mutant include: R7H, F61M, V184S, L205D and F287I; The mutation sites of the mutant of the ectoine synthetase include: V23Q, C73S, Y90L, R215E, N223D, E266T and Y326V; The mutation sites of the mutant of the pyruvate-CoA oxidase include: Y66L, C89S, D180A, K183M, H186V, H196E, Q276N, M395I, N466H, V494Y, D568T and K575G.

2. The enzyme composition according to claim 1, characterized in that The 2-hydroxy-4-aminobutyrate oxidase is derived from kiwi fruit ( Actinidia chinensis var. chinensis ); The ketotransaminase is derived from Burkholderia Burkholderia cenocepacia ); The hydrogen peroxide hydrolase is derived from Archaea ( Pyrobaculum calidifontis ); The ectoine synthase is derived from Halomonas elongatus ( Halomonas elongata ); The pyruvate-CoA oxidase is derived from Cyanobacteria ( Guillardia theta ); The Lactobacillus helveticus lactate dehydrogenase is derived from Lactobacillus helveticus ( Lactobacillus helveticus ).

3. The enzyme composition according to claim 1 or 2, characterized in that The amino acid sequence of the mutant of 2-hydroxy-4-aminobutyrate oxidase is shown in SEQ ID NO: 1; The amino acid sequence of the mutant of the ketotransaminase is shown in SEQ ID NO: 2; The amino acid sequence of the mutant of the hydrogen peroxide hydrolase is shown in SEQ ID NO: 3; The amino acid sequence of the mutant of the ectoine synthase is shown in SEQ ID NO:4; The amino acid sequence of the mutant of pyruvate-CoA oxidase is shown in SEQ ID NO:5; The amino acid sequence of the Lactobacillus helveticus lactate dehydrogenase is shown in SEQ ID NO:

6.

4. An immobilized enzyme, characterized in that include: The enzyme composition according to any one of claims 1 to 3.

5. A nucleic acid molecule encoding the enzyme composition according to any one of claims 1 to 3 and / or the immobilized enzyme according to claim 4.

6. The nucleic acid molecule according to claim 5, characterized in that The nucleotide sequence of the nucleic acid molecule encoding the mutant of 2-hydroxy-4-aminobutyrate oxidase is shown in SEQ ID NO: 7; The nucleotide sequence of the nucleic acid molecule encoding the mutant of the ketotransaminase is shown in SEQ ID NO: 8; The nucleotide sequence of the nucleic acid molecule encoding the mutant of the hydrogen peroxide hydrolase is shown in SEQ ID NO:9; The nucleotide sequence of the nucleic acid molecule encoding the mutant of the ectoine synthase is shown in SEQ ID NO: 10; The nucleotide sequence of the nucleic acid molecule encoding the mutant of the pyruvate-CoA oxidase is shown in SEQ ID NO: 11; The nucleotide sequence of the nucleic acid molecule encoding the Lactobacillus helveticus lactate dehydrogenase is shown in SEQ ID NO:

12.

7. Biomaterial, characterized in that Including at least one of the following (1) to (3): (1) A recombinant vector containing the nucleic acid molecule according to claim 5 or 6; (2) transforming or transfecting a host cell with the recombinant vector described in (1); (3) Cultivating the host cell as described in (2) to obtain the mixture.

8. Use of the enzyme composition according to any one of claims 1 to 3, the immobilized enzyme according to claim 4, the nucleic acid molecule according to claim 5 or 6 and / or the biomaterial according to claim 7 in the preparation of ectoine.

9. A product, characterized in that include: The enzyme composition according to any one of claims 1 to 3, the immobilized enzyme according to claim 4, the nucleic acid molecule according to claim 5 or 6 and / or the biomaterial according to claim 7, and acceptable auxiliary agents, excipients and / or carriers.

10. The preparation method of ekdoin is characterized in that: Using 2-hydroxy-4-aminobutyric acid, pyruvic acid and β-alanine as raw materials, ectoine is prepared by any of the following conversions; (4) The enzyme composition according to any one of claims 1 to 3; (5) The immobilized enzyme according to claim 4; (6) A nucleic acid molecule according to claim 5 or 6; or (7) The biomaterial according to claim 7; (8) The product as claimed in claim 9.

Images