Bisphenol F degradation gene cluster bpf and application thereof

Abstract

The invention discloses a bisphenol F degradation gene cluster bpf and application thereof. The strain DN12 is separated and can degrade the BPF and grow by taking the BPF as the unique carbon source and energy. On the basis, a BPF degradation gene cluster bpf is obtained from the strain DN12 by adopting whole genome and comparative transcriptome sequencing analysis. Three different degrading enzymes (two-component oxidase BpfAB, monooxygenase BpfC and hydrolase BpfD) are found in the gene cluster and can catalyze gradual degradation of BPF, and a simple aromatic ring compound p-hydroxybenzoic acid is generated.

Description

Technical Field

[0001] The present invention relates to the technical field of environmental microorganisms, and in particular to a bisphenol F degradation gene cluster. bpf and its applications. Background Art

[0002] Bisphenol analogs are a class of endocrine disruptors and emerging pollutants in aquatic environments. Studies have shown that exposure to bisphenol A (BPA) is associated with the incidence of health problems such as hypertension, obesity, type II diabetes, cardiovascular disease, and cancer. As global regulation of BPA is strengthened, the use of its substitute, bisphenol F (BPF), is on the rise. According to statistics, the annual production of BPF in the world reached hundreds of thousands of tons in 2018, mainly concentrated in developed countries and regions in North America, Europe, and Asia. As a key chemical industrial raw material, BPF has been widely used in the production of food can linings, coatings, adhesives, and electronic products. However, exposure to BPF can have negative effects on organisms, such as health risks faced by children and reproductive damage to aquatic organisms. At present, BPF residues have been detected in environmental samples such as wastewater from industrial and urban sewage treatment plants and landfill leachate. Bioremediation technology has become a green and sustainable method for treating this type of emerging pollutants, with the advantages of safety, high efficiency, and no secondary pollution. Bioremediation technology mainly uses microorganisms, plants, or enzymes to degrade or remove pollutants in the environment. In recent years, researchers have isolated an increasing number of BPF-degrading bacteria. Pseudomonas , Sphingobium and Bacillus However, there are no reports on genes and enzymes for BPF degradation, which seriously restricts the research on the environmental behavior and ecological safety of BPF. Therefore, it is necessary to further study the microbial degradation pathway and mechanism of BPF to enhance our understanding of the biodegradation mechanism of BPF and provide guidance for the effective remediation of BPF-contaminated environment.

[0003] Obtaining BPF-degrading strains and degradation genes has the following functions in the treatment of BPF accumulated in the environment: (1) It is used to eliminate BPF in soil and water bodies; (2) It is of great significance to construct recombinant strains through modern bioengineering technology and then study the enzymatic characteristics for BPF pollution remediation. In summary, the research on degradation genes and enzymes in the process of BPF degradation has very important theoretical and practical application value. Summary of the invention

[0004] The purpose of the present invention is to provide a bisphenol F degradation gene cluster bpf and its application to solve the deficiencies of the existing technology.

[0005] The purpose of the present invention is achieved through the following technical solutions: The first aspect of the present invention provides a bisphenol F degradation gene cluster bpf , whose nucleotide sequence is shown in SEQ ID NO.9, and can be used to degrade bisphenol F.

[0006] The second aspect of the present invention provides the bisphenol F degradation gene cluster bpf recombinant vector or recombinant microorganism.

[0007] The third aspect of the present invention provides the bisphenol F degradation gene cluster bpf Application in the degradation of bisphenol F.

[0008] The fourth aspect of the present invention provides a two-component oxidase gene bpfAB , which includes genes bpfA and genes bpfB , the gene bpfA The nucleotide sequence of the gene is shown in SEQ ID NO.10. bpfB The nucleotide sequence is shown in SEQ ID NO.12.

[0009] The fifth aspect of the present invention provides the above-mentioned two-component oxidase gene bpfAB The genes encoding the two-component oxidase BpfAB include bpfA Protein BpfA and gene encoding bpfB The encoded protein BpfB, the amino acid sequence of the protein BpfA is shown in SEQ ID NO.11, and the amino acid sequence of the protein BpfB is shown in SEQ ID NO.13.

[0010] The sixth aspect of the present invention provides a method comprising the above-mentioned two-component oxidase gene bpfAB recombinant vector or recombinant microorganism.

[0011] The seventh aspect of the present invention provides a monooxygenase gene bpfC , whose nucleotide sequence is shown in SEQ ID NO.14.

[0012] The eighth aspect of the present invention provides the monooxygenase gene bpfC The encoded monooxygenase BpfC has an amino acid sequence as shown in SEQ ID NO.15.

[0013] The ninth aspect of the present invention provides a method comprising the monooxygenase gene bpfC recombinant vector or recombinant microorganism.

[0014] The tenth aspect of the present invention provides a hydrolase gene bpfD , whose nucleotide sequence is shown in SEQ ID NO.16.

[0015] The eleventh aspect of the present invention provides the hydrolase genebpfD The encoded hydrolase BpfD has an amino acid sequence as shown in SEQ ID NO.17.

[0016] The twelfth aspect of the present invention provides a method comprising the hydrolase gene bpfD recombinant vector or recombinant microorganism.

[0017] The thirteenth aspect of the present invention provides the use of any one or more of the following substances 1) to 3) in the degradation of bisphenol F: 1) The above two-component oxidase gene bpfAB ; 2) The above monooxygenase genes bpfC ; 3) The above hydrolase genes bpfD .

[0018] The fourteenth aspect of the present invention provides the use of any one or more of the following 1)-3) substances in the degradation of bisphenol F: 1) the above-mentioned two-component oxidase BpfAB; 2) the above-mentioned monooxygenase BpfC; 3) The above-mentioned hydrolase BpfD.

[0019] Beneficial effects of the present invention: 1. The present invention isolated strain DN12, which is capable of degrading BPF and growing with BPF as the sole carbon and energy source. Based on this, the present invention obtained a BPF degradation gene cluster from strain DN12 using whole genome and comparative transcriptome sequencing analysis. bpf Three different degradation enzymes (two-component oxidase BpfAB, monooxygenase BpfC, and hydrolase BpfD) were found in this gene cluster, which can catalyze the stepwise degradation of BPF to produce a simple aromatic ring compound, p-hydroxybenzoic acid.

[0020] 2. BPF degradation gene cluster provided by the present invention bpf 0.2 mM BPF can be completely degraded within 7 hours. In addition, the optimal activity temperature of the two-component oxidase BpfAB is 55°C and the optimal activity pH is 8; the optimal activity temperature of the monooxygenase BpfC is 40°C and the optimal activity pH is 8; the optimal activity temperature of the hydrolase BpfD is 40°C and the optimal activity pH is 9-9.5. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Figure 1 is the identification diagram of strain DN12, A is the colony photo of strain DN12, B is the microscopic photo of strain DN12, and C is the phylogenetic tree of strain DN12 constructed based on the 16S rRNA gene sequence.

[0022] Figure 2The degradation and growth of BPF by strain DN12.

[0023] Figure 3 Liquid chromatogram of BPF degradation by strain DN12 (A); BPF degradation pathway in strain DN12 (B).

[0024] Figure 4 Gene cluster bpf Diagram of the heterologous expression strategy.

[0025] Figure 5 For strain B2 (pBBR- bpf ) Liquid chromatogram of BPF degradation.

[0026] Figure 6 The SDS-PAGE images of oxidase BpfAB (Figure A), monooxygenase BpfC (Figure B) and hydrolase BpfD (Figure C). Lane M in A, protein marker; lane 1, BpfAB crude enzyme solution; lane 2, BpfAB crude enzyme penetration solution; lanes 3, 4, 5, 6 and 7 are 10, 30, 50, 75, 100 mM imidazole eluents, respectively; lane M in B, protein marker; lane 1, BpfC crude enzyme solution; lanes 2, 3, 4, 5 and 6 are 10, 30, 50, 75, 100 mM imidazole eluents, respectively; lane M in C, protein marker; lane 1, BpfD crude enzyme solution; lanes 2, 3, 4, 5 and 6 are 10, 30, 50, 75, 100 mM imidazole eluents, respectively.

[0027] Figure 7 Effects of temperature and pH on the activity of the two-component oxidase BpfAB.

[0028] Figure 8 Effects of temperature and pH on the activity of monooxygenase BpfC.

[0029] Figure 9 Effects of temperature and pH on the activity of hydrolase BpfD. Biomaterial Deposit Information

[0030] strain DN12, classified as Sphingobium yanoikuyae DN12 is deposited in the China Center for Type Culture Collection, with the deposit address at Wuhan University, Wuhan, China. The deposit date is March 6, 2025, and the deposit number is CCTCCNO: M 2025387.

[0031] strain B2, classified as Sphingobium sp. B2, deposited in China Center for Type Culture Collection, Wuhan University, Wuhan, China, on October 16, 2018, with the deposit number CCTCC NO: M2018684. DETAILED DESCRIPTION

[0032] The present invention is further explained below in conjunction with the examples and drawings. The following examples are only used to illustrate the present invention, but are not intended to limit the scope of the present invention.

[0033] The culture medium formulas involved in the following examples are as follows: Inorganic salt liquid medium (hereinafter referred to as MSM), 1L system formula: NaCl 1.0 g, NH4Cl 1.0 g, K2HPO4 1.5 g, KH2PO4 0.5 g, MgSO4•7H2O 0.2 g, ultrapure water to 1 L, sterilized at 121℃ for 20 min. pH 7.0.

[0034] LB liquid medium, 1L system formula: NaCl 5.0 g, yeast powder 5.0 g, tryptone 10.0 g, ultrapure water to 1L, sterilized at 121℃ for 20 min. pH is 7.0. LB medium is added on this basis 15 g agar powder.

[0035] Example 1 Degradation and growth experiment of strain DN12 on BPF A BPF-degrading bacterium was isolated and screened from river sediments through pressure acclimation of BPF and named DN12. Strain DN12 was cultured on LB medium at 30°C for 2-3 days, and the colonies were yellow, round and smooth ( Figure 1 A in the figure), Gram-negative, rod-shaped cells with a size of 0.5-0.7 μm × 1.7-2.0 μm ( Figure 1 B in the figure). Phylogenetic tree constructed based on 16S rRNA gene sequences ( Figure 1 C) The results of comparative analysis showed that strain DN12 and Sphingobium yanoikuyae ATCC 51230 T and Sphingobium scionense WP01 T The closest relationship is between DN12 and DN13, with 16S rRNA gene homology of 100% and 99.1%, respectively. Combining the phylogenetic tree analysis results constructed by 16S rRNA gene sequence and colony morphology, strain DN12 was identified as Sphingobium yanoikuyae The strain DN12 has been deposited in China Center for Type Culture Collection with the deposit number CCTCC NO: M 2025387.

[0036] Pre-culture of strains: Inoculate strain DN12 into LB liquid medium, culture at 30°C and 180 rpm until mid-logarithmic phase, centrifuge at 6000 rpm for 8 min, collect the cells, wash them twice with MSM, and resuspend them in MSM to obtain the DN12 seed solution. 600 About 0.1 was inoculated in 20 mL of MSM with a final concentration of 0.2 mM BPF (BPF stock solution concentration of 20 mM, methanol was used as the solvent, and a total of 200 μL BPF stock solution was added) as the experimental group (DN12+BPF group). 20 mL of MSM with a final concentration of 0.2 mM BPF (BPF stock solution concentration of 20 mM, methanol was used as the solvent, and a total of 200 μL BPF stock solution was added) was used as the negative control group (BPF group). The DN12 seed solution was inoculated at an initial inoculum of OD 600 About 0.1 was inoculated into 20 mL of MSM supplemented with 200 μL of methanol as the positive control group. Each group was cultured at 30°C and 180 rpm with shaking, and 1 mL of samples were collected at 0, 1, 2, 3, 4, 5, and 6 h. The bacterial growth was measured by UV spectrophotometer, and BPF was quantitatively analyzed by HPLC. The specific operation was as follows: Take 500 μL of sample, add an equal volume of methanol, centrifuge at 12000 rpm for 5 min, filter the supernatant with a 0.22 μm filter membrane, and then perform HPLC analysis. The chromatographic conditions for HPLC detection of BPF concentration are as follows: the chromatographic column is Agilent ZORBAX SB C18 (specifications: 250 mm × 4.6 mm × 5 μm); the mobile phase is methanol: 0.5 v / v% acetic acid water (v: v = 60: 40); the flow rate is 1.0 mL min -1 ; detection wavelength is 230 nm; column temperature is 35°C; injection volume is 20 μL. Take 500 μL sample and detect it with UV spectrophotometer at 600 nm. The results are as follows Figure 2 As shown, strain DN12 can degrade 0.2 mM BPF within 6 h. At the same time, the biomass of strain DN12 grows from about 0.1 to about 0.14, indicating that strain DN12 can use BPF as the sole carbon source and energy source for growth.

[0037] Example 2 Analysis of BPF degradation pathway in strain DN12 and cloning and functional verification of BPF degradation gene cluster 2.1 Analysis of BPF degradation pathways After strain DN12 was induced by substrate BPF, the degradation efficiency of BPF increased significantly. Therefore, we searched for target genes by whole genome and comparative transcriptome sequencing analysis. Comparative transcriptome sequencing analysis showed that 73 transcripts in strain DN12 were significantly upregulated, accounting for about 1.3% of the total transcripts, of which 48 transcripts were more than 4 times more transcribed in BPF-induced cells than in uninduced cells. Among these 48 transcripts, we predicted a BPF degradation gene cluster bpf (which is located on the plasmid with accession number CP173718 in the genome of strain DN12), whose nucleotide sequence is shown in SEQ ID NO.9, and contains a two-component oxidase gene bpfAB (Two-component oxidase gene bpfAB Including genes bpfA and genes bpfB ,Gene bpfA The nucleotide sequence of the gene is shown in SEQ ID NO.10, and the amino acid sequence of the encoded protein BpfA is shown in SEQ ID NO.11; bpfB The nucleotide sequence is shown in SEQ ID NO.12, and the amino acid sequence of the encoded protein BpfB is shown in SEQ ID NO.13) 、 A monooxygenase gene bpfC (monooxygenase gene bpfC The nucleotide sequence is shown in SEQ ID NO.14, and the amino acid sequence of the encoded monooxygenase BpfC is shown in SEQ ID NO.15) and a hydrolase gene bpfD (Hydrolase gene bpfD The nucleotide sequence is shown in SEQ ID NO.16, and the amino acid sequence of the encoded hydrolase BpfD is shown in SEQ ID NO.17).

[0038] HPLC was used to analyze the samples of BPF degradation by strain DN12. First, HPLC results showed that strain DN12 degraded BPF to produce three main metabolites: M1, M2 and M3 ( Figure 3 A in the figure). We purchased possible metabolite standards through the reported BPF metabolic pathway. Through the chromatogram analysis of the three metabolites and the standards, we speculated that metabolite M1 was dihydroxybiphenyl (4,4'-dihydroxybenzophenone, DHBP), M2 was 4-hydroxyphenyl 4-hydroxybenzoate (4-hydroxyphenyl 4-hydroxybenzoate, HPHB), and M3 was p-hydroxybenzoic acid (4-hydroxybenzoate, 4HB) ( Figure 3A in the figure). Combined with the predicted degradation gene functions, a biodegradation pathway for BPF was inferred. BPF is first oxidized to DHBP by the two-component oxidase BpfAB (the intermediate product is bis(4-hydroxyphenyl)methanol), then undergoes Baeyer-Villiger oxidation reaction through the monooxygenase BpfC to generate HPHB, which is then hydrolyzed to 4HB and hydroquinone (1,4-hydroquinone, HQ) by the hydrolase BpfD, and finally enters the classic aromatic ring opening pathway ( Figure 3 B in the figure).

[0039] 2.2 BPF degradation gene cluster bpf Heterologous expression of Using primers pBBR1- bpf _F and pBBR1- bpf _R amplification of the BPF degradation gene cluster bpf Fragment (strategy see Figure 4 ).

[0040] Forward primer pBBR1- bpf _F: AACAAAAGCTGGGTACC GGGCCC GGAGAGGAGAACCCGTCATGGCACGGA (SEQ ID NO. 1); Reverse primer pBBR1- bpf _R: TCACTATAGGGCGAATTG GAGCTC AGAACTTGGCGCCAACCT (SEQ ID NO. 2); the underline indicates the restriction site sequence.

[0041] Amplification program: stage 1, preliminary denaturation at 95°C (3 min); stage 2, denaturation at 95°C (15 s), annealing at 57°C (15 s), extension at 72°C (5 min), 30 cycles; stage 3, final extension at 72°C (5 min).

[0042] The pBBR1MCS-2 plasmid was digested with restriction endonucleases Apa I and Sac I at 30 °C for 2 h, and then the PCR-amplified gene fragment was ligated into the linearized pBBR1MCS-2 plasmid using homologous recombination to obtain the recombinant plasmid pBBR- bpf These recombinant plasmids pBBR- bpf Convert to E.coli In DH5α cells, positive clones were selected ( E. coli (pBBR- bpf )) and then with the helper strainE. coli HB101 (pRK2013) was transformed into the recombinant plasmid pBBR- bpf Import to Sphingobium sp. B2 (accession number: CCTCC NO: M2018684), and obtained the heterologous expression strain, namely the recombinant strain B2 (pBBR- bpf HPLC was used to evaluate the degradation efficiency of BPF by heterologous expression strains. The recombinant strain B2 (pBBR- bpf ) was inoculated into LB liquid medium and cultured until the exponential phase, 2 mL of bacterial solution was inoculated into 20 mL of MSM supplemented with a final concentration of 0.2 mM BPF, and samples were collected at 0 h and 7 h, respectively, and detected by HPLC (detection method was the same as in Example 1). The results are shown in Figure 5 As shown in Figure 2, the retention time of BPF was 4.8 min, and the recombinant strain B2 (pBBR- bpf ) can completely degrade BPF in 7 h. The above results indicate that the BPF degradation gene is located in the putative BPF degradation gene cluster bpf In this study, combined with the gene function annotation in this cluster and the results of the BPF metabolic pathway, it was speculated that the BPF degradation gene may be a two-component oxidase gene. bpfAB , monooxygenase gene bpfC , hydrolase bpfD .

[0043] Example 3 Purification and activity determination of BPF degrading enzyme 3.1 Purification of the two-component oxidase BpfAB 3.1.1 Construction of recombinant vectors and recombinant strains Connected with 6×His-Tag bpfAB Primers for amplification of gene fragments: Forward Primer bpfAB _F: AGAAGGAGATATA CATATG CACCACCACCACCACCACCCCCTATCTGTCGCCGAG (SEQ ID NO.3); Reverse primer bpfAB _R: GTGGTGGTGGTG CTCGAG TCATGGCTTGGGCTCCACAA (SEQ ID NO. 4); the underline indicates the restriction site sequence.

[0044] Two primers specifically amplify bpfAB Gene fragment.

[0045] Amplification program: stage 1, preliminary denaturation at 95°C (3 min); stage 2, denaturation at 95°C (15 s), annealing at 57°C (15 s), extension at 72°C (1 min), 30 cycles; stage 3, final extension at 72°C (5 min).

[0046] The pET-29a (+) overexpression plasmid was digested with restriction endonucleases Nde I and Xho I at 37 °C for 2 h, and then the amplified gene fragment was ligated into the linearized plasmid pET-29a (+) using homologous recombination to obtain the recombinant plasmid pET- bpfAB These recombinant plasmids were transformed into E.coli BL21 (DE3) cells, and positive clones were selected for further experiments. The recombinant strain was named E.coli BL21 (pET- bpfAB ).

[0047] 3.1.2 Expression and purification of BpfAB The recombinant strain E.coli BL21 (pET- bpfAB ) was added to LB liquid medium containing 50 mg / L kanamycin (Km) and cultured at 37°C and 180 rpm until the cell density reached 0.6-0.8 (OD 600 ), add IPTG with a final concentration of 0.5 mM, culture at 16°C and 180 rpm for 12 h to induce protein expression, then centrifuge at 12000 rpm for 8 min, collect the cells, wash them twice with 1×PBS (pH 7.2; obtained by dilution with 10×PBS, the same below), resuspend the cells with 15 mL of 1×PBS (pH7.2), ultrasonically disrupt them at 550W for 10 min (break for 1 s, pause for 2 s), centrifuge at 4°C and 12000 rpm for 30 min, collect the supernatant, purify BpfAB with a nickel ion affinity chromatography column, and perform SDS-PAGE detection on the purified enzyme. The results showed that the size of the obtained band was about 58 kDa, which was consistent with the theoretical value of BpfA (the gel image is a fragment of BpfA, BpfB is a cytochrome C, which is an electron acceptor, the fragment is smaller, and the gel image is not obvious), and can be used for further experiments ( Figure 6 A in the figure).

[0048] 3.1.3 BpfAB activity assay In order to determine the optimal reaction temperature of BpfAB, its catalytic efficiency was evaluated in the temperature range of 10-70℃. The enzyme activity reaction system of BpfAB (500 µL): in 500 µL 1×PBS (pH 7.2) containing 0.1 mM flavin adenine dinucleotide (FAD), 0.2 mM phenazine methyl sulfate (PMS), 0.137 μM BpfAB and 0.2 mM BPF; the reaction was carried out at 10℃, 20℃, 30℃, 40℃, 45℃, 50℃, 55℃, 60℃, 65℃, and 70℃ for 10 min, and the activity of BpfAB was determined. After the reaction, the enzyme reaction solution was boiled for 3 min, an equal volume of methanol was added, and centrifuged at 12000 rpm for 5 min. The supernatant was filtered with a 0.22 μm filter membrane, and the degradation of BPF was detected by HPLC. The results showed that the optimal reaction temperature for BpfAB to catalyze the degradation of BPF was 55℃ ( Figure 7 Left).

[0049] At the optimal reaction temperature of BpfAB, the optimal pH value was determined using buffers with a pH range of 3.5-10.5: 50 mM sodium acetate (pH 3.5-6.0), 50 mM PBS (pH 5.5-8.0), 50 mM Tris-HCl (pH 7.5-9.0) and 50 mM glycine-NaOH (pH 8.5-10.5). Enzyme activity reaction system (500 µL): In 500 µL of the corresponding pH buffer (pH 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5) containing 0.1 mM FAD, 0.2 mM PMS, 0.137 μM BpfAB and 0.2 mM BPF; react at 55℃ for 10 min to determine the activity of BpfAB. After the reaction, the enzyme reaction solution was boiled for 3 min, an equal volume of methanol was added, and centrifuged at 12000 rpm for 5 min. The supernatant was filtered using a 0.22 μm filter membrane, and the degradation of BPF was detected by HPLC. The results showed that the optimal reaction pH for BpfAB-catalyzed BPF degradation was 8 ( Figure 7 right).

[0050] 3.2 Purification of monooxygenase BpfC 3.2.1 Construction of recombinant vectors and recombinant strains Connected with 6×His-Tag bpfC Primers for amplification of gene fragments: Forward primer bpfC_F: TAAGAAGGAGATATA CATATG AGCGGCAACGACCGTG (SEQ ID NO.5); Reverse primer bpfC_R: TCAGTGGTGGTGGTGGTGGTG CTCGAG CTGCACGCTCTCCGCAAA (SEQ ID NO.6); the underline indicates the restriction site sequence.

[0051] Two primers specifically amplify bpfC Gene fragment. Amplification procedure is the same as 3.1.1.

[0052] The specific amplification bpfC The gene fragments were constructed according to 3.1.1 for the construction of recombinant vectors and recombinant strains to obtain E. coli BL21 (pET- bpfC ).

[0053] 3.2.2 Expression and purification of BpfC The expression and purification of BpfC were the same as in 3.1.2. SDS-PAGE analysis showed that the obtained band size was about 46 kDa, which was consistent with the theoretical value of BpfC and could be used for further experiments ( Figure 6 B in the figure).

[0054] 3.2.3 BpfC activity assay In order to determine the optimal reaction temperature of BpfC, its catalytic efficiency was evaluated in the temperature range of 10-70℃. The enzyme activity reaction system of BpfC (500 µL): in 500 µL 1×PBS (pH 7.2) containing 0.02 mM FAD, 0.4 mM nicotinamide adenine dinucleotide phosphate (NADPH), 0.218 μM BpfC and 0.2 mM DHBP; the reaction was carried out at 10℃, 20℃, 25℃, 30℃, 35℃, 40℃, 45℃, 50℃, 60℃, and 70℃ for 15 min, and the activity of BpfC was determined. After the reaction, the enzyme reaction solution was boiled for 3 min, an equal volume of methanol was added, and centrifuged at 12000 rpm for 5 min. The supernatant was filtered with a 0.22 μm filter membrane, and the degradation of DHBP was detected by HPLC. The results showed that the optimal reaction temperature for BpfC to catalyze the degradation of DHBP was 40℃ ( Figure 8 Left).

[0055] At the optimal reaction temperature of BpfC, use the corresponding buffer in 3.1.3 to determine its optimal pH value. Enzyme activity reaction system (500 µL): In 500 µL of corresponding pH buffer (pH 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, respectively) containing 0.02 mM FAD, 0.4 mM NADPH, 0.022 μM BpfC and 0.1 mM DHBP; react at 40°C for 90 min, and measure the activity of BpfC. After the reaction, boil the enzyme reaction solution for 3 min, add an equal volume of methanol, centrifuge at 12000 rpm for 5 min, filter the supernatant with a 0.22 μm filter membrane, and use HPLC to detect the degradation of BPF. The results showed that the optimal reaction pH for BpfC to catalyze the degradation of BPF was 8 ( Figure 8 right).

[0056] 3.3 Purification of hydrolase BpfD 3.3.1 Construction of recombinant vectors and recombinant strains Connected with 6×His-Tag bpfD Primers for amplification of gene fragments: Forward Primer bpfD _F: TAAGAAGGAGATATA CATATG ACCGAACGGTTCGTGCCTGAATGGA (SEQ ID NO.7); Reverse primer bpfD _R: TCAGTGGTGGTGGTGGTGGTG CTCGAG TCGAGATACCTCTTTCTG (SEQ ID NO. 8); the underline indicates the restriction site sequence.

[0057] Two primers specifically amplify bpfD Gene fragment. Amplification procedure is the same as 3.1.1.

[0058] The specific amplification bpfD The gene fragments were constructed according to 3.1.1 for the construction of recombinant vectors and recombinant strains to obtain E. coli BL21 (pET- bpfD ).

[0059] 3.3.2 Expression and purification of BpfD The expression and purification of BpfD was the same as in 3.1.2. SDS-PAGE analysis showed that the obtained band size was about 33 kDa, which was consistent with the theoretical value of BpfD and could be used for further experiments ( Figure 6 C in.

[0060] 3.3.3 BpfD activity assay In order to determine the optimal reaction temperature of BpfD, its catalytic efficiency was evaluated in the temperature range of 10-70°C. The enzyme activity reaction system of BpfD (500µL): in 500 µL 1×PBS (pH 7.2) containing 0.021 μM BpfD and 0.2 mM HPHB; react at 10°C, 20°C, 25°C, 30°C, 35°C, 40°C, 45°C, 50°C, 60°C, and 70°C for 5 min to measure the activity of BpfD. After the reaction, the enzyme reaction solution was boiled for 3 min, an equal volume of methanol was added, centrifuged at 12000 rpm for 5 min, the supernatant was filtered with a 0.22 μm filter membrane, and the degradation of HPHB was detected by HPLC. The results showed that the optimal reaction temperature for BpfD to catalyze the degradation of HPHB was 40°C ( Figure 9 Left).

[0061] Use the corresponding buffer in 3.1.3 to determine its optimal pH value. Enzyme activity reaction system (500 µL): In 500 µL of the corresponding pH buffer (pH 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, respectively) containing 0.021 μM BpfD and 0.2 mM HPHB; react at 30°C for 5 min, and measure the activity of BpfD. After the reaction, boil the enzyme reaction solution for 3 min, add an equal volume of methanol, centrifuge at 12000 rpm for 5 min, filter the supernatant with a 0.22 μm filter membrane, and use HPLC to detect the degradation of BPF. The results showed that the optimal reaction pH for BpfD-catalyzed HPHB degradation was 9-9.5 ( Figure 9 right).

Claims

1. Bisphenol F degradation gene cluster bpf , characterized in that, The nucleotide sequence thereof is shown in SEQ ID NO.9, and the compound can be used for degrading bisphenol F.

2. A bisphenol F degradation gene cluster comprising the bisphenol F degradation gene cluster according to claim 1 bpf recombinant vector or recombinant microorganism.

3. The bisphenol F degradation gene cluster according to claim 1 bpf Application in the degradation of bisphenol F.

4. Two-component oxidase genes bpf , characterized in that, It includes genes bpfA and genes Bf , the gene bpfA The nucleotide sequence of the gene is shown in SEQ ID NO.

10. Bf The nucleotide sequence is shown in SEQ ID NO.

12.

5. The two-component oxidase gene according to claim 4 bpf The encoded two-component oxidase BpfAB is characterized in that Including genes bpfA Protein BpfA and gene encoding Bf The encoded protein BpfB, the amino acid sequence of the protein BpfA is shown in SEQ ID NO.11, and the amino acid sequence of the protein BpfB is shown in SEQ ID NO.

13.

6. A method comprising the two-component oxidase gene according to claim 4 bpf recombinant vector or recombinant microorganism.

7. Monooxygenase genes BfC , characterized in that, Its nucleotide sequence is shown in SEQ ID NO.

14.

8. The monooxygenase gene according to claim 7 BfC The encoded monooxygenase BpfC is characterized in that Its amino acid sequence is shown in SEQ ID NO.

15.

9. A composition comprising the monooxygenase gene according to claim 7. BfC recombinant vector or recombinant microorganism.

10. Hydrolase genes BfD , characterized in that, Its nucleotide sequence is shown in SEQ ID NO.

16.

11. The hydrolase gene according to claim 10 BfD The encoded hydrolase BpfD is characterized in that Its amino acid sequence is shown in SEQ ID NO.

17.

12. A method comprising the hydrolase gene according to claim 10. BfD recombinant vector or recombinant microorganism.

13. Use of any one or more of the following 1)-3) in the degradation of bisphenol F: 1) The two-component oxidase gene according to claim 4 bpf ; 2) The monooxygenase gene according to claim 7 BfC ; 3) The hydrolase gene according to claim 10 BfD .

14. Use of any one or more of the following 1)-3) in the degradation of bisphenol F: 1) The two-component oxidase BpfAB according to claim 5; 2) The monooxygenase BpfC according to claim 8; 3) The hydrolase BpfD according to claim 11.

Images