circApbb1 molecules, siRNA targeting circApbb1 expression, adeno-associated virus vectors, preparation methods, and applications

Abstract

The present invention discloses circApbb1 molecules, siRNA targeting circApbb1 expression, adeno-associated virus vectors, preparation methods and applications, belonging to the field of molecular biology applications. A siRNA capable of knocking down circApbb1 expression was designed, and an adeno-associated virus vector HBAAV2 / 9‑cTNT‑mir30‑circApbb1Green of the siRNA was constructed. Detection showed that circApbb1 was significantly upregulated in the hearts of mice with atherosclerosis. The prepared siRNA adeno-associated virus vector can effectively reduce the expression of circApbb1 in the mouse heart, reduce the area of ​​atherosclerotic plaques, inhibit the progression of atherosclerosis and improve cardiac function, thus realizing the use of circApbb1 to treat atherosclerosis, providing an important supplement to the biological function of circApbb1, and providing a new technical means for the treatment of atherosclerosis.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology applications, and in particular to circApbb1 molecules, siRNA targeting circApbb1 expression, adeno-associated virus vectors, preparation methods and applications. Background Art

[0002] Atherosclerosis (AS) is an important pathological basis for the development of cardiovascular diseases such as coronary heart disease, myocardial infarction, and heart failure. It is considered a chronic, complex disease caused by the interaction of multiple factors. Its main characteristics include the accumulation of subendothelial lipids and the formation of atherosclerotic plaques. The pathogenesis of atherosclerosis is very complex, and genetic, epigenetic, and environmental factors also play an important role in the occurrence and development of atherosclerosis. Studies have shown that hypercholesterolemia can cause cardiac pathological remodeling, ultimately leading to impaired cardiac contractile function. Therefore, there is an urgent need to find effective treatments to address this serious health problem.

[0003] Circular RNA (circRNA) is a non-coding RNA molecule with a circular structure that is ubiquitous in eukaryotes. Due to its closed covalent structure and resistance to exonucleases, circRNA is more stable than linear RNA. In recent years, the rapid development and application of high-throughput sequencing technologies have enabled the isolation and identification of circRNAs. More circRNAs have been discovered and shown to be associated with the pathophysiological processes of various cardiovascular diseases. However, their specific mechanisms of action remain unclear. Therefore, screening and validating a novel circRNA and applying it to the diagnosis and treatment of atherosclerosis could provide a new diagnostic and therapeutic target for atherosclerosis at the RNA level. Summary of the Invention

[0004] To solve the above technical problems, the present invention aims to provide circApbb1 molecules, siRNA targeting circApbb1 expression, adeno-associated virus vectors, preparation methods and applications. By designing circApbb1 siRNA and constructing the siRNA adeno-associated virus vector HBAAV2 / 9-cTNT-mir30-circApbb1 Green, the formation of atherosclerosis is intervened, and circApbb1 is used to treat atherosclerosis.

[0005] To achieve the above object, the first aspect of the present invention provides:

[0006] A circular non-coding RNA circApbb1 molecule, wherein the nucleotide sequence of circApbb1 is shown in SEQ ID NO.1:

[0007] ATTCCTTCTGGAACCCCAACGCTTTCGAGACGGATTCCGATCTACCGGCTGGATGGATGAGGGTACAGGACACCTCAGGGACCTACTACTGGCACATCCCAACAGGGACCACCCAGTGGGAACCCCCAGGCCGGGCCTCCCCCTCACAGGGGAGCAGCCCCCAAGAAGAGTCCCAGCTCACCTGGACTGGCTTTGCTCACCAAGAAGGCTTTGAGGAAGGAGAGTTTTGGAAGGATGAACCCAGTGAGGAGGCCCCAATGGAGTTGGGACTGAAGGACCCCGAGGAGGCGACATTGTCCTTCCCAGCTCAGAGCCTCAGCCCAGAACCAGTTCCCCAGGAGGAAGAGAAGCTGTCCCAACGGAATGCCAACCCAGGGATCAAGTGTTTCGCTGTGCGCTCCCTAGGCTGGGTAGAGATGACCGAGGAGGAGCTGGCCCCAGGACGCAGCAGTGTGGCAGTCAACAATTGTATCCGCCAGCTCTCCTACCACAAAAACAATCTACATGATCCGATGGCTGGGGGCTGGGGAGAGGGAAAGGATCTGCTGCTCCAGCTGGAGGACGAGACTCTAAAGTTGGTGGAGCCACAGAACCAGACGCTGCTGCATGCACAGCCCATCGTCAGCATTCGTGTGTGGGGCGTTGGGCGGGACAGTGGAAGGGACTTTGCCTACGTAGCTCGAGATAAGCTGACCCAGATGCTCAAGTGCCACGTGTTTCGCTGTGAGGCACCTGCCAAGAACATCGCCACCAGCCTGCATGAGATCTGCTCCAAGATCATGTCTGAACGGCGCAATGCTCGCTGCTTGGTCAATGGACTCTCCCTAGACCACTCTAAACTCGTGGATGTCCCTTTCCAAGTGGAATTCCCAGCACCAAAGAATGAGCTGGTGCAGAAGTTCCAAGTCTATTACCTGGGAAATGTGCCAGTTGCTAAACCTGTTG。 <了

[0008] The second aspect of the present invention provides:

[0009] The invention relates to the use of the circular non-coding RNA circApbb1 molecule in the preparation of a drug for treating atherosclerosis.

[0010] The circApbb1 was significantly upregulated in the hearts of atherosclerotic mice, causing cardiac function damage and arterial plaque formation.

[0011] A third aspect of the present invention provides:

[0012] An siRNA targeting circApbb1 expression, characterized by comprising a sense strand and an antisense strand, wherein the sequence of the sense strand is shown in SEQ ID NO.4:

[0013] GCAGTGTGGCAGTCAACAATT.

[0014] The antisense strand sequence is shown in SEQ ID NO.5:

[0015] AATTGTTGACTGCCACACTGC.

[0016] A fourth aspect of the present invention provides:

[0017] An adeno-associated virus vector containing the siRNA is obtained by cloning the siRNA into a vector (pHBAAV-cTNT-MCS-Green) to obtain an adeno-associated virus vector of the siRNA (HBAAV2 / 9-cTNT-mir30-circApbb1-Green).

[0018] A fifth aspect of the present invention provides:

[0019] The invention relates to the use of the adeno-associated virus vector in the preparation of a medicine for treating atherosclerosis.

[0020] Preferably, the adeno-associated virus vector can reduce the expression level of circApbb1 in the heart of atherosclerotic mice, reduce the area of ​​atherosclerotic plaques, inhibit the progression of atherosclerosis and improve heart function.

[0021] Preferably, the adeno-associated virus vector can improve cardiac function indicators including: end-systolic ventricular septum thickness, end-systolic left ventricular posterior wall thickness, end-systolic left ventricular internal diameter, ejection fraction, fractional shortening and aortic blood pressure.

[0022] A sixth aspect of the present invention provides:

[0023] A preparation method for constructing the siRNA adeno-associated virus vector comprises the following steps:

[0024] a) vector digestion;

[0025] b) obtaining the target fragment;

[0026] c) PCR amplification of the target fragment;

[0027] d) connecting the target fragment to the vector;

[0028] e) transforming into competent cells;

[0029] f) PCR identification of bacterial liquid;

[0030] g) Sequencing verification;

[0031] h) Plasmid extraction.

[0032] A seventh aspect of the present invention provides:

[0033] A method for packaging an adeno-associated virus (AAV) comprises transfecting AAV-293 cells with a three-plasmid system (a shuttle plasmid (carrying siRNA), a pAAV-RC vector plasmid, and a pHelper vector plasmid), disrupting the cells, collecting the lysis supernatant containing AAV particles, and performing purification and quality testing to obtain the AAV.

[0034] An eighth aspect of the present invention provides:

[0035] A pharmaceutical composition for treating atherosclerosis comprises an effective dose of the siRNA or the expression vector, and a pharmaceutically acceptable carrier or excipient.

[0036] The present invention has the following beneficial effects:

[0037] This study demonstrates that circApbb1 is highly expressed in atherosclerotic myocardial tissue. A siRNA targeting circApbb1 was designed and an adeno-associated viral vector (AAV) encoding the siRNA, HBAAV2 / 9-cTNT-mir30-circApbb1-Green, was constructed. Testing showed that this AAV vector, constructed with the siRNA, could knock down circApbb1 expression, reduce aortic root and aortic plaque area in mice, lower body weight, inhibit atherosclerosis progression, and improve cardiac function. This provides an important supplement to the biological function of circApbb1 and offers a new technical approach for the treatment of atherosclerosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 This is a comparison of the expression results of circApbb1 in atherosclerotic myocardial tissue and control myocardial tissue detected by qRT-PCR.

[0039] Figure 2This is a comparison of the relative expression levels of RNA after digestion of circApbb1 and mApbb1 with RNase R.

[0040] Figure 3 This is the Oil Red staining and plaque area changes of the aortic root and aorta of mice after circApbb1 knockdown.

[0041] Figure 4 This is a diagram showing changes in cardiac function in mice after circApbb1 knockdown. DETAILED DESCRIPTION

[0042] In order to enable those skilled in the art to more clearly understand the technical solutions of the present invention, the technical solutions will be clearly and completely described below in conjunction with specific embodiments. The described embodiments are only part of the embodiments of the present invention and are not intended to be exhaustive. Specific conditions are not specified in the following examples, and are generally implemented under conventional conditions or under conditions recommended by the manufacturer.

[0043] circApbb1 (mmu_circRNA_42044) is located at chr7:105564972-105567753 on the genome, with a circular sequence length of 945 base pairs. circApbb1 is expressed in both human and mouse hearts. To date, there have been no studies or reports on the use of circApbb1 in the treatment of atherosclerosis.

[0044] Therefore, the present invention mainly provides circApbb1 molecules, siRNA targeting circApbb1 expression, adeno-associated virus vectors, preparation methods and applications. By designing circApbb1 siRNA and constructing the siRNA adeno-associated virus vector HBAAV2 / 9-cTNT-mir30-circApbb1 Green, the formation of atherosclerosis is intervened, and circApbb1 is used to treat atherosclerosis.

[0045] The main materials and reagents used in the present invention are shown in Table 1:

[0046] Table 1 Main materials and reagents

[0047]

[0048] Table 2 Experimental instruments

[0049]

[0050]

[0051] Example 1: Analysis of circApbb1 expression levels in atherosclerotic myocardial tissue

[0052] In this example, circApbb1 expressed in four species, namely human, mouse, rat, and monkey, was screened based on sequencing data, and then qRT-PCR technology was used to detect the expression of circApbb1 in atherosclerotic mice ( Figure 1 AS group) and control mice ( Figure 1 The expression of circApbb1 in heart tissue of the Con group was detected. The primer sequences of circApbb1 are shown in SEQ ID NO: 2 and SEQ ID NO: 3. The specific experimental plan is as follows:

[0053] (1) Sample collection: Heart tissues from atherosclerotic mice were collected, placed in cryopreservation tubes, and stored at -80°C until use.

[0054] (2) RNA extraction: Take heart tissue, grind it into fine powder with liquid nitrogen, add 1 ml of TriZol reagent, blow and lyse it thoroughly, add 200 μl of chloroform, shake and mix, and let it stand at room temperature for 3 minutes; centrifuge at 4°C, 12000 rpm for 15 minutes; take the upper clear solution to a new EP tube, add an equal volume of isopropanol, mix and let it stand at room temperature for 10 minutes; centrifuge at 4°C, 12000 rpm for 15 minutes, discard the supernatant, and obtain a white precipitate; wash the precipitate twice with 75% ethanol, centrifuge at 4°C, 7500 rpm for 10 minutes, remove the supernatant, wait for the ethanol to evaporate, dissolve the RNA in 20-30 μl of DEPC water, and measure the RNA concentration.

[0055] (3) gDNA genome removal

[0056] Take a 200μl centrifuge tube and add the following reagents to prepare the reaction system

[0057]

[0058] Reaction conditions: 42°C, 2 min, 4°C, 0 min.

[0059] (4) Reverse transcription reaction

[0060]

[0061] Reaction conditions: 25°C, 5 min; 42°C, 30 min; 85°C, 5 min.

[0062] (5) qRT-PCR was used to detect the expression level of circApbb1 in normal and atherosclerotic heart tissues. The reaction system was as follows:

[0063]

[0064] Reaction conditions: 95°C, 30 s; 95°C, 5 s; 60°C, 34 s, 40 cycles; 95°C, 15 s; 60°C, 1 min; 95°C, 15 s.

[0065] (6) Result analysis: The Ct values ​​of the target gene and the reference gene were recorded, and the 2^(-ΔΔCt) value was calculated to express the expression level of circApbb1.

[0066] See the results Figure 1 , circApbb1 was significantly upregulated in the heart tissues of atherosclerotic mice compared with control mice.

[0067] Example 2: RNase R digestion

[0068] In this example, the inventors designed specific primers capable of amplifying circApbb1. The primer sequences are as follows: F: 5'-(GTGCCAGTTGCTAAACCTGT)-3' (SEQ ID NO: 2), R: 5'-(TGCCAGTAGTAGGTCCCTGA)-3' (SEQ ID NO: 3). These primers were used to amplify circApbb1. RNase R can digest linear RNA but has little effect on circRNA. Therefore, mouse heart total RNA was treated with RNase R to verify the molecular stability of circApbb1. The reaction system is as follows:

[0069]

[0070]

[0071] Reaction conditions: 37°C, 30 min; 4°C, 0 min. The treated RNA was reverse transcribed into cDNA and the abundance changes were detected by PCR.

[0072] See the results Figure 2 The comparison of RNase R digestion of circApbb1 and mApbb1 showed that the expression of linear RNAApbb1 was significantly reduced after RNase R digestion, while the expression level of circApbb1 remained basically unchanged, indicating that circApbb1 is resistant to RNase R digestion.

[0073] Example 3: Construction of circApbb1 siRNA adeno-associated virus vector and viral packaging

[0074] 1. Construction of adeno-associated virus vectors for siRNA

[0075] (1) Vector information: The present invention uses pHBAAV-cTNT-MCS-Green vector to make mir30 structure:

[0076] siRNA sense strand sequence: GCAGTGTGGCAGTCAACAATT (SEQ ID NO: 4);

[0077] siRNA antisense strand sequence: AATTGTTGACTGCCACACTGC (SEQ ID NO: 5).

[0078] (2) Enzyme digestion of the vector, the system is as follows:

[0079]

[0080] Reaction conditions: 37°C, 1-2h.

[0081] (3) Obtain the target fragment. The PCR amplification system is as follows:

[0082]

[0083] Reaction conditions: 95°C, 5 min; 95°C, 30 s; 55-72°C, 30 s; 72°C, 30-60 s / kb (27-35 cycles); 72°C, 10 min; 12°C, 0 min.

[0084] (4) The target fragment is connected to the vector. The system is as follows:

[0085]

[0086] Reaction conditions: 50°C, 30 min, 4°C, 5 min.

[0087] (5) Transformation: Take out the DH5α competent cells from the -80℃ freezer and immediately put them on ice to thaw; after the competent cells have thawed, add 5μL of the ligation product and place on ice for 20-30 minutes; heat shock at 42℃ for 90 seconds, and then incubate on ice for 2-3 minutes; add 500μL of LB culture medium and turn it upside down 3-5 times; shake and culture at 37℃ and 230rpm for 45-60 minutes; spread the bacterial solution on a solid plate with the corresponding resistance and place it in a 37℃ constant temperature incubator for 12-16 hours.

[0088] (6) Bacterial liquid PCR identification, the identification system is as follows:

[0089]

[0090] Reaction conditions: 94°C, 5 min; 94°C, 30 s; 56°C, 30 s; 72°C, 30-60 s / Kb, 25 cycles; 72°C, 10 min; 12°C, 0 min.

[0091] (7) Sequencing: If the sequencing results are consistent with the target sequence, the target plasmid is successfully constructed.

[0092] (8) Plasmid extraction: After successful sequencing, arrange for bacterial liquid amplification and perform plasmid extraction and purification.

[0093] 2. Adeno-associated virus packaging and quality testing

[0094] (1) AAV-293 cells were passaged and cultured at 37°C, 5% CO2, and 95% relative humidity.

[0095] (2) Transfection: Transfection was performed when the cell density reached 80-90%. The transfection complex components were as follows:

[0096]

[0097] (3) Medium change: 6 hours after transfection, replace the complete medium containing 10% fetal bovine serum.

[0098] (4) Cell collection: 72 h after transfection, cells containing AAV particles were scraped off and centrifuged at 150 × g for 3 min to collect the cells. The culture supernatant was removed and the cells were resuspended in 300 μL PBS.

[0099] (5) Cell disruption: The cells were repeatedly frozen and thawed three times in liquid nitrogen and a 37°C water bath, centrifuged at 2000 × g for 5 min, the cell debris was removed, and the lysis supernatant containing AVV particles was collected.

[0100] (6) Adeno-associated virus purification: 0.1 μL of Benonase was added to every 1 ml of crude virus extract. The virus was incubated in a 37°C water bath for 1 h to remove the cellular genome and residual plasmid DNA from the virus solution. The solution was centrifuged at 600 × g for 10 min at 4°C and the supernatant was collected. The virus was purified using the Biomiga Adeno-associated Virus Purification Kit V1469-01. The purified virus sample was added to an ultrafiltration tube and centrifuged at 1400 × g for 30 min to obtain the purified virus.

[0101] (7) The purified virus was tested for sterility, mycoplasma, and virus titer.

[0102] The results showed that the siRNA adeno-associated virus vector of circApbb1 was successfully constructed and the virus packaging was completed.

[0103] Example 4. Effect of HBAAV2 / 9-cTNT-mir30-circApbb1-Green on the progression of atherosclerosis in mice

[0104] 1. Construction of Atherosclerosis Model

[0105] The present invention uses C57 BL / 6J mice as control (Con), 8-week-old Apoe - / -Mice were fed a high cholesterol diet to establish an atherosclerosis model. The experimental groups were control group (Con group, given regular feed), model group (Apoe - / - group, fed a high-cholesterol diet); empty vector group (NC group, injected with HBAAV2 / 9-cTNT-Green, fed a high-cholesterol diet); low knockout group (sicircApbb1 group, injected with HBAAV2 / 9-cTNT-mir30-circApbb1-Green, fed a high-cholesterol diet). Empty vector and circApbb1 knockout adeno-associated virus were injected into mice through the tail vein and fed a high-fat diet for 8 weeks. The mice were weighed every week, and cardiac ultrasound was performed at the end of the experiment.

[0106] See the results Figure 3 C, compared with the mice in the Con group, Apoe - / - The weight of mice increased with the extension of high-fat diet, and knockdown of circApbb1 significantly reduced the weight of mice (*Apoe - / - vs Con, #Apoe - / - vs sicircApbb1, +NC vsCon).

[0107] 2. Oil red staining

[0108] After the experiment, the mice were killed by spinal dislocation, and the aorta was carefully dissected from the aortic arch at the heart orifice to the iliac bifurcation of the abdominal aorta. The fat tissue around the blood vessels was peeled off with forceps, and the aorta was cut longitudinally with ophthalmic scissors under a dissecting microscope, and the cutting was carried out along the inner curve of the aortic arch. The aorta was then spread flat on filter paper in a Y shape. The aorta was fixed with 4% paraformaldehyde for 20 minutes and then stained with Oil Red O working solution in the dark for 1 hour. Finally, the aorta was photographed and the vascular surface area and red plaque area were calculated using Image J software.

[0109] Mouse hearts were fixed with 4% paraformaldehyde for 1 hour, dehydrated with varying concentrations of sucrose, embedded in OCT, and sectioned to collect intact aortic valve tissue. The tissue was rehydrated in PBS for 5 minutes, pre-washed with 60% isopropanol for 5 minutes, then transferred to 60% Oil Red O working solution and stained for 30 minutes in the dark. The stained sections were rinsed two to three times in 60% isopropanol to remove background staining. The sections were washed with water, counterstained with hematoxylin for 10 seconds, and then deblued with running water for 30 minutes. After deblueing, the sections were mounted and photographed. The area of ​​red plaques and the aortic root area were counted using Image J software.

[0110] See the results Figure 3 Compared with the Con group mice, Apoe - / -Obvious atherosclerotic plaques appeared in the abdominal aorta and aortic root of mice, suggesting that Apoe - / - The mouse atherosclerosis model was successfully established. Oil red O staining of the aorta of mice in the sicircApbb1 group revealed that knocking down circApbb1 significantly reduced the area of ​​atherosclerotic plaques in the intima and aortic root of the abdominal aorta of mice, indicating that reducing circApbb1 levels can inhibit the progression of atherosclerotic lesions.

[0111] 3. Mouse Heart Ultrasound

[0112] Mice were placed in the supine position on a 37°C heating plate under 2% isoflurane inhalation anesthesia. After depilation of the thoracic cavity, ultrasound examinations were performed using a Vevo 2100 small animal ultrasound system and an MS-550D probe. A sternal long-axis view was obtained. The probe was rotated 90 degrees clockwise from the left ventricular long-axis view to obtain the left ventricular short-axis view. Left ventricular motion was recorded using M-mode imaging. End-systolic interventricular septal thickness, end-systolic left ventricular posterior wall thickness, end-systolic left ventricular internal diameter, ejection fraction, fractional shortening, and aortic blood pressure were measured.

[0113] See the results Figure 4 Compared with the Con group mice, Apoe - / - The thickness of the left ventricular posterior wall at the end of systole of mice was significantly reduced, and the left ventricular internal diameter at the end of systole was significantly increased, indicating abnormal cardiac structure. The ejection fraction and short-axis shortening rate were significantly reduced, indicating weakened cardiac function of mice. The results of pulsed Doppler showed that Apoe - / - The aortic pressure of mice was significantly higher than that of the Con group. Knockdown of circApbb1 increased the thickness of the left ventricular posterior wall at the end of systole, significantly reduced the left ventricular internal diameter at the end of systole, significantly improved the ejection fraction and short-axis shortening rate, and restored the aortic pressure to the level of the Con group, indicating that inhibiting the level of circApbb1 can increase the level of Apoe - / - Improves cardiac function and inhibits ventricular remodeling in mice.

[0114] In summary, the siRNA adeno-associated virus vector designed in the present invention can target circApbb1. Downregulating its level can significantly reduce the plaque area in the abdominal aorta and aortic root, inhibit the progression of atherosclerosis, improve cardiac function, and inhibit ventricular remodeling, indicating that circApbb1 can become a molecular target for the treatment of atherosclerosis.

[0115] The above description is only a preferred specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes based on the technical solutions and concepts of the present invention within the technical scope disclosed by the present invention, and these changes should be covered by the scope of protection of the present invention.

Claims

1. A siRNA targeting circApbb1, characterized in that It includes a sense chain and an antisense chain. The sequence of the sense chain is shown in SEQ ID NO.4, and the sequence of the antisense chain is shown in SEQ ID NO.

5.

2. An adeno-associated virus vector comprising the siRNA according to claim 1, characterized in that: Adeno-associated virus vectors of siRNA are obtained by cloning siRNA into vectors.

3. The adeno-associated virus vector according to claim 2, characterized in that The vector includes the vector pHBAAV-cTNT-MCS-Green.

4. The adeno-associated virus vector according to claim 3, characterized in that The adeno-associated viral vector includes the adeno-associated viral vector HBAAV2 / 9-cTNT-mir30-circApbb1-Green.

5. Use of the adeno-associated virus vector according to any one of claims 2 to 4 in the preparation of a medicament for treating atherosclerosis.

6. The use according to claim 5, characterized in that The adeno-associated virus vector can reduce the expression level of circApbb1 in the heart of atherosclerotic mice, reduce the area of ​​atherosclerotic plaques, inhibit the progression of atherosclerosis and improve heart function.

7. The use according to claim 6, characterized in that The cardiac function indicators improved by the adeno-associated virus vector include: end-systolic ventricular septum thickness, end-systolic left ventricular posterior wall thickness, end-systolic left ventricular internal diameter, ejection fraction, fractional shortening and aortic blood pressure.

8. A pharmaceutical composition for treating atherosclerosis, characterized in that: The invention comprises an effective dose of the siRNA according to claim 1 or the adeno-associated virus vector according to any one of claims 2 to 4, and a pharmaceutically acceptable carrier or excipient.

Images