Multi-mode biosensor as well as preparation method and application thereof

Abstract

The invention belongs to the technical field of biological detection, and particularly relates to a multi-mode biosensor as well as a preparation method and application thereof. According to the multi-mode biosensor, a magnetic covalent organic framework is used as a matrix, a gold nanoparticle modified enrofloxacin aptamer is used as a recognition site, and the matrix and the recognition site are connected in an adsorption manner, so that the multi-mode biosensor is constructed. According to the multi-mode biosensor provided by the invention, the Au NCs modified enrofloxacin aptamer is adsorbed on Fe3O4 (at) COF through electrostatic adsorption and pi-pi stacking, and the COF has excellent fluorescence quenching capability, so that red light of Au NCs disappears, and meanwhile, the activity of peroxidase is reduced. After the to-be-detected object ENR is added, the aptamer performs specific recognition, the aptamer falls off from the surface of the COF due to higher affinity between the aptamer and the ENR, and fluorescence signals and enzyme activity are changed due to adsorption and falling of the aptamer, so that accurate and specific detection is performed.

Description

Technical Field

[0001] The present invention belongs to the field of biological detection technology, and in particular relates to a multi-mode biosensor and a preparation method and application thereof. Background Art

[0002] Enrofloxacin, abbreviated as ENR, is called Enrofloxacin in English. It has good antibacterial effect and is mainly used to treat Gram-negative and Gram-positive bacteria. It is widely used as a veterinary drug to treat infectious diseases of livestock and poultry. However, in recent years, the abuse of ENR in animal husbandry has become more and more serious. Excessive use will produce drug-resistant bacteria and residues in animal-derived products. Long-term consumption of foods containing ENR can cause allergies, cancer, teratogenicity, etc. Among them, the maximum residue of ENR in animal-derived foods is 100μg / kg.

[0003] Traditional methods for detecting ENR include high performance liquid chromatography, liquid chromatography-mass spectrometry and capillary electrophoresis. These detection methods have accurate results, but have the disadvantages of being time-consuming, complex sample pretreatment, expensive equipment and requiring professional operation, and are not suitable for on-site real-time detection. Therefore, it is very important to accurately, conveniently and quickly detect ENR in animal-derived food or water.

[0004] At present, nanozymes are enzyme mimics based on nanomaterials. They are usually highly stable, low-cost, and have good catalytic activity. They are good substitutes for natural enzymes. Due to their easy modification, strong substrate specificity and biocompatibility, they are used in many fields, such as materials science, chemistry, biological detection, medicine and environment. At present, nanozymes are often combined with colorimetry to quickly and accurately detect the analyte. The nanozyme colorimetric analysis method mainly relies on the color change of the chromogenic substrate 3,3′,5,5′-tetramethylbenzidine and the change of the ultraviolet absorption signal. The color change of the system solution is obvious and easy to observe with the naked eye. Therefore, it is more suitable for real-time and on-site detection in outdoor scenes. For example, the Peng research group synthesized an iron-based nanozyme coordinated with peroxidase activity dopamine, and prepared a colorimetric sensor for detecting norfloxacin by using the interaction between norfloxacin and L-cysteine. However, in most cases, the sensitivity of colorimetric sensors is insufficient, which limits the practical application of these sensors. Summary of the invention

[0005] In order to solve the above problems, the present invention provides a multi-mode biosensor and its preparation method and application. The multi-mode biosensor provided by the present invention is based on a magnetic covalent organic framework as a matrix, the abbreviation of the magnetic covalent organic framework is Fe3O4@COF, Fe3O4@COF has a core-shell structure, the matrix has good peroxidase-like activity and magnetism, and the enrofloxacin aptamer modified with gold nanoparticles is used as the recognition site, the abbreviation of the gold nanoparticles is Au NCs, the enrofloxacin aptamer modified by Au NCs is adsorbed on Fe3O4@COF through electrostatic adsorption and π-π stacking, because the organic framework has excellent fluorescence quenching ability, the abbreviation of the organic framework is COF, resulting in the disappearance of the red light of Au NCs, and the reduction of peroxidase-like activity. When the multi-mode biosensor is used to detect the analyte ENR, when the analyte ENR is added, the aptamer specifically recognizes, and because the aptamer and ENR have a higher affinity, it will fall off from the COF surface, and the adsorption and shedding of the aptamer cause changes in the fluorescence signal and enzyme activity, so as to perform accurate and specific detection. It has the advantages of good selectivity, easy separation, high accuracy, low detection limit, wide range and multi-mode detection. This analytical method is simple to operate and has great application potential in the on-site detection of antibiotic residues in the environment and food.

[0006] The present invention solves the above technical problems through the following technical solutions.

[0007] The present invention develops a biosensor with high sensitivity, selectivity and multi-mode based on ligand regulation of nanozyme activity and induction of FRET "switch", wherein the first purpose of the present invention is to provide a multi-mode biosensor, which uses a magnetic covalent organic skeleton as a matrix, and an enrofloxacin aptamer modified with gold nanoparticles as a recognition site, and constructs a multi-mode biosensor through adsorption connection between the matrix and the recognition site; wherein the enrofloxacin aptamer modified with gold nanoparticles uses the enrofloxacin aptamer as a carrier, and the gold nanoparticles are cross-linked and loaded on the enrofloxacin aptamer.

[0008] The multi-mode biosensor provided by the present invention uses Fe3O4@COF as a matrix, and the matrix has good peroxidase-like activity and magnetism, and has excellent catalytic performance. Under the action of H2O2, it can catalyze the oxidase-substrate, that is, 3,3′,5,5′-tetramethylbenzidine oxidase substrate, and the abbreviation of 3,3′,5,5′-tetramethylbenzidine oxidase substrate is TMB, to produce a blue oxidation product ox-TMB. The ENR aptamer modified with red light Au NCs is used as the recognition site, and the enrofloxacin aptamer modified with Au NCs is adsorbed on Fe3O4@COF through electrostatic adsorption and π-π stacking to construct a multi-mode biosensor. Because COF has excellent fluorescence quenching ability, the aptamer has specific recognition, and the aptamer has a higher affinity with ENR, and will fall off from the COF surface, the red light of Au NCs disappears, and the adsorption and shedding of the aptamer cause changes in the fluorescence signal and enzyme activity, so as to perform accurate and specific detection.

[0009] The second object of the present invention is to provide a method for preparing the above-mentioned multi-mode biosensor, comprising the following steps:

[0010] S1, mixing the enrofloxacin aptamer and the cross-linking agent and stirring the mixture at 37° C., adding the gold nanoparticle solution to the enrofloxacin aptamer, and performing a modification reaction under the action of the cross-linking agent to obtain an Au NCs-modified enrofloxacin aptamer solution;

[0011] S2. Adding a magnetic covalent organic framework solution to the gold nanoparticle-modified enrofloxacin aptamer solution to carry out an adsorption connection reaction to obtain a multimodal biosensor.

[0012] The multimodal biosensor provided by the present invention is based on Fe3O4@COF, and the enrofloxacin aptamer modified by Au NCs is adsorbed on Fe3O4@COF through electrostatic adsorption and π-π stacking. The preparation method is simple. The biosensor combines the high sensitivity of fluorescence method and the intuitive analysis of colorimetry with a smartphone. Compared with other commonly used methods for detecting enrofloxacin, it has the advantages of good selectivity, easy separation, high accuracy, low detection limit, wide range and multimodal detection.

[0013] In some embodiments, the volume ratio of the enrofloxacin aptamer to the gold nanoparticle solution is 1:5-20, the concentration of the enrofloxacin aptamer is 10 μM-20 μM, and the concentration of the gold nanoparticle solution is 4 mM-10 mM. It should be noted that the concentration of the enrofloxacin aptamer is 10 μM-20 μM in order to enable the enrofloxacin aptamer to modify a sufficient amount of AuNCs and obtain high fluorescence measurement results in subsequent fluorescence spectroscopy experiments.

[0014] In some embodiments, the volume ratio of enrofloxacin aptamer to cross-linker is 1:0.5-2, the concentration of cross-linker is 0.5mM-2mM; the modification reaction condition is: stirring overnight at 37°C. It should be noted that the purpose of the cross-linker is to efficiently activate the aptamer and promote the full interaction between the aptamer and Au NCs. Preferably, the cross-linker is obtained by mixing 1-ethyl-(3-dimethylaminopropyl)carbodiimide and N-hydroxysuccinimide in a mass ratio of 1:1.

[0015] In some embodiments, the nucleotide sequence of the enrofloxacin aptamer is: CCCATCAGGGGGCTAGGCTAACACGGTTCGGCTCTCTGAGCCCGGGTTATTTCAGGGGGA.

[0016] In some embodiments, the volume ratio of the gold nanoparticle-modified enrofloxacin aptamer solution and the magnetic covalent organic framework solution is 1:0.2-1, the concentration of the magnetic covalent organic framework solution is 2 mg / L-5 mg / L, and the final concentration of the gold nanoparticle-modified enrofloxacin aptamer solution is 100 nM-700 nM. It should be noted that the concentration of the magnetic covalent organic framework solution is 2 mg / L-5 mg / L, and the purpose is to load the magnetic covalent organic framework with enough gold nanoparticle-modified enrofloxacin aptamers. The abbreviation of the gold nanoparticle-modified enrofloxacin aptamer is Apt-Au NCs. COF has excellent fluorescence quenching ability, the aptamer has specific recognition, and the aptamer has a higher affinity with ENR, and will fall off from the COF surface, the red light of Au NCs disappears, and the adsorption and shedding of the aptamer cause changes in the fluorescence signal and enzyme activity, so as to perform accurate and specific detection.

[0017] In some embodiments, the conditions of the adsorption connection reaction are: shaking at room temperature for 5 min to 10 min.

[0018] In some embodiments, the method for preparing the gold nanoparticle solution comprises the following steps:

[0019] Under stirring conditions at 37°C, HAuCl4 solution was added to the bovine serum albumin solution, and then NaOH solution was added to adjust the pH value to 12, and stirred at 37°C overnight to obtain a luminescent gold nanoparticle solution.

[0020] The volume ratio of HAuCl4 solution to bovine serum albumin solution is 1:1, the concentration of HAuCl4 solution is 1 mM, and the concentration of bovine serum albumin solution is 50 mg / mL.

[0021] The present invention uses HAuCl4 as a precursor of Au atoms, bovine serum albumin as a reducing agent and a protective agent, and synthesizes an Au NCs solution by a "one-pot synthesis method". The synthesis method is simple and the reaction conditions are mild. The synthesized Au NCs have good biocompatibility and photostability, good fluorescence properties, and high quantum yield. The Au NCs solution has the characteristic of emitting red light at a wavelength of 620nm, and then enrofloxacin is modified to obtain an ENR aptamer of the Au NCs modified with red light.

[0022] In some embodiments, the method for preparing a magnetic covalent organic framework solution comprises the following steps:

[0023] Step 1, synthesizing Fe3O4 NPs by solvothermal method: FeCl3·6H2O, anhydrous sodium acetate and sodium citrate are dissolved in a solvent to obtain a mixed solution A, and the mixed solution A is stirred and mixed evenly, and then transferred to a reactor for solvothermal reaction at 200°C. After the reaction is completed, the product is collected by a magnet, washed and dried to obtain Fe3O4 NPs. Spherical Fe3O4 NPs are prepared by solvothermal method, and the surface has abundant carboxyl groups, which is conducive to the subsequent COF coating.

[0024] Among them, the mass ratio of FeCl3·6H2O, anhydrous sodium acetate and sodium citrate is 1.36:2.4:0.4, and the solvothermal reaction time is 14 h.

[0025] Step 2, synthesis of magnetic covalent organic framework Fe3O4@COF NPs solution: 2,5-dimethoxyterephthalaldehyde and 1,3,5-tri(4-aminophenyl)benzene are dissolved in a mixed solvent, mixed evenly, and then Fe3O4 NPs are added. After ultrasonic mixing, acetic acid is added to make the COF NPs initially polymerized; after stirring at room temperature for 2 hours, acetic acid solution is continued to be added to make the polymerization reaction more thorough; a mixed solution B is obtained, and the mixed solution B is transferred to a reactor and reacted by solvothermal method at 70°C. After the reaction is completed, the product is collected by a magnet, washed and dried to obtain a magnetic covalent organic framework Fe3O4@COF NPs.

[0026] Among them, the mass ratio of 2,5-dimethoxyterephthalaldehyde, 1,3,5-tri(4-aminophenyl)benzene and Fe3O4 NPs is 34.8:42:36, and the solvothermal reaction time is 48h.

[0027] The present invention synthesizes a COF with an imino bond -C=N- through condensation reaction of 2,5-dimethoxyterephthalaldehyde and 1,3,5-tri-4-aminobenzene, and then further modifies it on magnetic Fe3O4 NPs to obtain a magnetic material Fe3O4@COF with a core-shell structure. The multi-mode biosensor prepared by the present invention uses a covalent organic framework Fe3O4@COF as a matrix. The covalent organic framework Fe3O4@COF has a unique core-shell structure. Because it has abundant carboxyl groups on the surface, it is conducive to the subsequent coating of COF and increases the fluorescence quenching ability of COF. Moreover, Fe3O4@COF is a nanomaterial with good peroxidase-like activity and magnetism, and has excellent catalytic performance. It can catalyze the oxidation of TMB under the action of H2O2 to produce a blue product ox-TMB, increase the affinity between the enzyme and the substrate, and improve the oxidase activity. Then, based on the ligand regulating the activity of the nanozyme and inducing the FRET "switch", a biosensor with high sensitivity, selectivity and multi-mode is developed.

[0028] The present invention also provides the use of the multi-mode biosensor in detecting enrofloxacin in water or food, wherein the food includes milk and chicken.

[0029] After ENR of the analyte, the aptamer specifically recognizes it. Due to the higher affinity between the aptamer and ENR, in the presence of ENR, Apt-Au NCs are induced to separate from the Fe3O4@COF surface. Apt-Au NCs fall off the COF surface, resulting in the recovery of Apt-AuNCs fluorescence, and then the recovery of red fluorescence and enzyme activity. The peroxidase-like activity of Fe3O4@COF is increased, allowing accurate and specific detection.

[0030] In some embodiments, the detection method of the biosensor is fluorescence, colorimetry or intelligent image recognition.

[0031] The biosensor prepared by the present invention has multiple detection modes. The multi-mode sensing strategy of fluorescence, colorimetry and intelligent image recognition has the advantages of wide linear range, low detection limit, good selectivity, etc., and has good analytical performance for the detection of ENR. More importantly, by comparing the results of the fluorescence mode and the colorimetric mode, the reliability and accuracy of the sensing strategy can be guaranteed. In addition, the introduction of the intelligent image recognition method realizes rapid real-time detection of ENR, and the method has good practicality.

[0032] In some embodiments, the intelligent image recognition method comprises the following steps:

[0033] S1. Use image processing software to read the RGB values ​​of samples containing different known enrofloxacin concentrations after color development, calculate the grayscale value through the RGB value, construct the detection linear response relationship between enrofloxacin concentration and grayscale value, and select the curve with the highest fitting degree as the enrofloxacin detection standard curve.

[0034] The linear regression equation for the detection of enrofloxacin concentration and gray value is: y1=-15.8249x1+163.7164, where x1 is the gray value, y1 is the enrofloxacin concentration in the sample to be tested, and the detection linear range is 10 ng / mL~5×10 4 ng / mL, and the detection limit was 0.12ng / mL.

[0035] S2. Obtain the concentration of enrofloxacin in the sample to be tested according to the obtained enrofloxacin detection linear regression equation and the measured gray value of the sample to be tested.

[0036] The image processing software is a software with the function of shooting color images and reading RGB values. In the present invention, the image processing software is the Color Grap application software in the smart phone. The RGB value is read by the Color Grap application, and the gray value is calculated by the formula I=0.3R+0.59G+0.11B to construct a standard curve, wherein I is the gray value, and R, G, and B represent the intensity of the three primary colors of red, green, and blue, respectively. The intelligent image recognition method realizes the intuitive analysis of rapid real-time detection of ENR, and has the advantages of good selectivity, easy separation, high accuracy, low detection limit, wide range and multi-mode detection. The analysis method is simple to operate and has great application potential in the on-site detection of antibiotic residues in the environment and food.

[0037] Compared with the prior art, the present invention has the following beneficial effects:

[0038] (1) The multi-mode biosensor provided by the present invention is based on the covalent organic framework Fe3O4@COF, which has good peroxidase-like activity and magnetism, and uses the enrofloxacin aptamer modified by Au NCs as the recognition site. The enrofloxacin aptamer modified by Au NCs is adsorbed on Fe3O4@COF through electrostatic adsorption and π-π stacking. Since COF has excellent fluorescence quenching ability, the red light of Au NCs disappears, and the peroxidase-like activity decreases. When the multi-mode biosensor is used to detect the analyte ENR, after the analyte ENR is added, the aptamer specifically recognizes, and since the enrofloxacin aptamer modified by Au NCs has a higher affinity with ENR, it will fall off the COF surface. The adsorption and shedding of the aptamer cause changes in the fluorescence signal and enzyme activity, so as to perform accurate and specific detection, and has the advantages of good selectivity, easy separation, high accuracy, low detection limit, wide range and multi-mode detection. This analytical method is simple to operate and has great application potential in on-site detection of antibiotic residues in the environment and food.

[0039] (2) The multimodal biosensor prepared by the present invention is based on the covalent organic framework Fe3O4@COF. The covalent organic framework Fe3O4@COF has a unique core-shell structure. Because it has abundant carboxyl groups on the surface, it is conducive to the subsequent COF coating and increases the fluorescence quenching ability of COF. Fe3O4@COF is a nanomaterial with good peroxidase-like activity and magnetism. It has excellent catalytic performance and can catalyze the oxidation of TMB under the action of H2O2 to produce a blue product ox-TMB, which increases the affinity between the enzyme and the substrate and improves the oxidase activity. Based on the ligand regulating the activity of the nanozyme and inducing the FRET "switch", a biosensor with high sensitivity, selectivity and multimodality is developed. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 This is a morphology and structure diagram of Fe3O4@COF in Example 1 of the present invention.

[0041] Figure 2 IR spectra of Fe3O4@COF and COF in Example 1 of the present invention.

[0042] Figure 3 This is the X-ray diffraction spectrum of Fe3O4NPs and Fe3O4@COF in Example 1.

[0043] Figure 4 This is a diagram of the zeta potential values ​​of Aptamer, Apt-Au NCs, COF, Fe3O4@COF and Apt-Au NCs-Fe3O4@COF of Example 1 of the present invention.

[0044] Figure 5This is the X-ray photoelectron spectrum of Fe3O4@COF in Example 1 of the present invention. Figure 5 Figure A is the spectrum of Fe3O4@COF, Figure B is the spectrum of C1s, and Figure C is the spectrum of N1s.

[0045] Figure 6 This is a diagram showing the peroxidase-like activity of Fe3O4@COF and Apt-Au NCs-Fe3O4@COF in Example 1 of the present invention.

[0046] Figure 7 The Michaelis-Menten curve of Fe3O4@COF of Example 1 of the present invention versus TMB and the corresponding Lineweaver-Burk double reciprocal plot. Figure 7 Figure A is the Michaelis-Menten curve. Figure 7 Figure B is the corresponding Lineweaver-Burk double reciprocal plot.

[0047] Figure 8 The Michaelis-Menten curve of Fe3O4@COF of Example 1 of the present invention for H2O2 and the corresponding Lineweaver-Burk double reciprocal plot. Figure 8 Figure A is the Michaelis-Menten curve. Figure 8 Figure B is the corresponding Lineweaver-Burk double reciprocal plot.

[0048] Fig. 9 This is a comparative performance diagram of Apt-Au NCsFe3O4@COF of Examples 1 to 7 of the present invention. Fig. 9 Figure A in the figure shows the absorbance values ​​of Examples 1 to 7. Fig. 9 Figure B is a UV spectrum and a line graph showing the changes in peroxidase activity in Examples 1 to 7. Fig. 9 C in the figure is the adsorption time optimization diagram of Apt-AuNCs and Fe3O4@COF.

[0049] Fig.10 This is a diagram of the detection performance of Apt-Au NCs-Fe3O4@COF in fluorescence mode and colorimetric mode according to Example 5 of the present invention.

[0050] Fig.11 This is the fluorescence intensity and linear change diagram of the fluorescence mode of Apt-Au NCs-Fe3O4@COF in Example 5 of the present invention. Fig.11 A in the figure is the fluorescence intensity diagram of Apt-Au NCs-Fe3O4@COF under different concentrations of ENR. Fig.11 B in the figure is a linear change graph.

[0051] Fig.12 This is a graph of fluorescence intensity and linear change in the colorimetric mode of Apt-Au NCs-Fe3O4@COF of Example 5 of the present invention. Fig.12 Figure A is the fluorescence intensity diagram of Apt-Au NCs-Fe3O4@COF under different concentrations of ENR. Fig.12 Figure B is the current linear change diagram.

[0052] Fig.13 Schematic diagram of the ENR detection platform and linear relationship diagram of Apt-Au NCs-Fe3O4@COF in Example 3 of the present invention. Fig.13 A in the figure is a schematic diagram of the ENR detection platform. Fig.13 B in the figure is a linear relationship diagram. DETAILED DESCRIPTION

[0053] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0054] It should be noted that the professional terms used in the present invention are only for the purpose of describing specific embodiments, and are not intended to limit the scope of protection of the present invention. Unless otherwise specified, the various raw materials, reagents, instruments and equipment used in the following embodiments of the present invention can be purchased from the market or prepared by existing methods. Among them, n-butanol, ferric chloride hexahydrate, anhydrous sodium acetate, sodium citrate, ethylene glycol, 1,4-dioxane, butanol and tetrahydrofuran are purchased from China Pharmaceutical Group Corporation (Shanghai, China). 2,5-dimethoxyterephthalaldehyde, 1,3,5-tri-4-aminobenzene, 1,3,5-trimethylbenzene, bovine serum albumin, 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride, N-hydroxysuccinimide sodium salt, and enrofloxacin are purchased from Shanghai Aladdin Biochemical Technology Co., Ltd. All aqueous solutions are purchased from Wahaha Group Co., Ltd.

[0055] Example 1

[0056] A method for preparing a multi-mode biosensor comprises the following steps:

[0057] S1. Synthesis of Fe3O4 NPs by solvothermal method: 1.36 g FeCl3·6H2O, 2.4 g anhydrous sodium acetate and 0.4 g sodium citrate were dissolved in 40 mL ethylene glycol to form a mixed solution. The mixed solution was stirred at 1200 rpm for 1.5 h, then transferred to a stainless steel high-pressure reactor and reacted by solvothermal method at 200 °C for 14 h. After the reaction was completed, the product was cooled to room temperature, collected by a magnet, washed three times with anhydrous ethanol and deionized water respectively, and dried in vacuum at 30 °C for 12 h to obtain Fe3O4 NPs.

[0058] S2. Synthesis of magnetic covalent organic framework solution: 34.8 mg of 2,5-dimethoxyterephthalaldehyde, abbreviated as DMTP and 42 mg of 1,3,5-tris(4-aminophenyl)benzene, abbreviated as TAPB, were dissolved in a mixed solvent formed by 8 mL of butanol and 8 mL of 1,4-dioxane, and ultrasonically mixed for 5 minutes; then 36 mg of Fe3O4 NPs were added to the mixed solution, and ultrasonication was continued for 5 minutes, followed by the addition of 0.2 mL of acetic acid, and after stirring at 1200 rpm at room temperature for 2 hours, 1.8 mL of 12 M acetic acid aqueous solution was added to obtain a mixed solution, and the mixed solution was transferred to a stainless steel high-pressure reactor and reacted by solvothermal method at 70°C for 48 hours. After the reaction was completed, the product was cooled to room temperature, collected by a magnet, washed three times with acetone and tetrahydrofuran respectively, and vacuum dried at 30°C for 12 hours to obtain a magnetic covalent organic framework solution, named Fe3O4@COF NPs solution.

[0059] S3. Synthesis of Au NCs: Add 5 mL of 1 mM HAuCl4 to 5 mL of 50 mg / mL bovine serum albumin solution at 37°C and 1500 rpm, then add 0.5 mL of 1 M NaOH solution to adjust the pH to 12, and then stir at 37°C overnight to obtain luminescent Au NCs.

[0060] S4. Synthesis of Au NCs-modified enrofloxacin aptamer: 10 μL of 10 μM enrofloxacin aptamer and 10 μL of 1 mM cross-linker were mixed to form a mixed solution, wherein the cross-linker was obtained by mixing 1-ethyl-(3-dimethylaminopropyl)carbodiimide and N-hydroxysuccinimide in a mass ratio of 1:1, wherein 1-ethyl-(3-dimethylaminopropyl)carbodiimide is abbreviated as EDC, and N-hydroxysuccinimide is abbreviated as NHS; the mixed solution was stirred at 37°C and 1200 rpm for 0.5 h, and then 180 μL of Au NCs obtained in S3 was added, and the mixture was continuously stirred at 37°C overnight to obtain an Au NCs-modified enrofloxacin aptamer solution, which was stored at 4°C and named Apt-Au NCs.

[0061] S5, preparation of multimodal biosensor: 40 μL of 2.5 mg / mL Fe3O4@COF solution was added to 160 μL of Apt-Au NCs solution prepared in S4 above, so that the final concentration of Apt-Au NCs was 100 nM. Oscillating at room temperature for 5 min, the Au NCs-modified enrofloxacin aptamer was completely adsorbed to the Fe3O4@COF surface, the product was collected by magnet, and the final product was obtained after washing with deionized water, which was a multimodal biosensor named Apt-Au NCs-Fe3O4@COF, and was dispersed in 200 μL of water after washing with deionized water, with the content of Fe3O4@COF as the matrix, and the concentration of Fe3O4@COF in water in Apt-Au NCs-Fe3O4@COF was 0.5 mg / mL, which was convenient for subsequent use.

[0062] Example 2

[0063] A method for preparing a multi-mode biosensor comprises the following steps:

[0064] S1. Synthesis of Fe3O4 NPs by solvothermal method: 1.36 g FeCl3·6H2O, 2.4 g anhydrous sodium acetate and 0.4 g sodium citrate were dissolved in 40 mL ethylene glycol to form a mixed solution. The mixed solution was stirred at 1200 rpm for 1.5 h, then transferred to a stainless steel high-pressure reactor and reacted by solvothermal method at 200 °C for 14 h. After the reaction was completed, the product was cooled to room temperature, collected by a magnet, washed three times with anhydrous ethanol and deionized water respectively, and dried in vacuum at 30 °C for 12 h to obtain Fe3O4 NPs.

[0065] S2. Synthesis of magnetic covalent organic framework solution: 34.8 mg DMTP and 42 mg TAPB were dissolved in a mixed solvent formed by 8 mL butanol and 8 mL 1,4-dioxane, and ultrasonically mixed for 5 min; then 36 mg Fe3O4 NPs were added to the mixed solution, and ultrasonication was continued for 5 min. Subsequently, 0.2 mL acetic acid was added, and after stirring at 1200 rpm at room temperature for 2 h, 1.8 mL 12 M acetic acid aqueous solution was added to obtain a mixed solution. The mixed solution was transferred to a stainless steel high-pressure reactor and reacted by solvothermal method at 70 °C for 48 h. After the reaction was completed, the product was cooled to room temperature, collected by a magnet, washed three times with acetone and tetrahydrofuran respectively, and vacuum dried at 30 °C for 12 h to obtain a magnetic covalent organic framework solution, named Fe3O4@COF NPs solution.

[0066] S3. Synthesis of Au NCs: Add 5 mL of 1 mM HAuCl4 to 5 mL of 50 mg / mL bovine serum albumin solution at 37°C and 1500 rpm, then add 0.5 mL of 1 M NaOH solution to adjust the pH to 12, and then stir at 37°C overnight to obtain luminescent Au NCs.

[0067] S4. Synthesis of Au NCs-modified enrofloxacin aptamer: 10 μL of 10 μM enrofloxacin aptamer and 10 μL of 1 mM cross-linker were mixed to form a mixed solution, wherein the cross-linker was obtained by mixing EDC and NHS in a mass ratio of 1:1; the mixed solution was stirred at 37°C and 1200 rpm for 0.5 h, and then 180 μL of Au NCs obtained by S3 were added and stirred continuously at 37°C overnight to obtain an Au NCs-modified enrofloxacin aptamer solution, which was stored at 4°C and named Apt-AuNCs.

[0068] S5, preparation of multimodal biosensor: 40 μL of 2.5 mg / mL Fe3O4@COF solution was added to 160 μL of Apt-Au NCs solution prepared in S4 above, so that the final concentration of Apt-Au NCs was 200 nM. Oscillating at room temperature for 5 min, the Au NCs-modified enrofloxacin aptamer was completely adsorbed to the Fe3O4@COF surface, the product was collected by magnet, and the final product was obtained after washing with deionized water, which was a multimodal biosensor named Apt-Au NCs-Fe3O4@COF, and after washing with deionized water, it was dispersed in 200 μL of water, with the content of Fe3O4@COF as the matrix, and the concentration of Fe3O4@COF in water in Apt-Au NCs-Fe3O4@COF was 0.5 mg / mL, which was convenient for subsequent use.

[0069] Example 3

[0070] A method for preparing a multi-mode biosensor comprises the following steps:

[0071] S1. Synthesis of Fe3O4 NPs by solvothermal method: 1.36 g FeCl3·6H2O, 2.4 g anhydrous sodium acetate and 0.4 g sodium citrate were dissolved in 40 mL ethylene glycol to form a mixed solution. The mixed solution was stirred at 1200 rpm for 1.5 h, then transferred to a stainless steel high-pressure reactor and reacted by solvothermal method at 200 °C for 14 h. After the reaction was completed, the product was cooled to room temperature, collected by a magnet, washed three times with anhydrous ethanol and deionized water respectively, and dried in vacuum at 30 °C for 12 h to obtain Fe3O4 NPs.

[0072] S2. Synthesis of magnetic covalent organic framework solution: 34.8 mg DMTP and 42 mg TAPB were dissolved in a mixed solvent formed by 8 mL butanol and 8 mL 1,4-dioxane, and ultrasonically mixed for 5 min; then 36 mg Fe3O4 NPs were added to the mixed solution, and ultrasonication was continued for 5 min. Subsequently, 0.2 mL acetic acid was added. After stirring at 1200 rpm at room temperature for 2 h, 1.8 mL 12 M acetic acid aqueous solution was added to obtain a mixed solution. The mixed solution was transferred to a stainless steel high-pressure reactor and reacted by solvothermal method at 70 °C for 48 h. After the reaction was completed, the product was cooled to room temperature, collected by a magnet, washed three times with acetone and tetrahydrofuran respectively, and vacuum dried at 30 °C for 12 h to obtain a magnetic covalent organic framework solution, named Fe3O4@COF NPs solution.

[0073] S3. Synthesis of Au NCs: Add 5 mL of 1 mM HAuCl4 to 5 mL of 50 mg / mL bovine serum albumin solution at 37°C and 1200 rpm, then add 0.5 mL of 1 M NaOH solution to adjust the pH to 12, and then stir at 37°C overnight to obtain luminescent Au NCs.

[0074] S4. Synthesis of Au NCs-modified enrofloxacin aptamer: Mix 10 μL of 10 μM enrofloxacin aptamer and 10 μL of 1 mM cross-linker to form a mixed solution, wherein the cross-linker is a mixture of EDC and NHS in a mass ratio of 1:1; stir the mixed solution at 37°C and 1200 rpm for 0.5 h, then add 180 μL of Au NCs obtained by S3, and stir continuously at 37°C overnight to obtain an Au NCs-modified enrofloxacin aptamer solution, which is stored at 4°C and named Apt-AuNCs.

[0075] S5, preparation of multimodal biosensor: 40 μL of 2.5 mg / mL Fe3O4@COF solution was added to 160 μL of Apt-Au NCs solution prepared in S4 above, so that the final concentration of Apt-Au NCs was 300 nM. Oscillating at room temperature for 5 min, the Au NCs-modified enrofloxacin aptamer was completely adsorbed to the Fe3O4@COF surface, the product was collected by magnet, and the final product was obtained after washing with deionized water, which was a multimodal biosensor named Apt-Au NCs-Fe3O4@COF, and after washing with deionized water, it was dispersed in 200 μL of water, with the content of Fe3O4@COF as the matrix, and the concentration of Fe3O4@COF in water in Apt-Au NCs-Fe3O4@COF was 0.5 mg / mL, which was convenient for subsequent use.

[0076] Example 4

[0077] A method for preparing a multi-mode biosensor comprises the following steps:

[0078] S1. Synthesis of Fe3O4 NPs by solvothermal method: 1.36 g FeCl3·6H2O, 2.4 g anhydrous sodium acetate and 0.4 g sodium citrate were dissolved in 40 mL ethylene glycol to form a mixed solution. The mixed solution was stirred at 1200 rpm for 1.5 h, then transferred to a stainless steel high-pressure reactor and reacted by solvothermal method at 200 °C for 14 h. After the reaction was completed, the product was cooled to room temperature, collected by a magnet, washed three times with anhydrous ethanol and deionized water respectively, and dried in vacuum at 30 °C for 12 h to obtain Fe3O4 NPs.

[0079] S2. Synthesis of magnetic covalent organic framework solution: 34.8 mg DMTP and 42 mg TAPB were dissolved in a mixed solvent formed by 8 mL butanol and 8 mL 1,4-dioxane, and ultrasonically mixed for 5 min; then 36 mg Fe3O4 NPs were added to the mixed solution, and ultrasonication was continued for 5 min. Subsequently, 0.2 mL acetic acid was added. After stirring at 1200 rpm at room temperature for 2 h, 1.8 mL 12 M acetic acid aqueous solution was added to obtain a mixed solution. The mixed solution was transferred to a stainless steel high-pressure reactor and reacted by solvothermal method at 70 °C for 48 h. After the reaction was completed, the product was cooled to room temperature, collected by a magnet, washed three times with acetone and tetrahydrofuran respectively, and vacuum dried at 30 °C for 12 h to obtain a magnetic covalent organic framework solution, named Fe3O4@COF NPs solution.

[0080] S3. Synthesis of Au NCs: Add 5 mL of 1 mM HAuCl4 to 5 mL of 50 mg / mL bovine serum albumin solution at 37°C and 1200 rpm, then add 0.5 mL of 1 M NaOH solution to adjust the pH to 12, and then stir at 37°C overnight to obtain luminescent Au NCs.

[0081] S4. Synthesis of Au NCs-modified enrofloxacin aptamer: Mix 10 μL of 10 μM enrofloxacin aptamer and 10 μL of 1 mM cross-linker to form a mixed solution, wherein the cross-linker is a mixture of EDC and NHS in a mass ratio of 1:1; stir the mixed solution at 37°C and 1200 rpm for 0.5 h, then add 180 μL of Au NCs obtained by S3, and stir continuously at 37°C overnight to obtain an Au NCs-modified enrofloxacin aptamer solution, which is stored at 4°C and named Apt-AuNCs.

[0082] S5, preparation of multimodal biosensor: 40 μL of 2.5 mg / mL Fe3O4@COF solution was added to 160 μL of Apt-Au NCs solution prepared in S4 above, so that the final concentration of Apt-Au NCs was 400 nM. Oscillating at room temperature for 5 min, the Au NCs-modified enrofloxacin aptamer was completely adsorbed to the Fe3O4@COF surface, the product was collected by magnet, and the final product was obtained after washing with deionized water, which was a multimodal biosensor named Apt-Au NCs-Fe3O4@COF, and after washing with deionized water, it was dispersed in 200 μL of water, with the content of Fe3O4@COF as the matrix, and the concentration of Fe3O4@COF in water in Apt-Au NCs-Fe3O4@COF was 0.5 mg / mL, which was convenient for subsequent use.

[0083] Example 5

[0084] A method for preparing a multi-mode biosensor comprises the following steps:

[0085] S1. Synthesis of Fe3O4 NPs by solvothermal method: 1.36 g FeCl3·6H2O, 2.4 g anhydrous sodium acetate and 0.4 g sodium citrate were dissolved in 40 mL ethylene glycol to form a mixed solution. The mixed solution was stirred at 1200 rpm for 1.5 h, then transferred to a stainless steel high-pressure reactor and reacted by solvothermal method at 200 °C for 14 h. After the reaction was completed, the product was cooled to room temperature, collected by a magnet, washed three times with anhydrous ethanol and deionized water respectively, and dried in vacuum at 30 °C for 12 h to obtain Fe3O4 NPs.

[0086] S2. Synthesis of magnetic covalent organic framework solution: 34.8 mg DMTP and 42 mg TAPB were dissolved in a mixed solvent formed by 8 mL butanol and 8 mL 1,4-dioxane, and ultrasonically mixed for 5 min; then 36 mg Fe3O4 NPs were added to the mixed solution, and ultrasonication was continued for 5 min. Subsequently, 0.2 mL acetic acid was added. After stirring at 1200 rpm at room temperature for 2 h, 1.8 mL 12 M acetic acid aqueous solution was added to obtain a mixed solution. The mixed solution was transferred to a stainless steel high-pressure reactor and reacted by solvothermal method at 70 °C for 48 h. After the reaction was completed, the product was cooled to room temperature, collected by a magnet, washed three times with acetone and tetrahydrofuran respectively, and vacuum dried at 30 °C for 12 h to obtain a magnetic covalent organic framework solution, named Fe3O4@COF NPs solution.

[0087] S3. Synthesis of Au NCs: Add 5 mL of 1 mM HAuCl4 to 5 mL of 50 mg / mL bovine serum albumin solution at 37°C and 1200 rpm, then add 0.5 mL of 1 M NaOH solution to adjust the pH to 12, and then stir at 37°C overnight to obtain luminescent Au NCs.

[0088] S4. Synthesis of Au NCs-modified enrofloxacin aptamer: Mix 20 μL of 10 μM enrofloxacin aptamer and 20 μL of 1 mM cross-linker to form a mixed solution, wherein the cross-linker is a mixture of EDC and NHS in a mass ratio of 1:1; stir the mixed solution at 37°C and 1200 rpm for 0.5 h, then add 160 μL of Au NCs obtained by S3, and stir continuously at 37°C overnight to obtain an Au NCs-modified enrofloxacin aptamer solution, which is stored at 4°C and named Apt-AuNCs.

[0089] S5, preparation of multimodal biosensor: 40 μL of 2.5 mg / mL Fe3O4@COF solution was added to 160 μL of Apt-Au NCs solution prepared in S4 above, so that the final concentration of Apt-Au NCs was 500 nM. Oscillating at room temperature for 5 min, the Au NCs-modified enrofloxacin aptamer was completely adsorbed to the Fe3O4@COF surface, the product was collected by magnet, and the final product was obtained after washing with deionized water, which was a multimodal biosensor named Apt-Au NCs-Fe3O4@COF, and was dispersed in 200 μL of water after washing with deionized water, with the content of Fe3O4@COF as the matrix, and the concentration of Fe3O4@COF in water in Apt-Au NCs-Fe3O4@COF was 0.5 mg / mL, which was convenient for subsequent use.

[0090] Example 6

[0091] A method for preparing a multi-mode biosensor comprises the following steps:

[0092] S1. Synthesis of Fe3O4 NPs by solvothermal method: 1.36 g FeCl3·6H2O, 2.4 g anhydrous sodium acetate and 0.4 g sodium citrate were dissolved in 40 mL ethylene glycol to form a mixed solution. The mixed solution was stirred at 1200 rpm for 1.5 h, then transferred to a stainless steel high-pressure reactor and reacted by solvothermal method at 200 °C for 14 h. After the reaction was completed, the product was cooled to room temperature, collected by a magnet, washed three times with anhydrous ethanol and deionized water respectively, and dried in vacuum at 30 °C for 12 h to obtain Fe3O4 NPs.

[0093] S2. Synthesis of magnetic covalent organic framework solution: 34.8 mg DMTP and 42 mg TAPB were dissolved in a mixed solvent formed by 8 mL butanol and 8 mL 1,4-dioxane, and ultrasonically mixed for 5 min; then 36 mg Fe3O4 NPs were added to the mixed solution, and ultrasonication was continued for 5 min. Subsequently, 0.2 mL acetic acid was added. After stirring at 1200 rpm at room temperature for 2 h, 1.8 mL 12 M acetic acid aqueous solution was added to obtain a mixed solution. The mixed solution was transferred to a stainless steel high-pressure reactor and reacted by solvothermal method at 70 °C for 48 h. After the reaction was completed, the product was cooled to room temperature, collected by a magnet, washed three times with acetone and tetrahydrofuran respectively, and vacuum dried at 30 °C for 12 h to obtain a magnetic covalent organic framework solution, named Fe3O4@COF NPs solution.

[0094] S3. Synthesis of Au NCs: Add 5 mL of 1 mM HAuCl4 to 5 mL of 50 mg / mL bovine serum albumin solution at 37°C and 1200 rpm, then add 0.5 mL of 1 M NaOH solution to adjust the pH to 12, and then stir at 37°C overnight to obtain luminescent Au NCs.

[0095] S4. Synthesis of Au NCs-modified enrofloxacin aptamer: Mix 20 μL of 10 μM enrofloxacin aptamer and 20 μL of 1 mM cross-linker to form a mixed solution, wherein the cross-linker is a mixture of EDC and NHS in a mass ratio of 1:1; stir the mixed solution at 37°C and 1200 rpm for 0.5 h, then add 160 μL of Au NCs obtained by S3, and stir continuously at 37°C overnight to obtain an Au NCs-modified enrofloxacin aptamer solution, which is stored at 4°C and named Apt-AuNCs.

[0096] S5, preparation of multimodal biosensor: 40 μL of 2.5 mg / mL Fe3O4@COF solution was added to 160 μL of Apt-Au NCs solution prepared in S4 above, so that the final concentration of Apt-Au NCs was 600 nM. Oscillating at room temperature for 5 min, the Au NCs-modified enrofloxacin aptamer was completely adsorbed to the Fe3O4@COF surface, the product was collected by magnet, and the final product was obtained after washing with deionized water, which was a multimodal biosensor named Apt-Au NCs-Fe3O4@COF, and after washing with deionized water, it was dispersed in 200 μL of water, with the content of Fe3O4@COF as the matrix, and the concentration of Fe3O4@COF in water in Apt-Au NCs-Fe3O4@COF was 0.5 mg / mL, which was convenient for subsequent use.

[0097] Example 7

[0098] A method for preparing a multi-mode biosensor comprises the following steps:

[0099] S1. Synthesis of Fe3O4 NPs by solvothermal method: 1.36 g FeCl3·6H2O, 2.4 g anhydrous sodium acetate and 0.4 g sodium citrate were dissolved in 40 mL ethylene glycol to form a mixed solution. The mixed solution was stirred at 1200 rpm for 1.5 h, then transferred to a stainless steel high-pressure reactor and reacted by solvothermal method at 200 °C for 14 h. After the reaction was completed, the product was cooled to room temperature, collected by a magnet, washed three times with anhydrous ethanol and deionized water respectively, and dried in vacuum at 30 °C for 12 h to obtain Fe3O4 NPs.

[0100] S2. Synthesis of magnetic covalent organic framework solution: 34.8 mg DMTP and 42 mg TAPB were dissolved in a mixed solvent formed by 8 mL butanol and 8 mL 1,4-dioxane, and ultrasonically mixed for 5 min; then 36 mg Fe3O4 NPs were added to the mixed solution, and ultrasonication was continued for 5 min. Subsequently, 0.2 mL acetic acid was added. After stirring at 1200 rpm at room temperature for 2 h, 1.8 mL 12 M acetic acid aqueous solution was added to obtain a mixed solution. The mixed solution was transferred to a stainless steel high-pressure reactor and reacted by solvothermal method at 70 °C for 48 h. After the reaction was completed, the product was cooled to room temperature, collected by a magnet, washed three times with acetone and tetrahydrofuran respectively, and vacuum dried at 30 °C for 12 h to obtain a magnetic covalent organic framework solution, named Fe3O4@COF NPs solution.

[0101] S3. Synthesis of Au NCs: Add 5 mL of 1 mM HAuCl4 to 5 mL of 50 mg / mL bovine serum albumin solution at 37°C and 1200 rpm, then add 0.5 mL of 1 M NaOH solution to adjust the pH to 12, and then stir at 37°C overnight to obtain luminescent Au NCs.

[0102] S4. Synthesis of Au NCs-modified enrofloxacin aptamer: Mix 20 μL of 10 μM enrofloxacin aptamer and 20 μL of 1 mM cross-linker to form a mixed solution, wherein the cross-linker is a mixture of EDC and NHS in a mass ratio of 1:1; stir the mixed solution at 37°C and 1200 rpm for 0.5 h, then add 160 μL of Au NCs obtained by S3, and stir continuously at 37°C overnight to obtain an Au NCs-modified enrofloxacin aptamer solution, which is stored at 4°C and named Apt-AuNCs.

[0103] S5, preparation of multimodal biosensor: 40 μL of 2.5 mg / mL Fe3O4@COF solution was added to 160 μL of Apt-Au NCs solution prepared in S4 above, so that the final concentration of Apt-Au NCs was 700 nM. Oscillating at room temperature for 5 min, the Au NCs-modified enrofloxacin aptamer was completely adsorbed to the Fe3O4@COF surface, the product was collected by magnet, and the final product was obtained after washing with deionized water, which was a multimodal biosensor named Apt-Au NCs-Fe3O4@COF, and after washing with deionized water, it was dispersed in 200 μL of water, with the content of Fe3O4@COF as the matrix, and the concentration of Fe3O4@COF in water in Apt-Au NCs-Fe3O4@COF was 0.5 mg / mL, which was convenient for subsequent use.

[0104] Since the structures of Apt-Au NCs-Fe3O4@COF prepared in Examples 1 to 7 are similar, the structure of Apt-Au NCs-Fe3O4@COF prepared in Example 1 is described as follows, and the results are as follows.

[0105] Figure 1 The morphology and structure diagram of Fe3O4@COF in Example 1 of the present invention. Figure 1 As shown, Fe3O4@COF is evenly distributed and has a unique core-shell structure with a total size between 600nm and 700nm.

[0106] Figure 2 The infrared spectra of Fe3O4@COF and COF in Example 1 of the present invention are shown in FIG. Figure 2 As shown, at 585cm -1 The typical absorption at 1631 cm is attributed to Fe-O vibration. -1 The absorption at 1681 cm-1 comes from the newly formed imine bond -C=N-, which indirectly proves that the COF is successfully prepared. -1 and -NH2 of TAPB at 2874cm -1 , 2975cm -1 and 3005cm -1 All of them have weak stretching vibration bands, which shows that the spherical Fe3O4 NPs were prepared by hydrothermal method, which is beneficial to the subsequent COF coating because of the abundant carboxyl groups on the surface.

[0107] Figure 3 Figure 2 is the X-ray diffraction spectrum of Fe3O4 NPs and Fe3O4@COF in Example 1. Figure 3As shown, there are six prominent diffraction peaks of Fe3O4 at 30.12°, 35.50°, 43.16°, 53.71°, 57.30° and 62.70°; discernible peaks are shown at 4.84°, 5.56°, 7.44°, 9.74° and 25.6°, which correspond to the (110), (200), (210), (220) and (001) diffraction of TAPB-DMTP-COF, respectively.

[0108] To prove whether Au NCs were modified onto the aptamer to form Apt-Au NCs and that Apt-Au NCs were successfully connected to Fe3O4@COF, we performed zeta potential measurements.

[0109] Figure 4 Figure 1 is a graph showing the zeta potential values ​​of Aptamer, Apt-Au NCs, COF, Fe3O4@COF and Apt-Au NCs-Fe3O4@COF of Example 1 of the present invention. Figure 4 As shown in the figure, after Au NCs were modified onto the aptamer, the value decreased from -22 to -27. Similarly, after Apt-Au NCs were connected to Fe3O4@COF, the zeta potential of Fe3O4@COF also decreased to a certain extent.

[0110] Figure 5 This is the X-ray photoelectron spectrum of Fe3O4@COF in Example 1 of the present invention. Figure 5 Figure A is the spectrum of Fe3O4@COF, Figure B is the spectrum of C1s, and Figure C is the spectrum of N1s. Figure 5 As shown in Figure A, there are obvious N, O and C element signals in the spectrum of Fe3O4@COF; Figure 5 As shown in Figure B, the C 1s spectrum shows two peaks centered at 288.4 eV and 285.7 eV, corresponding to CO and C=O groups, respectively; Figure 5 As shown in Figure C, the two deconvoluted peaks of the N 1s spectrum are attributed to C=N and the residual -NH2 group, respectively. Figure 2 The results are consistent.

[0111] The above results prove that Fe3O4@COF and Apt-Au NCs-Fe3O4@COF were successfully prepared.

[0112] The peroxidase-like activity of Apt-Au NCs-Fe3O4@COF prepared in Example 1 was studied, including the following steps:

[0113] 40 μg / mL Fe3O4@COF, 0.5 mM TMB and 10 mM H2O2 were mixed in 0.2 M pH acetate buffer and reacted at room temperature for 5 min. The absorbance at 652 nm was recorded by UV-visible spectrophotometer.

[0114] TMB was used as a chromogenic substrate and the peroxidase-like activity of the prepared material was evaluated by catalyzing the oxidation of TMB by H2O2.

[0115] Figure 6 The peroxidase-like activity diagram of Fe3O4@COF and Apt-Au NCs-Fe3O4@COF in Example 1 of the present invention. Figure 6 As shown, Fe3O4@COF shows a strong UV absorption peak at 652nm, and the substrate color is darker. When Apt-Au NCs are adsorbed on the Fe3O4@COF surface, the enzyme active site is blocked, the enzyme activity is reduced, the absorbance is reduced, and the analyte ENR has no effect on the enzyme activity.

[0116] The catalytic performance of Fe3O4@COF was further studied by steady-state kinetic experiments, and steady-state kinetic calculations were performed using TMB and H2O2 as substrates for the enzymatic reaction. According to the Michaelis-Menten equation and the Lineweaver-Burk double reciprocal plot, the Michaelis constant Km and the maximum rate Vmax of the enzymatic reaction can be obtained. Among them, Km represents the affinity of the enzyme for the substrate. The lower the value, the stronger the affinity.

[0117] Figure 7 The Michaelis-Menten curve of Fe3O4@COF of Example 1 of the present invention versus TMB and the corresponding Lineweaver-Burk double reciprocal plot. Figure 7 Figure A is the Michaelis-Menten curve. Figure 7 Figure B in is the corresponding Lineweaver-Burk double reciprocal graph. Figure 7 As shown in Figure 2, when TMB was used as substrate at different concentrations, Km and Vmax were calculated to be 0.85 mM and 8.52 × 10 -8 M.s -1 .

[0118] Figure 8 The Michaelis-Menten curve of Fe3O4@COF to H2O2 and the corresponding Lineweaver-Burk double reciprocal graph of Example 1 of the present invention, wherein: Figure 8 Figure A is the Michaelis-Menten curve. Figure 8Figure B in is the corresponding Lineweaver-Burk double reciprocal graph. Figure 8 As shown, for H2O2, Km and Vmax are 0.86 mM and 2.21 × 10 -8 M.s -1 The above results prove that Fe3O4@COF has excellent catalytic performance.

[0119] For comparison, different concentrations of Apt-Au NCs were adsorbed onto the surface of Fe3O4@COF NPs in Comparative Examples 1 to 7, and the absorbance values ​​of Apt-Au NCs-Fe3O4@COF at 652 nm were obtained at different concentrations.

[0120] Fig. 9 This is a comparative performance diagram of Apt-Au NCs-Fe3O4@COF of Examples 1 to 7 of the present invention. Fig. 9 Figure A in the figure shows the absorbance values ​​of Examples 1 to 7. Fig. 9 Figure B is a UV spectrum and a line graph showing the changes in peroxidase activity in Examples 1 to 7. Fig. 9 Figure C in Figure 1 is the optimization diagram of adsorption time of Apt-AuNCs and Fe3O4@COF. Fig. 9 As shown in Figures A and B, as the final concentration of Apt-Au NCs increases from 100nM to 700nM, the absorbance at 652nm gradually decreases. When the aptamer concentration reaches 500nM, the absorbance stabilizes and no longer decreases. The time for Fe3O4@COF to adsorb Apt-Au NCs is a key parameter. The adsorption time is determined by quenching the fluorescence of Apt-Au NCs by Fe3O4@COF. Fig. 9 As shown in Figure C, Apt-Au NCs can be completely assembled on the Fe3O4@COF surface in 5 min.

[0121] Therefore, the present invention selected the Apt-Au NCs with a concentration of 500 nM in Example 5 for further study.

[0122] The multi-mode biosensor Apt-Au NCs-Fe3O4@COF prepared in Example 5 was used to detect ENR, comprising the following steps:

[0123] 1. Fluorescence method mode: 20μL ENR solutions of 0.001ng / mL, 0.01ng / mL, 0.1ng / mL, 1ng / mL, 1μg / mL, 10μg / mL, 100μg / mL, 300μg / mL, 500μg / mL, 800μg / mL, 850μg / mL, and 900μg / mL were introduced into 180μL Apt-Au NCs-Fe3O4@COF solution prepared in the previous step, where the Au NCs-Fe3O4@COF solution was based on the content of Fe3O4@COF, and the concentration of Fe3O4@COF in water in Apt-Au NCs-Fe3O4@COF was 0.5mg / mL, and reacted at 37℃ for 1h. Separate with a magnet; measure all samples with a fluorescence excitation wavelength of 470nm in the supernatant, and detect the ENR of the analyte by fluorescence method.

[0124] 2. Colorimetric method: Then, the precipitate obtained by magnetic separation in the above step is subjected to a colorimetric reaction at a final concentration of 100 μg / mL according to the amount of Fe3O4@COF. The obtained precipitate is added to a mixed solution of TMB with a final concentration of 0.5 mM and H2O2 with a final concentration of 20 mM, reacted at room temperature for 10 minutes, and the absorbance at 652 nm is measured to detect the analyte by colorimetry.

[0125] Fig.10 This is a diagram of the detection performance of Apt-Au NCs-Fe3O4@COF in fluorescence mode and colorimetric mode according to Example 5 of the present invention. Fig.10 Figure A is the fluorescence spectrum. Fig.10 Figure B is a peroxidase-like activity diagram. Fig.10 As shown in Figure A, in the fluorescence mode, the fluorescence intensity change of Apt-Au NCs at 620nm is used as the detection signal. After the introduction of Fe3O4@COF, the fluorescence of Apt-Au NCs at 620nm is quenched. This is because after the aptamer is successfully adsorbed on the surface, electrons are transferred from Apt-AuNCs to Fe3O4@COF. When the analyte ENR appears, the fluorescence intensity at 620nm is restored; similarly, Fig.10 Figure B shows that in the colorimetric mode, after Apt-Au NCs are successfully adsorbed on the surface, the active sites are covered, the peroxidase-like activity is reduced, and the UV absorbance at 652nm is greatly reduced. When the analyte appears, the activity is restored and the absorbance increases.

[0126] Under the optimized conditions, 0ng / mL~9×10 4 ng / mL of different concentrations of ENR, and the changes in fluorescence intensity at 620 nm in the supernatant were recorded after magnetic separation. Fig.11This is the fluorescence intensity and linear change diagram of the fluorescence mode of Apt-Au NCs-Fe3O4@COF in Example 5 of the present invention. Fig.11 Figure A is the fluorescence intensity diagram of Apt-Au NCs-Fe3O4@COF under different concentrations of ENR. Fig.11 Figure B in the figure is a linear change diagram. Fig.11 As shown in Figure 2, with the increase of ENR concentration, the fluorescence intensity I 620nm Gradually increase, when the concentration reaches 8×10 5 ng / mL, the fluorescence intensity I 620nm The fluorescence intensity is between 0.01ng / mL and 1×10 4 ng / mL(lg C ENR ) range, it showed a linear change with the increase of ENR concentration. The linear regression equation of ENR concentration and fluorescence intensity was: y2 = -17.6704x2 + 88.5253, where x2 is lg C ENR y2 is the fluorescence intensity, and the regression coefficient R2 2 The linear range of ENR is 0.01ng / mL~1×10 4 ng / mL, and the detection limit can reach 4.65pg / mL.

[0127] Fig.12 This is a graph of fluorescence intensity and linear change in the colorimetric mode of Apt-Au NCs-Fe3O4@COF of Example 5 of the present invention. Fig.12 Figure A is the fluorescence intensity diagram of Apt-Au NCs-Fe3O4@COF under different concentrations of ENR. Fig.12 Figure B in the figure is a linear change diagram. Fig.12 As shown in the figure, in the colorimetric detection of ENR, the absorbance at 652 nm increases with the increase of ENR concentration, and the solution gradually changes from light blue to dark blue. The constructed colorimetric sensing strategy can be accurately applied to the visual analysis of ENR. 5 ng / mL, the UV response changes linearly with the ENR concentration, and the linear regression equation for ENR concentration and fluorescence intensity is: y3 = -0.1014x3 + 0.1589, where x3 is lg C ENR , y3 is the fluorescence intensity, regression coefficient R3 2 =0.9941, the linear range of ENR is 10ng / mL~5×10 4 ng / mL, and the detection limit was 0.07 ng / mL based on three times the signal-to-noise ratio.

[0128] 3. Intelligent image recognition mode: The color change in the colorimetric system inspired us to detect ENR through smartphones.

[0129] The color of the reaction solution deepened with the increase of ENR concentration. The color development of different concentrations of ENR at 0μg / mL, 0.01μg / mL, 0.05μg / mL, 0.1μg / mL, 1μg / mL, 10μg / mL, 30μg / mL and 50μg / mL in the colorimetric mode was arranged in a 96-well plate, and the color image was taken by a smartphone. The RGB value was then read by the application Color Grap, and the gray value was calculated by the formula I = 0.3R + 0.59G + 0.11B.

[0130] Fig.13 Schematic diagram of the ENR detection platform and linear relationship diagram of Apt-Au NCs-Fe3O4@COF in Example 3 of the present invention. Fig.13 A in the figure is a schematic diagram of the ENR detection platform. Fig.13 B in is a linear relationship diagram. Fig.13 As shown, the Color Grab application in the mobile phone is used to extract the color and RGB values, and the RGB values ​​of different colors are converted into grayscale values ​​I. The ENR concentration has a good linear relationship with I: y1 = -15.8249x1 + 163.7164, where x1 is the grayscale value, y1 is the enrofloxacin concentration in the sample to be tested, and R1 2 =0.9944, linear range is 10ng / mL~5×10 4 ng / mL, and the detection limit was 0.12ng / mL. The establishment of the smartphone reading platform enables rapid, convenient, and accurate detection of ENR, providing a simple and practical new approach. In summary, the established fluorescence / colorimetry / intelligent image recognition multimodal detection platform can be used for sensitive real-time determination of ENR.

[0131] To verify the practicality and accuracy of the multimodal sensing platform, various real samples of water, milk, and chicken were analyzed. The samples were purchased from the local Jiajiayue supermarket. The real samples were pretreated before analysis. 5 mL of milk was taken as the sample matrix, and 10 mL of methanol was added to remove proteins. The supernatant was obtained by centrifugation at 10000 rpm for 10 minutes, and then the supernatant was further treated with a 0.22 μm filter membrane.

[0132] The actual sample solution was diluted 20 times with a pH = 4, 0.2M acetate buffer solution, and different standard concentrations of ENR were added to perform spike recovery experiments. After that, 0.5mM TMB, Apt-Au NCs-Fe3O4@COF with a Fe3O4@COF concentration of 100μg / mL based on the amount of Fe3O4@COF, and 20mM H2O2 were added to the actual sample, and the UV absorbance A at 652nm, the fluorescence intensity I at 620nm, and the gray value I were measured, and the recovery rate and relative standard deviation were calculated using the measured concentration and the standard concentration.

[0133] In order to verify the effectiveness and reliability of the designed nanomolecules for detecting ENR, multimodal detection of tap water and milk was performed using fluorescence, colorimetry, and a smartphone-assisted sensing platform. 3 ng / mL, 1×10 4 As shown in Tables 1 and 2, the recoveries in the fluorescence mode and colorimetric mode were 91.70% to 108.74% and 92.50% to 107.45%, respectively, and the relative standard deviations were both less than 6%.

[0134] Table 1 Fluorescence detection of ENR in real samples, n = 3

[0135]

[0136]

[0137] Table 2 Colorimetric detection of ENR in real samples, n = 3

[0138]

[0139] Similarly, for smartphone-assisted sensing detection, as shown in Table 3, the recoveries were 91.20% to 106.24%, and the RSD was also less than 6%. The results proved that the designed nanomolecules can accurately and effectively detect ENR, and the proposed smartphone-assisted sensing platform has good reliability in practical applications and can provide technical support for the rapid on-site detection of ENR residues.

[0140] Table 3 Intelligent image recognition assisted sensing to detect ENR in real samples, n = 3

[0141]

[0142]

[0143] In summary, the present invention provides a multi-mode biosensor and its preparation method and application, with a covalent organic framework Fe3O4@COF with a magnetic core-shell structure as a matrix, the matrix has good peroxidase-like activity and magnetism, and an Au NCs-modified enrofloxacin aptamer as a recognition site. The Au NCs-modified enrofloxacin aptamer is adsorbed on Fe3O4@COF through electrostatic adsorption and π-π stacking. Since COF has excellent fluorescence quenching ability, the red light of Au NCs disappears, and the peroxidase-like activity decreases. When the analyte ENR is added, the aptamer specifically recognizes, and due to the higher affinity between the aptamer and ENR, it will fall off from the COF surface. The adsorption and shedding of the aptamer cause changes in the fluorescence signal and enzyme activity, so as to perform accurate and specific detection. It has the advantages of good selectivity, easy separation, high accuracy, low detection limit, wide range and multi-mode detection. The analytical method is simple to operate and has great application potential in the on-site detection of antibiotic residues in the environment and food. The prepared biosensor has multiple detection modes. The multi-mode sensing strategy of fluorescence, colorimetry and intelligent image recognition has the advantages of wide linear range, low detection limit and good selectivity, and has good analytical performance for the detection of ENR. More importantly, by comparing the results of fluorescence mode and colorimetric mode, the reliability and accuracy of the sensing strategy can be guaranteed. In addition, the introduction of intelligent image recognition method realizes the rapid real-time detection of ENR, and the method has good practicality.

[0144] It should be noted that when the present invention involves a numerical range, it should be understood that the two endpoints of each numerical range and any value between the two endpoints can be selected. Since the steps and methods used are the same as those in the embodiments, in order to avoid redundancy, the present invention describes a preferred embodiment. Although the preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they know the basic creative concept. Therefore, the attached claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0145] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A multi-mode biosensor, characterized in that: A multimodal biosensor is constructed using a magnetic covalent organic framework as a matrix and gold nanoparticle-modified enrofloxacin aptamer as a recognition site through adsorption connection between the matrix and the recognition site; wherein, the gold nanoparticle-modified enrofloxacin aptamer uses the enrofloxacin aptamer as a carrier, and the gold nanoparticles are cross-linked and loaded on the enrofloxacin aptamer.

2. A method for preparing the multimodal biosensor according to claim 1, characterized in that: The following steps are involved: Adding a gold nanoparticle solution to the enrofloxacin aptamer, performing a modification reaction under the action of a cross-linking agent, and obtaining a gold nanoparticle-modified enrofloxacin aptamer solution; A magnetic covalent organic framework solution was added to the gold nanoparticle-modified enrofloxacin aptamer solution to carry out an adsorption connection reaction to obtain a multimodal biosensor.

3. The method for preparing the multimodal biosensor according to claim 2, characterized in that: The volume ratio of the enrofloxacin aptamer to the gold nanoparticle solution is 1:5-20, the concentration of the enrofloxacin aptamer is 10 μM-20 μM, and the concentration of the gold nanoparticle solution is 4 mM-10 mM.

4. The method for preparing the multimodal biosensor according to claim 2, characterized in that: The volume ratio of enrofloxacin aptamer to cross-linking agent is 1:0.5-2, the concentration of cross-linking agent is 0.5mM-2mM, and the cross-linking agent is obtained by mixing 1-ethyl-(3-dimethylaminopropyl)carbodiimide and N-hydroxysuccinimide in a mass ratio of 1:

1.

5. The method for preparing the multimodal biosensor according to claim 2, characterized in that: The nucleotide sequence of the enrofloxacin aptamer is: CCCATCAGGGGGCTAGGCTAACACGGTTCGGCTCTCTGAGCCCGGGTTATTTCAGGGGGA.

6. The method for preparing the multimodal biosensor according to claim 2, characterized in that: The volume ratio of the gold nanoparticle-modified enrofloxacin aptamer solution to the magnetic covalent organic framework solution is 1:0.2-1, the concentration of the magnetic covalent organic framework solution is 2 mg / L-5 mg / L, and the final concentration of the gold nanoparticle-modified enrofloxacin aptamer solution is 100 nM-700 nM.

7. The method for preparing the multimodal biosensor according to claim 1, characterized in that: The conditions of the adsorption connection reaction are: shaking at room temperature for 5 min to 10 min.

8. Use of the multi-mode biosensor according to claim 1 in detecting enrofloxacin in water or food, characterized in that: The food includes milk and chicken.

9. Use of the multi-mode biosensor according to claim 8 in detecting enrofloxacin in water or food, characterized in that: The detection method of the biosensor is fluorescence method, colorimetry method or intelligent image recognition method.

10. Use of the multi-mode biosensor according to claim 9 in detecting enrofloxacin in water or food, characterized in that: The intelligent image recognition method comprises the following steps: Image processing software was used to read the RGB values ​​of samples with different known enrofloxacin concentrations after color development, and the grayscale values ​​were calculated using the RGB values ​​to construct a linear response relationship between the enrofloxacin concentration and the grayscale value, and the curve with the highest fitting degree was selected as the enrofloxacin detection standard curve; The linear regression equation for the detection of enrofloxacin concentration and gray value is: y1=-15.8249x1+163.7164, where x1 is the gray value, y1 is the enrofloxacin concentration in the sample to be tested, and the detection linear range is 10 ng / mL~5×10 4 ng / mL, the detection limit was 0.12ng / mL; The concentration of enrofloxacin in the sample to be tested is obtained according to the obtained enrofloxacin detection linear regression equation and the measured gray value of the sample to be tested.

Images