Method for producing oligonucleotide

Abstract

The present invention provides: a method for producing an oligonucleotide by a solid-phase synthesis method; and an oligonucleotide in which the content ratio of N-1mer in the oligonucleotide is equal to or less than a certain amount. Comprising a step in which an oligonucleotide, in which the 5 '-terminal hydroxyl group is protected by a protecting group that can be removed under acidic conditions, is reacted with an acid in the presence of a thiol, thereby removing the protecting group of the 5'-terminal hydroxyl group.

Description

Technical Field

[0001] This patent application claims priority and benefits under the Paris Convention based on Japanese Patent Application No. 2022-172158 (filed on October 27, 2022), and all the contents recorded in the above application are incorporated into this specification by reference.

[0002] The present invention relates to a method for producing an oligonucleotide using the phosphoramidite method in solid phase synthesis, wherein a thiol compound is used as a cation scavenger. Background Art

[0003] In recent years, there has been a growing interest in the use of nucleic acid molecules in the medical field. For example, antisense nucleic acids, aptamers, ribozymes, and nucleic acids that induce RNA interference (RNAi), such as siRNA, are referred to as nucleic acid drugs.

[0004] The synthesis of oligonucleotides can be produced by the phosphoramidite method (hereinafter referred to as the "amidite method"), in which a step of deprotecting the protective group of the hydroxyl group at the 5' end is included. This step is carried out by reacting the oligonucleotide whose hydroxyl group at the 5' end is protected with an acid. This reaction is an equilibrium reaction in which the protective group of the hydroxyl group at the 5' end is released in the form of a cation, and is a reversible reaction.

[0005] In liquid phase synthesis, as the above-mentioned deprotection reaction proceeds, the cation of the deprotected protecting group (e.g., 4,4'-dimethoxytrityl cation) increases in the system, hindering the equilibrium reaction of the deprotection reaction. Therefore, in order to make the reaction proceed, a method of using a cation scavenger is known (see Patent Document 1).

[0006] On the other hand, it is known that in solid phase synthesis, in terms of synthesis operation, the above-mentioned cation is not retained in the system but is discharged outside the system, so the equilibrium reaction is carried out smoothly, and the aforementioned liquid phase synthesis problem (referring to non-patent literature 1) will not occur. It can be seen that there is no need to use a cation scavenger in solid phase synthesis. So far, it has been reported that triethylsilane is used as a cation scavenger to implement a method for deprotection reaction (referring to patent documentation 2) in solid phase synthesis. However, the effect of the cation scavenger of triethylsilane in the method is insufficient.

[0007] Prior art literature

[0008] Patent Literature

[0009] Patent Document 1: International Publication No. 2012 / 157723

[0010] Patent Document 2: U.S. Patent No. 5,510,476

[0011] Non-patent literature

[0012] Non-patent literature 1: J.Am.Chem.Society.,2020,142,16610 Summary of the invention

[0013] Problems to be solved by the invention

[0014] The present invention aims to provide a method for producing an oligonucleotide, which is a method for producing an oligonucleotide using the phosphoramidite method in solid phase synthesis, wherein the deprotection reaction of the hydroxyl group at the 5' end is efficiently carried out, and the yield and purity of the synthesized oligonucleotide are improved. The present invention also aims to provide an oligonucleotide having a significantly lower content ratio of N-1mer in the oligonucleotide.

[0015] Means for solving problems

[0016] The inventors of the present application have repeatedly conducted in-depth studies to achieve the above-mentioned purpose, and as a result, found that by using a thiol compound as a cation scavenger, the deprotection reaction of the protective group of the 5' hydroxyl group is efficiently carried out, and the yield and purity of the obtained oligonucleotide are improved. As a result, the present invention provides a method for producing an oligonucleotide and an oligonucleotide in which the content ratio of N-1mer in the oligonucleotide is less than a certain amount, and the production method is a method for producing an oligonucleotide based on a solid phase synthesis method, comprising a step of making the hydroxyl group at the 5' end protected by a protective group that can be removed under acidic conditions, and reacting with an acid in the presence of a thiol to remove the hydroxyl group at the 5' end.

[0017] The present invention includes the following aspects, but is not limited to these.

[0018] [1] A method for producing an oligonucleotide (hereinafter referred to as "the production method of the present invention"), which is a method for producing an oligonucleotide based on a solid phase synthesis method, comprising the steps of reacting an oligonucleotide whose 5'-terminal hydroxyl group is protected by a protecting group that can be removed under acidic conditions with an acid in the presence of a thiol to thereby remove the protecting group of the 5'-terminal hydroxyl group.

[0019] [2] The production method according to [1], wherein the thiol is a C2-C20 alkylthiol or a C4-C8 cycloalkylthiol.

[0020] [3] The production method according to any one of [1] or [2], wherein the mercaptan is 1-dodecanethiol or cyclohexanethiol.

[0021] [4] The production method according to any one of [1] to [3], wherein the protecting group of the hydroxyl group at the 5' end is a protecting group represented by the following formula:

[0022] [Chemical formula 1]

[0023]

[0024] (Where R 1 , R 2 and R 3 are the same or different from each other and each independently represents hydrogen or alkoxy. ).

[0025] [5] The production method according to any one of [1] to [4], wherein the protecting group of the hydroxyl group at the 5' end is a 4,4'-dimethoxytrityl group (DMTr group).

[0026] [6] The production method according to any one of [1] to [5], wherein the acid is trifluoroacetic acid, dichloroacetic acid, trifluoromethanesulfonic acid, trichloroacetic acid, methanesulfonic acid, hydrochloric acid, acetic acid or p-toluenesulfonic acid.

[0027] [7] The production method according to any one of [1] to [5], wherein the acid is dichloroacetic acid.

[0028] [8] The production method according to [7], wherein the acid is dichloroacetic acid in the coexistence of an aprotic inert solvent having a lower boiling point than dichloroacetic acid.

[0029] [9] The production method according to [8], wherein the aprotic inert solvent having a boiling point lower than that of dichloroacetic acid is one or more solvents selected from dichloromethane, acetonitrile or an aromatic organic solvent.

[0030]

[10] The production method according to [9], wherein the aromatic organic solvent is toluene.

[0031]

[11] The method according to [7], wherein the dichloroacetic acid is a dichloroacetic acid in which the molar ratio of formaldehyde to dichloroacetic acid is 81×10 -5 Below, and the molar ratio of dichloroacetic anhydride to dichloroacetic acid is 20×10 -5 The following dichloroacetic acid.

[0032]

[12] The method according to any one of [1] to

[11] , wherein the oligonucleotide whose 5'-terminal hydroxyl group is protected by a protecting group that can be removed under acidic conditions is an oligonucleotide represented by formula (1),

[0033] [Chemical formula 2]

[0034]

[0035] (Where,

[0036] G 1 represents a protecting group for a hydroxyl group,

[0037] G2 represents a protecting group for a hydroxyl group,

[0038] B a are the same or different from each other, and each independently represents a nucleic acid base that can be protected by a protecting group,

[0039] R are the same or different from each other, and each independently represents a protected hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group or an OQ' group,

[0040] Q' are the same or different from each other, and each independently represents a methylene group bonded to the carbon atom at the 4' position of ribose, an ethylene group bonded to the carbon atom at the 4' position of ribose, or an ethylidene group bonded to the carbon atom at the 4' position of ribose,

[0041] Y are the same or different from each other and each independently represents an oxygen atom or a sulfur atom,

[0042] n represents any integer from 1 to 300,

[0043] W1 represents an OZ group, and X1 represents an R group, or,

[0044] W1 represents an OV group, and X1 represents an OZ group,

[0045] V represents a protective group for a hydroxyl group,

[0046] Z is a group having a structure consisting of a solid phase support and a linking group.

[0047] Furthermore, when n is an integer greater than 2, the nucleic acid molecule represented by formula (1) may include a non-nucleotide linker between each nucleotide.

[0048] The nucleotide in which the protective group of the hydroxyl group at the 5' end is removed is an oligonucleotide represented by formula (2),

[0049] [Chemical formula 3]

[0050]

[0051] (Where,

[0052] G 2 , B a , R, Y, X1, W1 and n are the same as above, and,

[0053] A non-nucleotide linker may be incorporated between the nucleotides in the manner defined in formula (1). ).

[0054]

[13] The method according to

[12] , wherein the oligonucleotide whose 5'-terminal hydroxyl group is protected by a protecting group that can be removed under acidic conditions is an oligonucleotide represented by formula (1'),

[0055] [Chemical formula 4]

[0056]

[0057] (Where,

[0058] G 2 , B a , R, Y, X1, W1 and n are the same as above, and,

[0059] R 1 , R 2 and R 3 are the same or different from each other and each independently represents a hydrogen atom or an alkoxy group. ).

[0060]

[14] The method of production as described in

[13] , wherein R 1 and R 2 is methoxy, R 3 A hydrogen atom.

[0061]

[15] A method for producing an oligonucleotide represented by formula (2'), the method comprising:

[0062]

[12] the process;

[0063] A step of further removing the group represented by Z from the oligonucleotide represented by formula (2) produced in the step; and

[0064] The step of removing the protective groups of the hydroxyl group and the nucleic acid base,

[0065] [Chemical formula 5]

[0066]

[0067] (Where,

[0068] Y and n are the same as above,

[0069] B c are the same or different from each other, and each independently represents a nucleic acid base,

[0070] G 4 are the same or different from each other, and each independently represents a hydrogen ion, an alkali metal ion, an ammonium ion, an alkylammonium ion or a hydroxyalkylammonium ion,

[0071] R' is the same as or different from each other, and each independently represents a hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group or an OQ' group,

[0072] Q' is the same as above, and,

[0073] X3 and W3 each independently represent a hydroxyl group, or

[0074] X3 represents an R' group, and W3 represents a hydroxyl group. And,

[0075] A non-nucleotide linker may be incorporated between the nucleotides in the manner defined in formula (1). ).

[0076]

[16] The production method according to any one of

[12] to

[15] , wherein the oligonucleotide is an oligonucleotide containing ribonucleic acid (RNA).

[0077]

[17] The production method according to

[12] , wherein the oligonucleotide is an oligonucleotide comprising ribonucleic acid (RNA), and the protecting group of the hydroxyl group at the 2' position of the ribose is a protecting group represented by formula (6).

[0078] Formula (6):

[0079] [Chemical formula 6]

[0080]

[0081] (Where,

[0082] q represents any integer from 0 to 5,

[0083] R a and R b are the same or different from each other, and each independently represents a methyl group, an ethyl group or a hydrogen atom,

[0084] The * mark indicates the bonding point to the oxygen atom derived from the hydroxyl group at the 2' position of ribose, and,

[0085] E W represents an electron-withdrawing group. )

[0086]

[18] The method of

[17] , wherein q is 0 or 1, R a and R b are the same or different from each other, and are each independently a methyl group or a hydrogen atom, and E w It is cyano.

[0087]

[19] The production method according to any one of

[12] to

[18] , wherein n is an integer from 1 to 200.

[0088]

[20] The production method according to any one of [1] to

[19] , wherein the obtained oligonucleotide is an oligonucleotide of 100 mer or more.

[0089] [20-1] The production method according to any one of [1] to

[19] , wherein the obtained oligonucleotide is an oligonucleotide of 20 mer or longer.

[0090] [20-2] The production method according to any one of [1] to

[19] , wherein the obtained oligonucleotide is an oligonucleotide of 40 mer or longer.

[0091] [20-3] The production method according to any one of [1] to

[19] , wherein the obtained oligonucleotide is an oligonucleotide of 60 mer or longer.

[0092] [20-4] The production method according to any one of [1] to

[19] , wherein the obtained oligonucleotide is an oligonucleotide of 80 mer or longer.

[0093] [20-5] The production method according to any one of [1] to

[19] , wherein the obtained oligonucleotide is an oligonucleotide of 150 mer or longer.

[0094] [20-6] The production method according to any one of [1] to

[19] , wherein the obtained oligonucleotide is an oligonucleotide of 200 mer or less.

[0095] [20-7] The production method according to any one of [1] to

[19] , wherein the obtained oligonucleotide is an oligonucleotide of 250 mer or less.

[0096] [20-8] The production method according to any one of [1] to

[19] , wherein the obtained oligonucleotide is an oligonucleotide of 300 mer or less.

[0097]

[21] The method according to any one of [1] to

[20] , wherein the molar ratio of the amount of the thiol used relative to the oligonucleotide in which the hydroxyl group at the 5' end is protected by a protecting group that can be removed under acidic conditions is 1 or more.

[0098]

[22] The production method according to any one of [1] to

[21] , wherein the molar ratio of the amount of the thiol used relative to the amount of the acid used is 1 to 100.

[0099]

[23] An oligonucleotide, wherein the oligonucleotide has a chain length of 50 mer or more, and the N-1mer content ratio in the oligonucleotide is less than 5.8%.

[0100] Effects of the Invention

[0101] The present invention provides a method for producing an oligonucleotide, characterized in that the deprotection reaction of the protecting group of the 5' hydroxyl group is efficiently performed by using a thiol compound as a cation scavenger. The production method of the present invention can be expected to improve the yield and purity of the produced oligonucleotide. BRIEF DESCRIPTION OF THE DRAWINGS

[0102] [ Figure 1 ] Figure 1 Route A is a typical example of producing a nucleic acid molecule represented by formula (5) from a nucleic acid molecule represented by formula (1). 1 Any group that can be removed with dichloroacetic acid and functions as a protective group for a hydroxyl group can be used without particular limitation, and a wide range of known protective groups used in amide compounds can be used. 3 The same or different, each independently represents an alkyl group, or two G 3 Bonded to each other to form a ring structure. 3 , are the same or different from each other, and are each independently an alkyl group, for example, preferably a methyl group, an ethyl group, a propyl group or an isopropyl group, and more preferably both are isopropyl groups. Other symbols are the same as those described above. DETAILED DESCRIPTION

[0103] According to one embodiment of the present invention, the present invention relates to a method for producing an oligonucleotide, which is a method for producing an oligonucleotide based on a solid phase synthesis method, comprising the steps of protecting the hydroxyl group at the 5' end of the oligonucleotide with a protecting group that can be removed under acidic conditions, and reacting the oligonucleotide with an acid in the presence of a thiol to remove the protecting group of the hydroxyl group at the 5' end.

[0104] The term "oligonucleotide in which the hydroxyl group at the 5' end is protected by a protective group that can be removed under acidic conditions" used in this specification refers to an oligonucleotide containing a nucleotide in which the hydroxyl group at the 5' end of the nucleotide molecule structure is protected by a protective group that can be removed under acidic conditions. In this specification, "oligonucleotide" is sometimes referred to as "nucleic acid oligomer", and "nucleotide" is sometimes referred to as "nucleic acid molecule".

[0105] The term "the hydroxyl group at the 5' end is protected by a protecting group that can be removed under acidic conditions" is not particularly limited as long as it is a commonly known protecting group. As a specific protecting group, for example, a group represented by the following formula can be mentioned,

[0106] [Chemical formula 7]

[0107]

[0108] (Where R 1 , R 2 and R 3 are the same or different from each other and each independently represents hydrogen or alkoxy. ),

[0109] There are no particular limitations on the group as long as it is a group that can be dissociated as a cation.

[0110] In the protecting group represented by the above formula, R 1 , R 2 and R 3Preferably, one of the alkoxy groups is hydrogen and the remaining two are the same or different (preferably the same) alkoxy groups. The alkoxy group is particularly preferably a methoxy group.

[0111] Specifically, preferred protecting groups include, for example, groups selected from 4,4'-dimethoxytrityl (DMTr group), 4-monomethoxytrityl, and 4,4',4"-trimethoxytrityl groups. 4,4'-dimethoxytrityl (DMTr group) is particularly preferred.

[0112] As the term "thiol" used in this specification, specifically, for example, C2-C20 alkyl mercaptan or C4-C8 cycloalkyl mercaptan can be mentioned. As C2-C20 alkyl mercaptan, for example, ethyl mercaptan, 1-propanethiol, 2-propanethiol, 1-butanethiol, 2-butanethiol, 2-methyl-1-propanethiol (isobutyl mercaptan), 2-methyl-2-propanethiol (tert-butyl mercaptan), 1-pentanethiol, 1-hexanethiol, 1-heptanethiol, 1-octanethiol, 1-nonanethiol, 1-decanethiol, 1-undecanethiol, 1-dodecanethiol, tert-dodecanethiol, 1-tetradecanethiol, 1-pentadecanethiol, 1-hexadecanethiol, 1-octadecanethiol, 1-eicosanethiol. As C4-C8 cycloalkyl mercaptan, for example, cyclobutyl mercaptan, cyclopentanethiol, cyclohexanethiol, cycloheptanethiol, cyclooctanethiol. Preferred examples of the mercaptan include 1-dodecanethiol and cyclohexylthiol.

[0113] The molar ratio of the thiol to the reaction substrate, i.e., the oligonucleotide whose 5'-terminal hydroxyl group is protected by a protecting group that can be removed under acidic conditions, is 1 or more, but is not limited thereto. The molar ratio of the thiol to the acid is 1 to 100, but is not limited thereto.

[0114] The term "acid" refers to an acid used to remove the above-mentioned protecting group in the phosphoramidite method, and specifically, for example, trifluoroacetic acid, dichloroacetic acid, trifluoromethanesulfonic acid, trichloroacetic acid, methanesulfonic acid, hydrochloric acid, acetic acid and p-toluenesulfonic acid can be mentioned, but it is not limited to these. Particularly preferred is dichloroacetic acid.

[0115] As for the dichloroacetic acid used, it is preferred to use high-purity dichloroacetic acid. High-purity dichloroacetic acid refers to dichloroacetic acid in which the content of impurities contained in the dichloroacetic acid is less than a certain amount. As impurities, both or one of formaldehyde and dichloroacetic anhydride used in the process of the production method of dichloroacetic acid can be mentioned.

[0116] For example, the molar ratio of formaldehyde to dichloroacetic acid is 81×10 -5 Below, preferably 41×10 -5 Below, more preferably 81×10 -6In addition, the molar ratio of dichloroacetic anhydride to dichloroacetic acid is 20×10 -5 Below, preferably 10×10 -5 Below, more preferably 50×10 -6 the following.

[0117] Depending on the embodiment of the dichloroacetic acid used, it is preferred to use dichloroacetic acid in which the molar ratio of formaldehyde to dichloroacetic acid is less than the above ratio and / or the molar ratio of dichloroacetic anhydride to dichloroacetic acid is less than the above ratio.

[0118] The dichloroacetic acid can be used in the presence of an inert solvent, either in a liquid form (e.g., a solution, a suspension, or an emulsion) contained in an aprotic inert solvent, or by separately adding the inert solvent to the reaction system. The aprotic inert solvent is an aprotic inert solvent having a lower boiling point than that of dichloroacetic acid used in the method for producing and purifying dichloroacetic acid.

[0119] As the aforementioned aprotic inert solvent having a lower boiling point than dichloroacetic acid, for example, an aprotic inert solvent having a boiling point of 181° C. or less can be cited, and specifically, dichloromethane, acetonitrile and aromatic organic solvents can be cited, but it is not limited to these. As the aromatic organic solvent, for example, toluene, xylene, monochlorobenzene and o-dichlorobenzene can be cited, and toluene can be preferably cited. The amount of the above solvent used is not particularly limited, and typically, it is, for example, about 0.5 to 20 times by weight relative to dichloroacetic acid.

[0120] In addition, in the reaction system containing dichloroacetic acid used in the above-mentioned deprotection reaction, in the coexistence of the above-mentioned aprotic inert solvent having a lower boiling point than dichloroacetic acid, a compound selected from the group consisting of aliphatic alcohols, aliphatic amines and water having a lower boiling point than dichloroacetic acid can be appropriately added.

[0121] As the aliphatic alcohol and aliphatic amine having a lower boiling point than dichloroacetic acid, for example, C1-C6 aliphatic alcohol and C1-C6 aliphatic amine compounds can be exemplified. As examples of C1-C6 aliphatic alcohols, for example, methanol, ethanol, n-propanol, isopropanol, n-butanol, isobutanol, sec-butanol, tert-butanol, n-pentanol, n-hexanol, etc. can be exemplified. As the aliphatic amine having a lower boiling point than dichloroacetic acid, C1-C6 aliphatic amine compounds can be exemplified. Specifically, methylamine, ethylamine, n-propylamine, isopropylamine, n-butylamine, isobutylamine, tert-butylamine, n-pentylamine, n-hexylamine, etc. can be exemplified.

[0122] The amount of the aliphatic alcohol, the aliphatic amine, and water or a mixture thereof used is not particularly limited as long as it is an amount effective for reducing the dichloroacetic anhydride to the desired range.

[0123] Specific examples of the term "oligonucleotide in which the hydroxyl group at the 5' end is protected by a protecting group that can be removed under acidic conditions" used in the present specification include oligonucleotides represented by formula (1):

[0124] [Chemical formula 8]

[0125]

[0126] G 1 represents a protecting group for a hydroxyl group,

[0127] G 2 represents a protecting group for a hydroxyl group,

[0128] B a are the same or different from each other, and each independently represents a nucleic acid base that can be protected by a protecting group,

[0129] R are the same or different from each other, and each independently represents a protected hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group or an OQ' group,

[0130] Q' are the same or different from each other, and each independently represents a methylene group bonded to the carbon atom at the 4' position of ribose, an ethylene group bonded to the carbon atom at the 4' position of ribose, or an ethylidene group bonded to the carbon atom at the 4' position of ribose,

[0131] Y are the same or different from each other and each independently represents an oxygen atom or a sulfur atom,

[0132] n represents any integer from 1 to 300,

[0133] W1 represents an OZ group, and X1 represents an R group, or,

[0134] W1 represents an OV group, and X1 represents an OZ group,

[0135] V represents a protective group for a hydroxyl group,

[0136] Z is a group having a structure consisting of a solid phase support and a linking group.

[0137] Furthermore, when n is an integer greater than or equal to 2, the nucleic acid molecule represented by formula (1) may include a non-nucleotide linker between each nucleotide. )

[0138] According to a more preferred embodiment of the present invention, the oligonucleotide whose 5'-terminal hydroxyl group is protected by a protecting group that can be removed under acidic conditions may be an oligonucleotide represented by formula (1'):

[0139] [Chemical formula 9]

[0140]

[0141] (Where,

[0142] G 2 , B a , R, Y, X1, W1 and n are the same as above, and,

[0143] R 1 , R 2 and R 3 are the same or different from each other and each independently represents a hydrogen atom or an alkoxy group. ).

[0144] According to a further preferred embodiment of the present invention, in the above formula (1'), R 1 , R 2 and R 3 Represents a hydrogen atom.

[0145] According to an embodiment of the present invention, the nucleotide in which the protecting group of the hydroxyl group at the 5' end is removed may be an oligonucleotide represented by formula (2):

[0146] [Chemical formula 10]

[0147]

[0148] (Where,

[0149] G 2 , B a , R, Y, X1, W1 and n are the same as above, and,

[0150] A non-nucleotide linker may be incorporated between the nucleotides in the manner defined in formula (1). ).

[0151] In addition, regarding the nucleotide whose 5'-terminal hydroxyl group-protecting group is removed, according to a preferred embodiment of the present invention, the nucleotide whose 5'-terminal hydroxyl group-protecting group is removed can be an oligonucleotide represented by formula (2'):

[0152] [Chemical formula 11]

[0153]

[0154] (Where,

[0155] Y and n are the same as above,

[0156] B c are the same or different from each other, and each independently represents a nucleic acid base,

[0157] G 4are the same or different from each other, and each independently represents a hydrogen ion, an alkali metal ion, an ammonium ion, an alkylammonium ion or a hydroxyalkylammonium ion,

[0158] R' is the same as or different from each other, and each independently represents a hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group or an OQ' group,

[0159] Q' is the same as above, and,

[0160] X3 and W3 each independently represent a hydroxyl group, or

[0161] X3 represents an R' group, and W3 represents a hydroxyl group. And,

[0162] A non-nucleotide linker may be incorporated between the nucleotides in the manner defined in formula (1). ).

[0163] Examples of the protecting group for the hydroxyl group at the 5' position of the nucleic acid molecule include the following: 1 or G 5 As an oligonucleotide in which the hydroxyl group at the 5' position is protected, an oligonucleotide represented by the aforementioned formula (1) (or including (1')) can be exemplified. As a nucleotide generated by reacting the aforementioned acid (e.g., dichloroacetic acid) with a thiol, an oligonucleotide represented by the aforementioned formula (2) (or including (2')) can be exemplified.

[0164] In the above formulas (1) and (2), as compounds showing a methylene group represented by Q', which is the same or different from each other and each independently bonded to the carbon atom at the 4' position of ribose, an ethylene group bonded to the carbon atom at the 4' position of ribose, or an ethylidene group bonded to the carbon atom at the 4' position of ribose, specifically, the structure represented by LNA-1, LNA-2, or LNA-3 of the following formula (7) can be mentioned.

[0165] [Chemical formula 12]

[0166]

[0167] (Where B a Indicates nucleic acid bases that can be protected. )

[0168] The group represented by Z having a structure consisting of a solid phase carrier and a linking group linking the solid phase carrier to the oxygen atom of the hydroxyl group at the 2' or 3' position of the ribose at the 3' end of the nucleic acid molecule includes, more specifically, the structure represented by the following formula (8).

[0169] [Chemical formula 13]

[0170]

[0171] In formula (8), Sp represents a spacer group.

[0172] As the spacer (Sp), for example, a group having a structural formula represented by the following formula (9) can be exemplified.

[0173] [Chemical formula 14]

[0174]

[0175] The linker may be, for example, a structure represented by the following formula (10), or a structure in which the structure of formula (10) does not have a hexamethyleneamino moiety, that is, an aminopropyl group is bonded to Si. Alternatively, the linker may be a structure represented by the following formula (11).

[0176] [Chemical formula 15]

[0177]

[0178] (Where,

[0179] A can be any one of hydroxyl, alkoxy or alkyl. Examples of alkoxy include methoxy and ethoxy. Examples of alkyl include methyl, ethyl, isopropyl and n-propyl. Si represents an oxygen bond to a hydroxyl group on the surface of the carrier.

[0180] Examples of solid supports include inorganic porous supports and organic resin supports. Examples of inorganic porous supports include controlled pore glass (CPG). Examples of organic resin supports include supports made of polystyrene.

[0181] Examples of nucleosides (ribose and deoxyribose) contained in the nucleic acid molecule used in the present invention include DNA, RNA, 2'-O-MOE (2'-O-methoxyethyl), 2'-O-Me, 2'-F RNA, and the aforementioned LNA, but the aforementioned nucleosides are not limited to these.

[0182] The method for synthesizing an oligonucleotide (nucleic acid oligomer) by solid phase synthesis includes a step of deprotecting the protective group of the hydroxyl group at the 5' end by using an acid (eg, trichloroacetic acid) in the presence of the aforementioned thiol, and typically includes the following steps.

[0183] (1) a step of deprotecting the hydroxyl group at the 5′ position of a hydroxyl-protected nucleoside bonded to a solid support via a linker;

[0184] (2) a step of subjecting the 5'-hydroxyl group generated in the above step to a coupling reaction with a phosphoramidite compound to obtain a phosphite triester compound;

[0185] (3) a step of oxidizing the phosphite triester produced in the above step into a phosphotriester to produce an extended nucleic acid oligomer; or an arbitrary step of converting the phosphite triester produced in the above step into a thiophosphate triester;

[0186] (4) a step of synthesizing a nucleic acid oligomer on a solid phase carrier by repeatedly performing the following series of reaction cycles any number of times, wherein the series of reaction cycles consist of the aforementioned steps (1) to (3), namely, a step of deprotecting the 5'-hydroxyl group of the generated nucleic acid oligomer, a step of coupling the 5'-hydroxyl group with an amide compound, and a step of oxidizing the generated triester phosphite, and

[0187] (5) A step of subjecting the nucleic acid oligomer on the solid support generated in step (4) to a cutting out and deprotecting step to release it from the solid support, thereby producing a nucleic acid oligomer from which the protecting group has been removed. In the above-mentioned method for synthesizing a nucleic acid oligomer, a step of capping the hydroxyl group at the 5' position that has not been subjected to the coupling reaction with the phosphoramidite compound may be included after step (2) or (3), and a capping step may be added between any steps in the cycle of a series of reactions constituting step (4).

[0188] More specifically, the step (5) is implemented in the following manner: the nucleic acid oligomer on the solid phase carrier generated in step (4) is subjected to the following steps (5-1) and (5-2) in the order of reaction, and then subjected to the reaction of step (5-3). Here, the reaction of step (5-1) can be carried out arbitrarily, and the reaction of step (5-2) can also be carried out using the method described in Japanese Patent Gazette No. 4705716. As a result, a nucleic acid oligomer in which the protecting group is removed from the nucleic acid oligomer free from the solid phase carrier, or a nucleic acid oligomer in which the hydroxyl group at the 5' end is protected can be produced.

[0189] (5-1) a reaction for deprotecting the protective group of the hydroxyl group at the 5' end of the nucleic acid oligomer;

[0190] (5-2) a reaction of cutting out the nucleic acid oligomer from the solid phase carrier and releasing it; and

[0191] (5-3) A reaction of deprotecting the protecting group of the hydroxyl group at the 2' position or the 3' position of the ribose constituting the nucleic acid oligomer.

[0192] The route of the above steps (1) to (5) is shown in Figure 1 . Figure 1 The deprotection reaction in the step (1) or step (4) shown is carried out using the aforementioned dichloroacetic acid and thiol compound. The definitions of the substituents in the chemical formula in Scheme A are the same as those defined above.

[0193] For the nucleic acid oligomer of the aforementioned formula (1), the amide method can be further used to extend only any chain length using a nucleotide-type or non-nucleotide-type linker, and used to produce the nucleic acid oligomer represented by the aforementioned formula (3). It is also possible to cut out only the nucleic acid oligomer from the nucleic acid oligomer of the aforementioned formula (3) bonded to the solid phase carrier, and further deprotect it to obtain the nucleic acid oligomer represented by the aforementioned formula (5). The substituents in each formula are further described in detail below.

[0194] B a The nucleic acid bases which can be protected by protecting groups and B c The nucleic acid base represented is not particularly limited. As the nucleic acid base, adenine, cytosine, guanine, uracil, thymine, 5-methylcytosine, pseudouracil, and 1-methylpseudouracil etc. can be enumerated. In addition, the nucleic acid base can be substituted by a substituent. As such a substituent, for example, a halogen atom such as a fluorine group, a chlorine group, a bromine group, an iodine group, an acyl group such as an acetyl group, an alkyl group such as a methyl group, an ethyl group, an aralkyl group such as a benzyl group, an alkoxy group such as a methoxy group, an alkoxyalkyl group such as a methoxyethyl group, a cyanoalkyl group such as a cyanoethyl group, a hydroxyl group, a hydroxyalkyl group, an acyloxymethyl group, an amino group, a monoalkylamino group, a dialkylamino group, a carboxyl group, a cyano group, a nitro group, and the like, and a combination of two or more substituents therein can be enumerated.

[0195] As B a The protecting group of the nucleic acid base that can be protected by a protecting group is not particularly limited, and the protecting groups used in known nucleic acid chemistry can be used. As such a protecting group, for example, benzoyl, 4-methoxybenzoyl, 4-methylbenzoyl, acetyl, propionyl, butyryl, isobutyryl, phenylacetyl, phenoxyacetyl, 4-tert-butylphenoxyacetyl, 4-isopropylphenoxyacetyl, (dimethylamino)methylene, etc., and a combination of two or more of these protecting groups can be mentioned.

[0196] More specifically, B a It represents a group shown in any of the following.

[0197] [Chemical formula 16]

[0198]

[0199] (In the above formula,

[0200] R 4 represents a hydrogen atom, a methyl group, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, a phenylacetyl group, an acetyl group or a benzoyl group,

[0201] R 5 represents a hydrogen atom, an acetyl group, an isobutyryl group or a benzoyl group,

[0202] R 6 represents a hydrogen atom, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, a phenylacetyl group, an acetyl group or an isobutyryl group,

[0203] R 7 represents 2-cyanoethyl,

[0204] R 8 represents a hydrogen atom, a methyl group, a benzoyl group, a 4-methoxybenzoyl group or a 4-methylbenzoyl group, and

[0205] R 9 represents dimethylaminomethylene. ).

[0206] As B c More specifically, the above B a A group obtained by removing the protecting group from the specific example of .

[0207] Figure 1 G 1 and G 5 (corresponding to G defined in formula (I) described in this specification 1 ) is preferably the following group.

[0208] [Chemical formula 17]

[0209]

[0210] (Where,

[0211] R 1 , R 2 and R 3 are the same or different from each other and each independently represents a hydrogen atom or an alkoxy group. )

[0212] R 1 , R 2 and R 3 Preferably, one of the alkoxy groups is a hydrogen atom, and the remaining two alkoxy groups are the same or different (preferably the same), and the alkoxy group is particularly preferably a methoxy group. 5 It is 4,4'-dimethoxytrityl (DMTr group).

[0213] As G 2 As long as it can function as a protecting group for a hydroxyl group, it can be used without particular limitation, and known protecting groups used in amide compounds can be widely used. 2For example, there can be mentioned an alkyl group, an alkenyl group, an alkynyl group, a cycloalkyl group, a haloalkyl group, an aryl group, a heteroaryl group, an aralkyl group, a cycloalkenyl group, a cycloalkylalkyl group, a cyclylalkyl group, a hydroxyalkyl group, an aminoalkyl group, an alkoxyalkyl group, a heterocyclylalkenyl group, a heterocyclylalkyl group, a heteroaralkyl group, a silyl group, a siloxyalkyl group, a monoalkylsilyl group, a dialkylsilyl group or a trialkylsilyl group, a monoalkylsiloxyalkyl group, a dialkylsiloxyalkyl group or a trialkylsiloxyalkyl group, and they may be substituted with one or more electron withdrawing groups.

[0214] G 2 Preferably, the electron withdrawing group (E W ) substituted alkyl. Examples of the electron withdrawing group include cyano, nitro, alkylsulfonyl, halogen, arylsulfonyl, trihalomethyl and trialkylamino groups, and cyano is preferred.

[0215] As G 2 , the following groups are particularly preferred.

[0216] [Chemical formula 18]

[0217]

[0218] The aforementioned R 1 , R 2 , R 3 and G 2 The alkyl group in the definition of may be any of a linear or branched chain, preferably an alkyl group having 1 to 12 carbon atoms, and more preferably an alkyl group having 1 to 6 carbon atoms. Specific examples of the alkyl group include, for example, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, n-pentyl, isopentyl, and hexyl. The alkyl part constituting the alkoxy group in the definition of the above substituent has the same definition as the alkyl group herein.

[0219] In addition, in the method of the present invention, the amide compound can be used in a free state or in a salt state. As the salt of the amide compound, base addition salts or acid addition salts can be cited, without particular limitation. As base addition salts, specifically, salts formed with inorganic bases such as sodium salts, magnesium salts, potassium salts, calcium salts, aluminum salts, etc.; salts formed with organic bases such as methylamine, ethylamine, ethanolamine, etc.; salts formed with basic amino acids such as lysine, ornithine, arginine, and ammonium salts. As acid addition salts, specifically, inorganic acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, etc.; organic acids such as formic acid, acetic acid, propionic acid, oxalic acid, malonic acid, malic acid, tartaric acid, fumaric acid, succinic acid, lactic acid, maleic acid, citric acid, methanesulfonic acid, trifluoromethanesulfonic acid, ethanesulfonic acid, etc.; and acid addition salts formed with acidic amino acids such as aspartic acid and glutamic acid. Amide compounds also include salts, hydrates, solvates, and polymorphs.

[0220] R preferably represents a protected hydroxyl group. As long as the protecting group when R represents a protected hydroxyl group or the protecting group of the hydroxyl group represented by V can be used for amide method, for example, 2'-tert-butyldimethylsilyl (TBS group), 2'-bis (2-acetoxyethoxy) methyl (ACE group), 2'-(triisopropylsiloxy) methyl (TOM group), 2'-(2-cyanoethoxy) ethyl (CEE group), 2'-(2-cyanoethoxy) methyl (CEM group) (International Publication No. 2006 / 022323), 2'-toluenesulfonylethoxymethyl (TEM group), 2'-EMM group (International Publication No. 2013 / 027843) and 2'-PMM group (International Publication No. 2019 / 208571) can be used. V is preferably 2'-tert-butyldimethylsilyl (TBS group). In addition, when the nucleic acid molecule produced by the method of the present invention is a ribonucleic acid (RNA), etc., when the nucleic acid molecule contains ribose, as a protecting group for the hydroxyl group at the 2' position of the ribose, the protecting group represented by the above formula (6) can be exemplified as a preferred protecting group. W The protecting group represented by the formula (12) is an electron withdrawing group.

[0221] Formula (6):

[0222] [Chemical formula 19]

[0223]

[0224] (Where,

[0225] q represents any integer from 0 to 5,

[0226] R a and R b are the same or different from each other, and each independently represents a methyl group, an ethyl group or a hydrogen atom,

[0227] The * mark indicates the bonding point to the oxygen atom derived from the hydroxyl group at the 2' position of ribose, and,

[0228] E W represents an electron withdrawing group. ).

[0229] Formula (12):

[0230] [Chemical formula 20]

[0231]

[0232] (Where,

[0233] q, R a and R bThe same definition as in the above formula (6).

[0234] More preferably, in the group represented by formula (12), q is 1, R a and R b A group in which q is 1 and R a or R b A group in which one of them is a methyl group and the other is a hydrogen atom.

[0235] The protecting group represented by formula (6) (including formula (12)) can be synthesized according to the description of International Publication No. 2013 / 027843 and International Publication No. 2019 / 208571, for example, and the amide compound having the protecting group can be used for the production of nucleic acid compounds.

[0236] Nucleic acid extension reaction using Figure 1 An amide compound represented by formula (13) described in route A.

[0237] As a non-nucleotide linker, a linker formed by an amino acid backbone can be exemplified (for example, a linker formed by an amino acid backbone recorded in International Publication No. 2006 / 022323 or International Publication No. 2013 / 027843). Specifically, as a non-limiting example, for example, a linker represented by formula (A14-1) or (A14-2) or (A14-3) (for example, recorded in International Publication No. 2019 / 074110) can be exemplified. In addition to these linkers, the linkers recorded in International Publication No. 2012 / 005368, International Publication No. 2018 / 182008, or International Publication No. 2019 / 074110 can also be exemplified.

[0238] [Chemical formula 21]

[0239]

[0240] (Wherein, Y is the same as above.)

[0241] Nucleotides and amides in which the R group in formula (13) and the R' group in formula (5) are substituents other than hydroxyl groups can also be produced by synthesizing nucleosides using known methods described in Japanese Patent No. 3745226, International Publication No. 2001 / 053528 or Japanese Patent Publication No. 2014-221817, and known methods cited in these documents. In addition, substances that can be purchased as commercial products can be used to produce according to the methods described in the examples described below or by methods obtained by appropriately modifying these methods.

[0242] G 4represents a hydrogen atom, an alkali metal ion, an ammonium ion, an alkylammonium ion, or a hydroxyalkylammonium ion. Examples of the alkali metal ion include sodium ions and lithium ions. In addition, as for the alkylammonium ion, as specific examples of the alkyl group, for example, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, n-pentyl, isopentyl, and hexyl can be mentioned. More specifically, for example, diethylammonium ion, triethylammonium ion, tetrabutylammonium ion, hexylammonium ion, and dibutylammonium ion can be mentioned. In addition, as for the hydroxyalkylammonium ion, as specific examples of the hydroxyalkyl part, for example, hydroxymethyl, hydroxyethyl, hydroxyn-propyl, hydroxyisopropyl, hydroxyn-butyl, and trihydroxymethyl can be mentioned. As more specific examples of the hydroxyalkylammonium ion, trihydroxymethylammonium ion can be mentioned. G 4 Preferably it represents a hydrogen atom.

[0243] G 5 represents a hydrogen atom or a protective group for the hydroxyl group. When it represents a protective group, G 1 Also represents the same protecting group. 5 When deprotected, the nucleotide compound is a hydrogen atom, and the nucleotide compound is then subjected to a series of nucleic acid extension reaction steps.

[0244] Y is preferably an oxygen atom.

[0245] As for W1 and X1, it is preferred that W1 represents an OZ group and X1 represents an R group.

[0246] As for W2 and X2, it is preferred that W2 represents a hydroxyl group and X2 represents an R group.

[0247] W3 and X3 each independently preferably represent a hydroxyl group.

[0248] R' is preferably a hydroxyl group.

[0249] In the synthesis of nucleic acid oligomers by the amide method in the above steps (1) to (5), Figure 1 In addition to the deprotection step of the present invention in step (1) of the route or step (5), the nucleic acid extension reaction can be carried out according to a generally known method (for example, the method described in the aforementioned Japanese Patent No. 5157168 or Japanese Patent No. 5554881). Each step is described below.

[0250] (Nucleic acid extension reaction)

[0251] In this specification, the so-called "nucleic acid extension reaction" refers to a reaction in which nucleotides are sequentially bonded via a phosphodiester bond to extend an oligonucleotide. The nucleic acid extension reaction can be carried out according to the steps of the conventional phosphoramidite method. The nucleic acid extension reaction can also be carried out using a nucleic acid automatic synthesis device using the phosphoramidite method.

[0252] The chain length (N) of the nucleic acid molecule can be, for example, 20mer or more (i.e., n ≥ 19), 40mer or more (i.e., n ≥ 39), 50mer or more (i.e., n ≥ 49), 60mer or more (i.e., n ≥ 59), 80mer or more (i.e., n ≥ 79), 100mer or more (i.e., n ≥ 99), 200mer or more (i.e., n ≥ 199), 2 to 300mer (i.e., 1 ≤ n ≤ 299), 2 to 250mer (i.e., 1 ≤ n ≤ 249), 2 to 200mer (i.e., 1 ≤ n ≤ 199), 10 ~300mer (i.e., 9≤n≤299), 10~250mer (i.e., 9≤n≤249), 10~200mer (i.e., 9≤n≤199), 10~150mer (i.e., 9≤n≤149), 15~300mer (i.e., 14≤n≤299), 15~250mer (i.e., 14≤n≤249), 15~200mer (i.e., 14≤n≤199), 15~150mer (i.e., 14≤n≤149), and 15~110mer (i.e., 14≤n≤109).

[0253] The deprotection step of step (1) is a step of deprotecting the protecting group of the 5' hydroxyl group at the end of the oligonucleotide chain supported on the solid phase carrier. As a common protecting group, 4,4'-dimethoxytrityl (DMTr group), 4-monomethoxytrityl, 4,4',4"-trimethoxytrityl can be used. Deprotection can be carried out using an acid. As the acid for deprotection, for example, trifluoroacetic acid, dichloroacetic acid, trifluoromethanesulfonic acid, trichloroacetic acid, methanesulfonic acid, hydrochloric acid, acetic acid and p-toluenesulfonic acid can be cited.

[0254] The condensation step of step (2) is to Figure 1The reaction of the nucleoside phosphoramidite represented by the following formula (13) described in route A with the 5' hydroxyl group at the end of the oligonucleotide chain deprotected by the above-mentioned deprotection step. It should be noted that as the phosphoramidite used in nucleic acid extension, formula (13), uridine EMM amide described in Example 2 of International Publication No. 2013 / 027843, cytidine EMM amide described in Example 3, adenosine EMM amide described in Example 4, and guanosine EMM amide described in Example 5, uridine PMM amide, cytidine PMM amide, adenosine PMM amide, and guanosine PMM amide described in International Publication No. 2019 / 208571 can be exemplified. In addition, as other usable phosphoramidites, 2'-OMe, 2'-F, 2'-O-tert-butyldimethylsilyl, 2'-O-methoxyethyl, 2'-bis(2-acetoxyethoxy)methyl (ACE group), 2'-(triisopropylsilyloxy)methyl (TOM group), 2'-(2-cyanoethoxy)ethyl (CEE group), 2'-(2-cyanoethoxy)methyl (CEM group), 2'-toluenesulfonylethoxymethyl (TEM group), 2'-H, and 2'-fluoro-2'-deoxy-β-D-arabinofuranosyl, etc. can be cited. As the above-mentioned nucleoside phosphoramidite, a nucleoside phosphoramidite protected by a protecting group (e.g., DMTr group) is used. The condensation step can be performed using an activator or condensing agent that activates the above-mentioned nucleoside phosphoramidite. Examples of the activator or condensing agent include 5-benzylthio-1H-tetrazolyl (BTT) (also referred to as 5-benzylmercapto-1H-tetrazolyl), 1H-tetrazolyl, 4,5-dicyanoimidazole (DCI), 5-ethylthio-1H-tetrazolyl (ETT), N-methylbenzimidazolium trifluoromethanesulfonate (N-MeBIT), benzimidazolium trifluoromethanesulfonate (BIT), N-phenylimidazolium trifluoromethanesulfonate (N-PHIMT), imidazolium trifluoromethanesulfonate (IMT), 5-nitrobenzimidazolium trifluoromethanesulfonate (NBT), 1-hydroxybenzotriazole (HOBT), and 5-(bis-3,5-trifluoromethylphenyl)-1H-tetrazolyl.

[0255] Figure 1 The nucleoside phosphoramidite (hereinafter referred to as amide) represented by formula (13) described in route A is shown below.

[0256] The compound represented by the following formula:

[0257] [Chemical formula 22]

[0258]

[0259] (Where,

[0260] G 1 , G 2 , G3 , B a and R are the same as above. ).

[0261] After the condensation step, the unreacted 5' hydroxyl group may be capped as appropriate. The capping may be performed using a known capping solution such as an acetic anhydride-tetrahydrofuran solution or a phenoxyacetic anhydride / N-methylimidazole solution.

[0262] The oxidation step of step (3) is a step of converting the phosphite group formed by the above-mentioned condensation step into a phosphate group or a thiophosphorothioate group. This step is a reaction in which trivalent phosphorus is converted into pentavalent phosphorus using an oxidizing agent, and can be carried out by reacting the oxidizing agent with the oligonucleic acid derivative supported on a solid phase carrier.

[0263] In the case of converting a phosphite group into a phosphate group, as an "oxidant", for example, iodine can be used. The oxidant can be prepared and used in a concentration of 0.005 to 2M. As an oxygen source for oxidation, water can be used, and as a base for the reaction, pyridine, N-methylimidazole (NMI), N-methylmorpholine or triethylamine can be used. In addition, as a solvent, it is not particularly limited as long as it does not participate in the reaction, and acetonitrile, tetrahydrofuran (THF) or a mixed solvent of any proportion thereof can be cited. For example, iodine / water / pyridine / acetonitrile, or iodine / water / pyridine, or iodine / water / pyridine / NMI, or iodine / water / pyridine / THF can be used. The reaction temperature is preferably 5°C to 50°C. The reaction time is generally appropriate for 1 minute to 30 minutes. The amount of the reagent used is preferably 1 to 100 mol, more preferably 1 to 10 mol, relative to 1 mol of the compound supported on the solid phase carrier.

[0264] When converting a phosphite triester group into a thiophosphothioate triester group, as an "oxidant", for example, sulfur, 3H-1,2-benzodithiol-3-one-1,1-dioxide (Beaucage reagent), 3-amino-1,2,4-dithiazole-5-thione (ADTT), 5-phenyl-3H-1,2,4-dithiazol-3-one (POS), [(N,N-dimethylaminomethyl)amino]-3H-1,2,4-dithiazoline-3-thione (DDTT), and phenylacetyl disulfide (PADS) can be used. The oxidant can be used after being diluted with an appropriate solvent in a concentration of 0.001 to 2M. The solvent used in the reaction is not particularly limited as long as it does not participate in the reaction, and for example, dichloromethane, acetonitrile, pyridine, or a mixed solvent thereof in any ratio can be cited. The oxidation step can be performed after the aforementioned capping operation, or vice versa, the capping operation can be performed after the oxidation step, and the order is not limited.

[0265] In step (5-1), the protecting group of the hydroxyl group at the 5' position of the nucleotide introduced at the end of the extension can be used for column purification using the protecting group of the hydroxyl group at the 5' position as a label after being cut out from the solid phase support described later and the protecting group is deprotected, or the protecting group of the hydroxyl group at the 5' position can be deprotected after column purification.

[0266] In step (5-2), after the synthesis of the nucleic acid having the desired sequence is completed, an amine compound is allowed to act to deprotect the protecting group of the phosphate moiety. Examples of the amine compound include diethylamine described in Japanese Patent No. 4705716.

[0267] The excision of the nucleic acid molecule extended to a desired chain length on the solid phase support from the solid phase support in step (5-2) is usually carried out using concentrated aqueous ammonia as an excision agent.

[0268] Furthermore, using ammonia or an amine compound, for example, the oligonucleotide chain is cleaved from the solid phase support and recovered. Examples of the amine compound include methylamine, ethylamine, isopropylamine, ethylenediamine, and diethylamine.

[0269] In step (5-3), the protecting group of the hydroxyl group at the 2' or 3' position of the ribose of the nucleic acid oligomer (4) cut out from the solid phase support in step (5-2) can be removed according to the method described in International Publication No. 2006 / 022323, International Publication No. 2013 / 027843, or International Publication No. 2019 / 208571 to obtain a deprotected nucleic acid molecule (5).

[0270] As nucleic acid oligomers (oligonucleotides) that can be manufactured using the manufacturing method of the present invention, examples of nucleic acid oligomers in which the nucleosides contained in the nucleic acid oligomers are RNA, DNA, and RNA with 2'-O-MOE, 2'-O-Me, 2'-F, and LNA nucleic acid molecules can be cited, but are not limited to these. For example, examples of various nucleosides described in Xiulong, Shen et al., Nucleic Acids Research, 2018, Vol. 46, No. 46, 1584-1600, and Daniel O'Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, 546-558 can be cited. The nucleic acid oligomer manufactured by the method of the present invention is preferably ribonucleic acid (RNA). More preferably, the nucleic acid oligomer manufactured by the method of the present invention is ribonucleic acid (RNA), and the protecting group of the hydroxyl group at the 2' position of the ribose is a nucleic acid oligomer represented by formula (6).

[0271] By using the production method of the present invention, as one embodiment, an oligonucleotide having a reduced content of nucleotide deletion forms (also referred to as N-1mers) in the oligonucleotide can be produced.

[0272] Here, in an oligonucleotide, the content of N-1mer relative to the full-length form (FLP (Full Length Product)) in the oligonucleotide, that is, the content (%) of N-1mer when the content of the full-length form (FLP) in the oligonucleotide is set to 100%, is defined as the "N-1mer content ratio".

[0273] Specifically, examples of the content ratio of N-1mer in the oligonucleotide include less than 5.8%, less than 5.7%, less than 5.5%, less than 5%, less than 4.5%, less than 4%, less than 3.5%, less than 3%, less than 2.5%, less than 2.3%, less than 2.3%, less than 2.1%, and 2.1%. In addition, examples include greater than 0%, more than 0.001%, more than 0.01%, and more than 0.1%, but are not limited to these.

[0274] Specific examples of the oligonucleotide include the following oligonucleotides, but the oligonucleotides are not limited thereto.

[0275] An oligonucleotide in which the content ratio of N-1mer in the oligonucleotide is less than 5.8%.

[0276] An oligonucleotide having an N-1mer content ratio of 5.7% or less in the oligonucleotide.

[0277] An oligonucleotide having an N-1mer content ratio of 5.5% or less in the oligonucleotide.

[0278] An oligonucleotide having an N-1mer content ratio of 5% or less in the oligonucleotide.

[0279] An oligonucleotide having an N-1mer content ratio of 4.5% or less in the oligonucleotide.

[0280] An oligonucleotide having an N-1mer content ratio of 4% or less in the oligonucleotide.

[0281] An oligonucleotide having an N-1mer content ratio of 3.5% or less in the oligonucleotide.

[0282] An oligonucleotide having an N-1mer content ratio of 3% or less in the oligonucleotide.

[0283] An oligonucleotide having an N-1mer content ratio of 2.5% or less in the oligonucleotide.

[0284] An oligonucleotide having an N-1mer content ratio of 2.3% or less in the oligonucleotide.

[0285] An oligonucleotide having an N-1mer content ratio of 2.1% or less in the oligonucleotide.

[0286] An oligonucleotide having a chain length of 50 mer or longer and an N-1mer content ratio in the oligonucleotide of less than 5.8%.

[0287] An oligonucleotide having a chain length of 50 mer or longer and an N-1mer content ratio in the oligonucleotide of 5.7% or less.

[0288] An oligonucleotide having a chain length of 50 mer or longer and an N-1mer content ratio in the oligonucleotide of 5.5% or less.

[0289] An oligonucleotide having a chain length of 50 mer or longer and an N-1 mer content ratio in the oligonucleotide of 5% or less.

[0290] An oligonucleotide having a chain length of 50 mer or longer and an N-1mer content ratio in the oligonucleotide of 4.5% or less.

[0291] An oligonucleotide having a chain length of 50 mer or longer and an N-1 mer content ratio in the oligonucleotide of 4% or less.

[0292] An oligonucleotide having a chain length of 50 mer or longer and an N-1mer content ratio in the oligonucleotide of 3.5% or less.

[0293] An oligonucleotide having a chain length of 50 mer or longer and an N-1mer content ratio in the oligonucleotide of 3% or less.

[0294] An oligonucleotide having a chain length of 50 mer or longer and an N-1mer content ratio in the oligonucleotide of 2.5% or less.

[0295] An oligonucleotide having a chain length of 50 mer or longer and an N-1mer content ratio in the oligonucleotide of 2.3% or less.

[0296] An oligonucleotide having a chain length of 50 mer or longer and an N-1mer content ratio in the oligonucleotide of 2.1% or less.

[0297] An oligonucleotide having a chain length of 50 mer or more and 200 mer or less, and an oligonucleotide having an N-1mer content ratio of less than 5.8% in the oligonucleotide.

[0298] An oligonucleotide having a chain length of 50 mer or more and 200 mer or less, and an N-1mer content ratio in the oligonucleotide of 5.7% or less.

[0299] An oligonucleotide having a chain length of 50 mer or more and 200 mer or less, and an N-1mer content ratio in the oligonucleotide of 5.5% or less.

[0300] The oligonucleotide chain length is 50 mer or more and 200 mer or less, and the content ratio of N-1mer in the oligonucleotide is 5% or less.

[0301] An oligonucleotide having a chain length of 50 mer or more and 200 mer or less, and an N-1mer content ratio in the oligonucleotide of 4.5% or less.

[0302] An oligonucleotide having a chain length of 50 mer or more and 200 mer or less, and an N-1mer content ratio in the oligonucleotide of 4% or less.

[0303] An oligonucleotide having a chain length of 50 mer or more and 200 mer or less, and an N-1mer content ratio in the oligonucleotide of 3.5% or less.

[0304] An oligonucleotide having a chain length of 50 mer or more and 200 mer or less, and an N-1mer content ratio in the oligonucleotide of 3% or less.

[0305] An oligonucleotide having a chain length of 50 mer or more and 200 mer or less, and an N-1mer content ratio in the oligonucleotide of 2.5% or less.

[0306] An oligonucleotide having a chain length of 50 mer or more and 200 mer or less, and an N-1mer content ratio in the oligonucleotide of 2.3% or less.

[0307] An oligonucleotide having a chain length of 50 mer or more and 200 mer or less, and an N-1mer content ratio in the oligonucleotide of 2.1% or less.

[0308] An oligonucleotide having a chain length of 50 mer or more and 250 mer or less, and an oligonucleotide having an N-1mer content ratio of less than 5.8% in the oligonucleotide.

[0309] An oligonucleotide having a chain length of 50 mer or more and 250 mer or less, and an N-1mer content ratio in the oligonucleotide of 5.7% or less.

[0310] An oligonucleotide having a chain length of 50 mer or more and 250 mer or less, and an N-1mer content ratio in the oligonucleotide of 5.5% or less.

[0311] The oligonucleotide chain length is 50 mer or more and 250 mer or less, and the content ratio of N-1mer in the oligonucleotide is 5% or less.

[0312] An oligonucleotide having a chain length of 50 mer or more and 250 mer or less, and an N-1mer content ratio in the oligonucleotide of 4.5% or less.

[0313] An oligonucleotide having a chain length of 50 mer or more and 250 mer or less, and an N-1mer content ratio in the oligonucleotide of 4% or less.

[0314] An oligonucleotide having a chain length of 50 mer or more and 250 mer or less, and an N-1mer content ratio in the oligonucleotide of 3.5% or less.

[0315] The oligonucleotide chain length is 50 mer or more and 250 mer or less, and the content ratio of N-1mer in the oligonucleotide is 3% or less.

[0316] An oligonucleotide having a chain length of 50 mer or more and 250 mer or less, and an N-1mer content ratio in the oligonucleotide of 2.5% or less.

[0317] An oligonucleotide having a chain length of 50 mer or more and 250 mer or less, and an N-1mer content ratio in the oligonucleotide of 2.3% or less.

[0318] An oligonucleotide having a chain length of 50 mer or more and 250 mer or less, and an N-1mer content ratio in the oligonucleotide of 2.1% or less.

[0319] An oligonucleotide having a chain length of 50 mer or more and 300 mer or less, and an oligonucleotide having an N-1mer content ratio of less than 5.8% in the oligonucleotide.

[0320] An oligonucleotide having a chain length of 50 mer or more and 300 mer or less, and an N-1mer content ratio in the oligonucleotide of 5.7% or less.

[0321] An oligonucleotide having a chain length of 50 mer or more and 300 mer or less, and an N-1mer content ratio in the oligonucleotide of 5.5% or less.

[0322] The oligonucleotide chain length is 50 mer or more and 300 mer or less, and the content ratio of N-1mer in the oligonucleotide is 5% or less.

[0323] An oligonucleotide having a chain length of 50 mer or more and 300 mer or less, and an N-1mer content ratio in the oligonucleotide of 4.5% or less.

[0324] An oligonucleotide having a chain length of 50 mer or more and 300 mer or less, and an N-1mer content ratio in the oligonucleotide of 4% or less.

[0325] An oligonucleotide having a chain length of 50 mer or more and 300 mer or less, and an N-1mer content ratio in the oligonucleotide of 3.5% or less.

[0326] An oligonucleotide having a chain length of 50 mer or more and 300 mer or less, and an N-1mer content ratio in the oligonucleotide of 3% or less.

[0327] An oligonucleotide having a chain length of 50 mer or more and 300 mer or less, and an N-1mer content ratio in the oligonucleotide of 2.5% or less.

[0328] An oligonucleotide having a chain length of 50 mer or more and 300 mer or less, and an N-1mer content ratio in the oligonucleotide of 2.3% or less.

[0329] An oligonucleotide having a chain length of 50 mer or more and 300 mer or less, and an N-1mer content ratio in the oligonucleotide of 2.1% or less.

[0330] An oligonucleotide having a chain length of 100 mer or more and 300 mer or less, and an oligonucleotide having an N-1mer content ratio of less than 5.8% in the oligonucleotide.

[0331] An oligonucleotide having a chain length of 100 mer or more and 300 mer or less, and an N-1mer content ratio in the oligonucleotide of 5.7% or less.

[0332] An oligonucleotide having a chain length of 100 mer or more and 300 mer or less, and an N-1mer content ratio in the oligonucleotide of 5.5% or less.

[0333] The oligonucleotide has a chain length of 100 mer or more and 300 mer or less, and the content ratio of N-1mer in the oligonucleotide is 5% or less.

[0334] An oligonucleotide having a chain length of 100 mer or more and 300 mer or less, and an N-1mer content ratio in the oligonucleotide of 4.5% or less.

[0335] An oligonucleotide having a chain length of 100 mer or more and 300 mer or less, and an N-1mer content ratio in the oligonucleotide of 4% or less.

[0336] An oligonucleotide having a chain length of 100 mer or more and 300 mer or less, and an N-1mer content ratio in the oligonucleotide of 3.5% or less.

[0337] An oligonucleotide having a chain length of 100 mer or more and 300 mer or less, and an N-1mer content ratio in the oligonucleotide of 3% or less.

[0338] An oligonucleotide having a chain length of 100 mer or more and 300 mer or less, and an N-1mer content ratio in the oligonucleotide of 2.5% or less.

[0339] An oligonucleotide having a chain length of 100 mer or more and 300 mer or less, and an N-1mer content ratio in the oligonucleotide of 2.3% or less.

[0340] An oligonucleotide having a chain length of 100 mer or more and 300 mer or less, and an N-1mer content ratio in the oligonucleotide of 2.1% or less.

[0341] Typical examples of nucleic acid molecules that can be used in the production method of the present invention include the following examples in addition to the examples described in the Examples, but the present invention is not limited to these examples.

[0342] In the following description of the sequence, U represents uridine, C represents cytidine, A represents adenosine, and G represents guanosine.

[0343] Examples include nucleic acid molecules having the following sequences (A) and (B) described in International Publication No. 2019 / 060442.

[0344] Sequence (A): 5'-AUGGAAUmACUCUUGGUUmACdTdT-3' (according to ST.25 standard) (5'-ATGGAATmACTCTTGGTTmACdTdT-3' (according to ST.26 standard)) (antisense) (SEQ ID NO. 1) 21mer

[0345] Sequence (B): 5'-GUmAACmCmAAGAGUmAUmUmCmCmAUmd TdT-3' (according to ST.25 standard) (5'-GTmAACmCmAAGAGTmATmTmC mCmATmdTdT-3' (according to ST.26 standard)) (positive sense) (SEQ ID NO: 2) 21mer

[0346] In sequences (A) and (B), Um represents 2'-O-methyluridine (ST.25 standard), Tm represents 2'-O-methyluridine (ST.26 standard), Cm represents 2'-O-methylcytidine, and dT represents thymidine. In this specification, the abbreviations in the sequence apply to both the ST.25 standard and the ST.26 standard unless otherwise specified.

[0347] Examples include the nucleic acid molecules described in Daniel O'Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, 546-558 (see page 553). As a typical example, a nucleic acid molecule having the following sequence (C) can be mentioned.

[0348] Sequence (C): 5'-AGAGCCAGCCUUCUUAUUGUUUUAGAGCU AUGCUGU-3' (according to ST.25 standard) (5'-AGAGCCAGCCTTCTTATT GTTTTAGAGCTATGCTGT-3' (according to ST.26 standard)) (SEQ ID NO: 3) 36mer

[0349] Examples include a nucleic acid molecule having the following sequence (D) described in Nucleic Acids Research, 2019, Vol. 47, No. 2: 547.

[0350] Sequence (D): 5'-ACAGCAUAGCAAGUUAAAAUAAGGCUAGU CCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU-3' (according to ST.25 standard) (5'-ACAGCATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCT-3' (according to ST.26 standard)) (SEQ ID NO: 4) 67mer

[0351] Examples include a nucleic acid molecule having the following sequence (E) described on page 173 of JP-A No. 2015-523856.

[0352] Sequence (E): 5'-GUUUUCCCUUUUCAAAGAAAUCUCCUGGGCACCUAUCUUCUUAGGUGCCCUCCCUUGUUUAAACCUGACCAGUUAACCGGCUGGUUAGGUUUUU-3' (according to ST.25 standard) (5'-GTTTTCCCTTTTCAAAGAAATCTCCTGGGCACCTATCTTCTTAGGTGCCCTCCCTTGTTTAAACCTGACCAGTTAACCGGCTGGTTAGGTTTT-3' (according to ST.26 standard)) (SEQ ID NO: 5) 94mer

[0353] Examples include nucleic acid molecules described in JP-A-2017-537626. Typical examples include nucleic acid molecules having the following sequences (F), (G), (H), and (J).

[0354] Sequence (F): 5'-AGUCCUCAUCUCCCUCAAGCGUUUUAGAGCUAGUAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3' (according to ST.25 standard) (5'-AGTCCTCATCTCCCTCAAGCGTTTTAGAGCTAGTAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3' (according to ST.26 standard)) (SEQ ID NO: 6) 100mer

[0355] Sequence (G): 5'-GCAGAUGUAGUGUUUCCACAGUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU-3' (according to ST.25 standard) (5'-GCAGATGTAGTGTTTCCACAGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3' (according to ST.26 standard)) (SEQ ID NO: 7) 113mer

[0356] Sequence (H): 5'-dAdGdTdCdCdTdCdAdTdCdTdCdCdCdTdCdAd AdGdCGUUUAAGAGCUAUGCUGGUAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU-3' (according to ST.25 standard) (5'-dAdGdTdCdCdTd CdAdTdCdTdCdCdCdCdTdCdAdAdGdCGTTTAAGAGCTATGCTGGTAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3' (according to ST.26 standard)) (SEQ ID NO: 8) 113mer

[0357] In the sequence (H), dT represents thymidine, dC represents 2'-deoxycytidine, dA represents 2'-deoxyadenosine, and dG represents 2'-deoxyguanosine.

[0358] Sequence (J): 5'-AmsGmsUmsCCUCAUCUCCCUCAAGCGUUUA AGAGCUAUGCUGGUAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUmsUmsUmsU-3' (according to ST.25 standard) (5'-AmsGmsTmsCCTCATCT CCCTCAAGCGTTTAAGAGCTATGCTGGTAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTmsTmsTmsT-3' (according to ST.26 standard)) (SEQ ID NO: 9) 113mer

[0359] In sequence (J), Um represents 2'-O-methyluridine (ST.25 standard), Tm represents 2'-O-methyluridine (ST.26 standard), Am represents 2'-O-methyladenosine, Gm represents 2'-O-methylguanosine, and s represents phosphorothioate modification.

[0360] Example

[0361] Hereinafter, the present invention will be described in more detail by way of examples, but the present invention is not limited to these examples.

[0362] Determination method

[0363] First, various measurement methods used in the following experiments are shown below.

[0364] (Measurement method 1: Determination of FLP purity and N-1mer content in oligonucleotides)

[0365] The purity of the oligonucleotides was determined using HPLC. FLP refers to the full-length target substance (Full Length Product).

[0366] The HPLC measurement conditions are shown in Table 1 below.

[0367] [Table 1]

[0368] Table 1

[0369]

[0370] The N-1mer content refers to the content (area percentage) of N-1mer in the obtained oligonucleotide obtained by analyzing the obtained oligonucleotide using the present measurement method 1. The FLP purity refers to the content (area percentage) of FLP in the obtained oligonucleotide obtained by analyzing the obtained oligonucleotide using the aforementioned measurement method 1.

[0371] (Measurement method 2: measurement of oligonucleotide yield)

[0372] Determine the OD of the crude product 260 OD 260 It indicates the absorbance at UV260nm per 10mm pathlength in 1mL solution (pH=7.5). Generally, for RNA, 1OD 260 =40 μg, so based on the above OD 260 The yield is calculated based on the measured value.

[0373] Solid phase synthesis of oligonucleotides

[0374] Sequence (I):

[0375] 5'-UmUmUmUmUmUmUmUmUmUmUmUmUmUmUmUmUm UmUmUmUmUmUmUmUmUmUmUmUmUmUmUmUmUmUmUmUmUmUmUmUmUmUmUmUmUm-3' (according to ST.25 standard)

[0376] (5'-TmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmT mTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTm-3' (according to ST.26 standard))

[0377] (SEQ ID NO: 10) 50mer

[0378] In sequence (I), Um represents 2'-O-methyluridine (ST.25 standard), and Tm represents 2'-O-methyluridine (ST.26 standard). In this specification, the abbreviations in the sequence apply to both the ST.25 standard and the ST.26 standard unless otherwise specified.

[0379] The above sequence (I) represents the following structural formula (16).

[0380] [Chemical formula 23]

[0381]

[0382] As a solid phase carrier, controlled pore glass (CPG) was used, and as a nucleic acid synthesizer, NTS M-4MX-E (manufactured by NIHON TECHNO SERVICE CO.LTD) was used. The oligonucleotide consisting of the above sequence (I) was synthesized from the 3' side to the 5' side using the phosphoramidite solid phase synthesis method. The synthesis was carried out on a scale of about 1 μmol. In addition, in the synthesis, 2'-OMe-U amide represented by formula (18) was used, as a deprotection solution, a high-purity dichloroacetic acid toluene solution was used, as a condensing agent, a 5-benzylthio-1H-tetrazole solution was used, as an oxidant, an iodine solution was used, and as a capping solution, a phenoxyacetic anhydride solution and an N-methylimidazole solution were used.

[0383] Next, a specific example of producing an oligonucleotide produced by the production method of the present invention is shown. Here, in the following examples, the oligonucleotide produced by the production method of the present invention is an oligonucleotide having the sequence (I) shown in SEQ ID NO: 10 above.

[0384] The CPG supporting a 2'-OMe-U derivative described in the following Examples and Comparative Examples refers to a compound represented by the following formula (17). The circle shown in the formula (17) schematically represents CPG.

[0385] [Chemical formula 24]

[0386]

[0387] Example 1

[0388] Using controlled pore glass (CPG) loaded with 1.01 μmol of a 2'-OMe-U derivative and 2'-OMe-U amide represented by formula (18), an oligonucleotide represented by sequence (I) was automatically synthesized from the 3' side to the 5' side using NTS M-4MX-E (manufactured by NIHON TECHNO SERVICE CO. LTD). In the automatic synthesis step, first, a deprotection solution (1-dodecanethiol: dichloroacetic acid: toluene = 0.5:3.0:96.5) was sent to CPG to deprotect the trityl protecting group at the 5' position. Next, 2'-OMe-U amide and 5-benzylmercapto-1H-tetrazole as a condensing agent were sent to CPG to allow the hydroxyl group at the 5' position to undergo a coupling reaction. Next, an oxidizing solution containing 50 mM iodine was sent to convert the phosphite group into a phosphate group. Next, as a capping solution, 0.1M phenoxyacetic anhydride acetonitrile solution and 10% N-methylimidazole / 10% 2,6-lutidine acetonitrile solution were used to cap the reaction points that were not coupled. After further repeating these steps a total of 49 times, the protecting group (DMTr group) in the base at the 5' end was deprotected with a deprotection solution (1-dodecanethiol / dichloroacetic acid / toluene = 0.5 / 3.0 / 96.5), and the oligonucleotide of the sequence shown in sequence (I) was synthesized on a CPG carrier. Then, 750 μL of 28% ammonia water and 250 μL of ethanol were flowed into the CPG carrier carrying 1.01 μmol of the oligonucleotide, and the mixture was kept at 40°C for 4 hours to free the oligonucleotide from the solid phase carrier. Then, the solid phase carrier was removed by filtration, and the ammonia water and ethanol were removed by vacuum drying to obtain the desired oligonucleotide in the form of a dry solid. The purity of the oligonucleotide was measured by the method described in the above-mentioned determination method 1 for the obtained product. The result showed that the content of N-1mer was 1.5% and the purity of FLP was 71.3%. In addition, the yield of the oligonucleotide was measured by the method described in the above-mentioned determination method 2. The yield was 12.6 mg, which was 12.5 mg when converted to the yield of CPG per 1.00 μmol of 2'-OMe-U derivative. The results are shown in Table 2.

[0389] The 2'-OMe-U amide represented by the formula (18) has the following structure.

[0390] [Chemical formula 25]

[0391]

[0392] Example 2

[0393] In the method of Example 1, cyclohexanethiol / dichloroacetic acid / toluene = 0.5 / 3.0 / 96.5 was used as the deprotection solution. Otherwise, the oligonucleotide of sequence (I) was obtained by the same method. The purity of the oligonucleotide was determined by the method described in the aforementioned determination method 1. The result showed that the content of N-1mer was 1.6% and the purity of FLP was 70.4%. In addition, the yield of the oligonucleotide was determined by the method described in the aforementioned determination method 2. The yield was 12.6 mg, which was 12.5 mg if converted to the yield of CPG per 1.00 μmol of 2'-OMe-U derivative. The results are shown in Table 2.

[0394] Comparative Example 1

[0395] In the method of Example 1, CPG loaded with 1.00 μmol of 2'-OMe-U derivative and dichloroacetic acid / toluene = 3.0 / 97.0 as a deprotection solution were used, and the oligonucleotide of sequence (I) was obtained by the same method. The purity of the oligonucleotide was measured by the method described in the aforementioned measurement method 1, and the content of N-1mer was 4.9%, and the purity of FLP was 62.8%. In addition, the yield of the oligonucleotide was measured by the method described in the aforementioned measurement method 2, and the yield was 12.2 mg. The results are shown in Table 2.

[0396] Comparative Example 2

[0397] In the method of Example 1, CPG loaded with 0.96 μmol of 2'-OMe-U derivative and triethylsilane / dichloroacetic acid / toluene = 3.0 / 3.0 / 94.0 as a deprotection solution were used, and the oligonucleotide of sequence (I) was obtained by the same method. The purity of the oligonucleotide was measured using the method described in the aforementioned measurement method 1, and the result was that the content of N-1mer was 3.8%, and the purity of FLP was 65.7%. In addition, the yield of the oligonucleotide was measured using the method described in the aforementioned measurement method 2, and the result was 11.7 mg. If converted to the yield per CPG loaded with 1.00 μmol of 2'-OMe-U derivative, it is 12.2 mg. The results are shown in Table 2.

[0398] Comparative Example 3

[0399] In the method of Example 1, CPG loaded with 1.03 μmol of 2'-OMe-U derivatives and methanol / dichloroacetic acid / toluene = 0.5 / 3.0 / 96.5 as a deprotection solution were used, and the oligonucleotide of sequence (I) was obtained by the same method. The purity of the oligonucleotide was measured using the method described in the aforementioned measurement method 1, and the result was that the content of N-1mer was 9.6%, and the purity of FLP was 63.5%. In addition, the yield of the oligonucleotide was measured using the method described in the aforementioned measurement method 2, and the result was 12.7 mg. If converted to the yield of CPG loaded with 1.00 μmol of 2'-OMe-U derivatives, it is 12.3 mg. The results are shown in Table 2.

[0400] Comparative Example 4

[0401] In the method of Example 1, CPG loaded with 1.04 μmol of 2'-OMe-U derivative and isopropanol / dichloroacetic acid / toluene = 0.5 / 3.0 / 96.5 as a deprotection solution were used, and the oligonucleotide of sequence (I) was obtained by the same method. The purity of the oligonucleotide was measured using the method described in the aforementioned measurement method 1, and the result was that the content of N-1mer was 12.5%, and the purity of FLP was 59.2%. In addition, the yield of the oligonucleotide was measured using the method described in the aforementioned measurement method 2, and the result was 12.4 mg. If converted to the yield per CPG loaded with 1.00 μmol of 2'-OMe-U derivative, it is 11.9 mg. The results are shown in Table 2.

[0402] Table 2 shows the results of Examples 1 and 2 and Comparative Examples 1 to 4.

[0403] [Table 2]

[0404] Table 2

[0405]

[0406] In Table 2, the so-called N-1mer content refers to the content (area percentage) of N-1mer in the obtained oligonucleotide obtained by analyzing the obtained oligonucleotide using the aforementioned measurement method 1. In addition, the so-called FLP purity refers to the content (area percentage) of FLP in the obtained oligonucleotide obtained by analyzing the obtained oligonucleotide using the aforementioned measurement method 1. The so-called "N-1mer / FLP" refers to the content ratio of N-1mer when the content of FLP in the obtained oligonucleotide is set to 100%, and is obtained by the following formula.

[0407] "N-1mer / FLP" (%) = N-1mer content / FLP purity × 100

[0408] Industrial Applicability

[0409] The present invention provides an efficient deprotection reaction of a protecting group of a 5' hydroxyl group using a thiol compound as a cation scavenger. In addition, it is expected that the yield and purity of an oligonucleotide produced by the method for producing an oligonucleotide will be improved.

[0410] Sequence Listing Free Text

[0411] Sequence numbers 1 to 10 in the sequence listing represent base sequences of oligonucleotides produced according to the method for producing an oligonucleotide of the present invention.

Claims

1. A method for producing an oligonucleotide, which is a method for producing an oligonucleotide based on a solid phase synthesis method, The production method comprises the step of reacting an oligonucleotide whose 5'-terminal hydroxyl group is protected by a protecting group that can be removed under acidic conditions with an acid in the presence of a thiol to remove the protecting group of the 5'-terminal hydroxyl group.

2. The manufacturing method according to claim 1, wherein: The mercaptan is a C2-C20 alkyl mercaptan or a C4-C8 cycloalkyl mercaptan.

3. The manufacturing method according to any one of claims 1 or 2, wherein: The mercaptan is 1-dodecanethiol or cyclohexylthiol.

4. The production method according to any one of claims 1 to 3, wherein The protecting group of the hydroxyl group at the 5' end is a protecting group represented by the following formula, [Chemical formula 1] In the formula, R 1 , R 2 and R 3 are the same or different from each other and each independently represents hydrogen or an alkoxy group.

5. The production method according to any one of claims 1 to 4, wherein The protecting group of the hydroxyl group at the 5' end is 4,4'-dimethoxytrityl group (DMTr group).

6. The production method according to any one of claims 1 to 5, wherein The acid is trifluoroacetic acid, dichloroacetic acid, trifluoromethanesulfonic acid, trichloroacetic acid, methanesulfonic acid, hydrochloric acid, acetic acid or p-toluenesulfonic acid.

7. The production method according to any one of claims 1 to 5, wherein The acid is dichloroacetic acid.

8. The manufacturing method according to claim 7, wherein: The acid is dichloroacetic acid in the coexistence of an aprotic inert solvent having a lower boiling point than dichloroacetic acid.

9. The manufacturing method according to claim 8, wherein: The aprotic inert solvent having a boiling point lower than that of dichloroacetic acid is any one or more solvents selected from dichloromethane, acetonitrile or aromatic organic solvents.

10. The manufacturing method according to claim 9, wherein: The aromatic organic solvent is toluene.

11. The manufacturing method according to claim 7, wherein: The molar ratio of dichloroacetic acid to formaldehyde is 81×10 -5 Below, and the molar ratio of dichloroacetic anhydride to dichloroacetic acid is 20×10 -5 The following dichloroacetic acid.

12. The production method according to any one of claims 1 to 11, wherein The oligonucleotide whose 5'-terminal hydroxyl group is protected by a protecting group that can be removed under acidic conditions is an oligonucleotide represented by formula (1), [Chemical formula 2] In formula (1), G 1 represents a protecting group for a hydroxyl group, G 2 represents a protecting group for a hydroxyl group, B a are the same or different from each other, and each independently represents a nucleic acid base that can be protected by a protecting group, R are the same or different from each other, and each independently represents a protected hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group or an OQ' group, Q' are the same or different from each other, and each independently represents a methylene group bonded to the carbon atom at the 4' position of ribose, an ethylene group bonded to the carbon atom at the 4' position of ribose, or an ethylidene group bonded to the carbon atom at the 4' position of ribose, Y are the same or different from each other and each independently represents an oxygen atom or a sulfur atom, n represents any integer from 1 to 300, W1 represents an OZ group, and X1 represents an R group, or, W1 represents an OV group, and X1 represents an OZ group, V represents a protective group for a hydroxyl group, Z is a group having a structure consisting of a solid phase carrier and a linking group; Furthermore, when n is an integer greater than 2, the nucleic acid molecule represented by formula (1) may include a non-nucleotide linker between each nucleotide; The nucleotide in which the protective group of the hydroxyl group at the 5' end is removed is an oligonucleotide represented by formula (2), [Chemical formula 3] In formula (2), G 2 , B a , R, Y, X1, W1 and n are the same as above, and, Non-nucleotide linkers may be incorporated between nucleotides in the manner defined in formula (1).

13. The manufacturing method according to claim 12, wherein: The oligonucleotide whose 5'-terminal hydroxyl group is protected by a protecting group that can be removed under acidic conditions is an oligonucleotide represented by formula (1'), [Chemical formula 4] In formula (1'), G 2 , B a , R, Y, X1, W1 and n are the same as above, and, R 1 , R 2 and R 3 are the same or different from each other and each independently represents a hydrogen atom or an alkoxy group.

14. The manufacturing method according to claim 13, wherein: R 1 and R 2 is methoxy, R 3 A hydrogen atom.

15. A method for producing an oligonucleotide represented by formula (2'), the method comprising: The process according to claim 12; A step of further removing the group represented by Z from the oligonucleotide represented by formula (2) produced in the step; and The step of removing the protective groups of the hydroxyl group and the nucleic acid base, [Chemical formula 5] In formula (2'), Y and n are the same as above, B c are the same or different from each other, and each independently represents a nucleic acid base, G 4 are the same or different from each other and each independently represents a hydrogen ion, an alkali metal ion, an ammonium ion, an alkylammonium ion, or a hydroxyalkylammonium ion, R' is the same as or different from each other, and each independently represents a hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group or an OQ' group, Q' is the same as above, and, X3 and W3 each independently represent a hydroxyl group, or X3 represents an R' group, and W3 represents a hydroxyl group; and, Non-nucleotide linkers may be incorporated between nucleotides in the manner defined in formula (1).

16. The production method according to any one of claims 12 to 15, wherein: An oligonucleotide is an oligonucleotide comprising ribonucleic acid (RNA).

17. The manufacturing method according to claim 12, wherein: The oligonucleotide is an oligonucleotide containing ribonucleic acid (RNA), and the protecting group of the hydroxyl group at the 2' position of the ribose is a protecting group represented by formula (6), Formula (6): [Chemical formula 6] In formula (6), q represents any integer from 0 to 5, R a and R b are the same or different from each other, and each independently represents a methyl group, an ethyl group or a hydrogen atom, The * mark indicates the bonding point to the oxygen atom derived from the hydroxyl group at the 2' position of ribose, and, E W Represents an electron withdrawing group.

18. The manufacturing method according to claim 17, wherein: q is 0 or 1, R a and R b are the same or different from each other, and are each independently a methyl group or a hydrogen atom, and E w It is cyano.

19. The production method according to any one of claims 12 to 18, wherein: n is any integer from 1 to 200.

20. The production method according to any one of claims 1 to 19, wherein The obtained oligonucleotide is an oligonucleotide of 100 mer or more.

21. The production method according to any one of claims 1 to 20, wherein: The molar ratio of the thiol used to the oligonucleotide in which the hydroxyl group at the 5' end is protected by a protecting group that can be removed under acidic conditions is 1 or more.

22. The production method according to any one of claims 1 to 21, wherein The molar ratio of the mercaptan to the acid is 1 to 100.

23. An oligonucleotide, wherein The chain length of the oligonucleotide is 50 mer or longer, and the content ratio of N-1 mer in the oligonucleotide is less than 5.8%.

Images