Application of METTL3 as target spot in preparation of skin anti-aging medicine or skin care product

Abstract

The invention relates to the field of biological agents, in particular to application of METTL3 serving as a target spot to preparation of skin anti-aging drugs or skin care products, collagen expression in human skin fibroblasts is promoted to be increased by targeted inhibition of expression of METTL3, and the skin anti-aging effect is improved. The expression of collagen in human skin fibroblasts is also increased by inhibiting the expression of METTL3 in an inflammation model; expression of human skin endogenous collagen is improved through m6A epigenetic modification, and a strategy is provided for research and development of anti-aging products.

Description

Technical Field

[0001] The present application relates to the field of biological preparations, and more specifically, it relates to the use of METTL3 as a target in the preparation of anti-aging drugs or skin care products. Background Art

[0002] The skin is the largest organ in the human body. The network of collagen and elastin in the epidermis, dermis and subcutaneous fat tissue produces the biomechanical and physiological properties of the skin. Factors such as hormones, ultraviolet radiation and the external environment affect the appearance, structure and integrity of the skin. During the aging process, the skin undergoes qualitative and quantitative changes, such as loss of elasticity, thinning of the epidermis and reduction of collagen content, and increased wrinkles.

[0003] Among them, collagen plays an important role in skin anti-aging. It is the main structural protein of the skin and is essential for the elasticity, firmness and overall health of the skin. As we age, the collagen content in the skin gradually decreases, causing aging phenomena such as sagging and wrinkles. Therefore, supplementing collagen and promoting its synthesis is one of the key strategies for anti-aging. Currently, the skin care products on the market are more effective in supplementing collagen from the outside, while there are fewer skin care products that promote its own synthesis. Therefore, this application wants to promote the expression of endogenous collagen in the skin through a target.

[0004] Epigenetics refers to the science of affecting the characteristics of organisms by regulating gene expression without changing the DNA sequence. In the process of skin aging, epigenetic regulatory mechanisms play an important role. 6 A, N6-methyladenosine modification is a post-transcriptional modification of mRNA and long non-coding RNA that is ubiquitous in eukaryotes and plays an important role in regulating RNA splicing, maturation, degradation, and translation. 6 A modification is closely related to skin regeneration, wound healing, scar formation and the occurrence and development of various skin diseases. 6 A modification is mainly regulated by three types of protein molecules, “writers” 6 A methyltransferase, “eraser” m 6 A demethylase, “reader” m 6 A binding protein or recognition protein. METTL3 is an mRNA methyltransferase that catalyzes the mRNA conversion of adenylate 6A modification, and is associated with the occurrence and development of a variety of diseases, including cancer, cardiovascular disease, autoimmune diseases, etc. In terms of skin health and disease, the role of METTL3 has also attracted the attention of researchers. For example, in inflammatory diseases, the expression changes, modified target genes and pathogenesis of METTL3. In the study of skin photoaging, METTL3 is also believed to affect the skin's response to photoaging by regulating certain key biological processes, such as cell autophagy. In general, the role of METTL3 in skin health and disease is a multifaceted research field involving multiple biological processes and disease mechanisms. With the deepening of research, METTL3 may become a new target for the treatment of skin-related diseases in the future. Summary of the invention

[0005] In order to promote the expression of endogenous collagen in the skin, the present application provides the use of METTL3 as a target in the preparation of anti-aging drugs or skin care products.

[0006] The following technical solution is adopted: the use of METTL3 as a target in the preparation of skin anti-aging drugs or skin care products.

[0007] Preferably, the application includes preparing a drug or skin care product for skin anti-aging using a METTL3 inhibitor that specifically inhibits METTL3 or specifically interferes with the expression of the METTL3 gene.

[0008] Preferably, the METTL3 inhibitor includes a combination of one or more of a small molecule compound that specifically inhibits METTL3, an interfering molecule that specifically interferes with the expression of the METTL3 gene, and a natural product that specifically inhibits METTL3.

[0009] Preferably, the METTL3 inhibitor directly inhibits the activity of METTL3, thereby reducing m 6 A level, or specifically inhibit METTL3 gene expression, or target inhibit METTL3 protein activity.

[0010] Preferably, the medicine or skin care product comprises a medically acceptable carrier and an effective amount of an active ingredient, wherein the active ingredient directly inhibits the activity of METTL3 and reduces m 6 A level, or specifically inhibit METTL3 gene expression, or target inhibit METTL3 protein activity.

[0011] Preferably, the small molecule compound that specifically inhibits METTL3 is STM2457.

[0012] Preferably, the interfering molecule that specifically interferes with the expression of the METTL3 gene is shMETTL3.

[0013] Preferably, the natural product that specifically inhibits METTL3 is a combination of one or more of luteolin, quercetin and baicalein.

[0014] Preferably, the natural product that specifically inhibits METTL3 is luteolin.

[0015] Preferably, the medicine or skin care product comprises a combination of one or more of an ointment, a gel, a cream, an essence, and an aqueous solution.

[0016] In summary, this application has the following beneficial effects: The present application provides the use of a METTL3 inhibitor in the preparation of anti-aging drugs or skin care products, which promotes the increase of collagen expression in human skin fibroblasts by targeted inhibition of METTL3 expression, and inhibiting the expression of METTL3 in an inflammatory model also increases the expression of collagen in human skin fibroblasts.

[0017] This application is made through 6 A epigenetic modification increases the expression of endogenous collagen in human skin, providing a strategy for the development of anti-aging products.

[0018] This application screened the natural products luteolin, quercetin, and baicalein that inhibit METTL3, providing a selection of natural substances for subsequent drugs or skin care products. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Fluorescence microscopy images of human skin fibroblasts (HSF) infected with shMETTL3 virus (virus concentration: 1×10 8 TU / ml, multiplicity of infection MOI=20), green fluorescence marks the virus infection efficiency.

[0020] Figure 2 Western blotting was used to detect the expression level of METTL3 protein in HSF cells after shMETTL3 virus infection.

[0021] Figure 3 Fluorescence quantitative PCR was used to detect the expression level of METTL3 mRNA in HSF cells after shMETTL3 virus infection, and t-test analysis was used. * indicates the results compared with SCR, *P<0.05, **P<0.01, ***P < 0.001, ****P<0.0001.

[0022] Figure 4Fluorescence quantitative PCR was used to detect the expression level of COL1A1 mRNA in HSF cells after shMETTL3 virus infection, and t-test analysis was used. * indicates the results compared with SCR, *P<0.05, **P<0.01, ***P < 0.001, ****P<0.0001.

[0023] Figure 5 Fluorescence quantitative PCR was used to detect the expression level of COL1A2 mRNA in HSF cells after shMETTL3 virus infection, and t-test analysis was performed. * indicates the results compared with SCR, *P<0.05, **P<0.01, ***P < 0.001, ****P<0.0001.

[0024] Figure 6 Fluorescence quantitative PCR was used to detect the expression level of COL3A1 mRNA in HSF cells after shMETTL3 virus infection, and t-test analysis was performed. * indicates the results compared with SCR, *P<0.05, **P<0.01, ***P < 0.001, ****P<0.0001.

[0025] Figure 7 Fluorescence quantitative PCR was used to detect the changes in METTL3 mRNA levels in HSF cells after treatment with different concentrations of METTL3 inhibitors (0.1 μM, 1 μM, 10 μM) for 4 hours (control group: DMSO solvent treatment), and t-test analysis was used. * indicates the results compared with DMSO, *P<0.05, **P<0.01, ***P < 0.001, ****P<0.0001.

[0026] Figure 8 Western blotting was used to analyze the METTL3 protein expression after METTL3 inhibitor treatment.

[0027] Fig. 9 The expression of COL1A1 mRNA was detected by fluorescence quantitative PCR after METTL3 inhibitor treatment, and the t-test was used for analysis. * indicates the results compared with DMSO, *P<0.05, **P<0.01, ***P < 0.001, ****P<0.0001.

[0028] Fig.10 Fluorescence quantitative PCR was used to detect the changes in COL1A2 mRNA expression after METTL3 inhibitor treatment, and t-test analysis was performed. * indicates the results compared with DMSO, *P<0.05, **P<0.01, ***P < 0.001, ****P<0.0001.

[0029] Fig.11 Fluorescence quantitative PCR was used to detect the changes in COL3A1 mRNA expression after treatment with METTL3 inhibitors, and t-test analysis was performed. * indicates the results compared with DMSO, *P<0.05, **P<0.01, ***P < 0.001, ****P<0.0001.

[0030] Fig.12 Fluorescence quantitative PCR was used to detect the changes in METTL3 mRNA levels in HSF cells treated with different concentrations of luteolin (1 μM, 100 μM) for 4 hours, and the t-test was used for analysis. * indicates the results compared with DMSO, *P<0.05, **P<0.01, ***P < 0.001, ****P<0.0001.

[0031] Fig.13 The expression of COL1A1 mRNA after luteolin treatment was detected by fluorescence quantitative PCR, and the t-test was used for analysis. * indicates the results compared with DMSO, *P<0.05, **P<0.01, ***P < 0.001, ****P<0.0001.

[0032] Fig.14 To detect the expression of COL1A2 mRNA after luteolin treatment by fluorescence quantitative PCR, t-test analysis was performed. * indicates the results compared with DMSO, *P<0.05, **P<0.01, ***P < 0.001, ****P<0.0001.

[0033] Fig.15 The expression of COL3A1 mRNA after luteolin treatment was detected by fluorescence quantitative PCR, and the t-test was used for analysis. * indicates the results compared with DMSO, *P<0.05, **P<0.01, ***P < 0.001, ****P<0.0001.

[0034] Fig.16 Fluorescence quantitative PCR was used to detect the changes in METTL3 mRNA levels in HSF cells after quercetin (1 μM, 10 μM, 100 μM) was treated for 24 hours, and the t-test was used for analysis. * indicates the results compared with DMSO, *P<0.05, **P<0.01, ***P < 0.001, ****P<0.0001.

[0035] Fig.17Fluorescence quantitative PCR was used to detect the expression of COL1A1 mRNA after quercetin treatment, and t-test analysis was performed. * indicates the results compared with DMSO, *P<0.05, **P<0.01, ***P < 0.001, ****P<0.0001.

[0036] Fig.18 Fluorescence quantitative PCR was used to detect the expression of COL1A2 mRNA after quercetin treatment, and t-test analysis was performed. * indicates the results compared with DMSO, *P<0.05, **P<0.01, ***P < 0.001, ****P<0.0001.

[0037] Fig.19 Fluorescence quantitative PCR was used to detect the expression of COL3A1 mRNA after quercetin treatment, and t-test analysis was performed. * indicates the results compared with DMSO, *P<0.05, **P<0.01, ***P < 0.001, ****P<0.0001.

[0038] Fig. 20 Fluorescence quantitative PCR was used to detect the changes in METTL3 mRNA levels in HSF cells treated with baicalein (0.1 μM, 1 μM, 10 μM) for 24 hours, and t-test analysis was used. * indicates the results compared with DMSO, *P<0.05, **P<0.01, ***P < 0.001, ****P<0.0001.

[0039] Fig.21 Fluorescence quantitative PCR was used to detect the expression of COL1A1 mRNA after baicalein treatment, and t-test analysis was performed. * indicates the results compared with DMSO, *P<0.05, **P<0.01, ***P < 0.001, ****P<0.0001.

[0040] Fig. 22 Fluorescence quantitative PCR was used to detect the expression of COL1A2 mRNA after baicalein treatment, and t-test analysis was performed. * indicates the results compared with DMSO, *P<0.05, **P<0.01, ***P < 0.001, ****P<0.0001.

[0041] Fig.23 The expression of COL3A1 mRNA after baicalein treatment was detected by fluorescence quantitative PCR, and the t-test was used for analysis. * indicates the results compared with DMSO, *P<0.05, **P<0.01, ***P < 0.001, ****P<0.0001.

[0042] Fig.24 Fluorescence quantitative PCR was used to detect the changes in IL-6 mRNA levels in HSF cells after treatment with 20 ng / ml IL-1β for different time periods (4 h, 8 h, and 16 h). Two-way ANOVA analysis was used. * indicates the results compared with the Control group (PBS), *P<0.05, **P<0.01, ***P < 0.001, ****P<0.0001.

[0043] Fig.25 Two-way ANOVA was used to analyze the inhibitory effect of IL-1β treatment on COL1A1 mRNA expression. * indicates the results compared with the Control group (PBS), *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

[0044] Fig.26 Two-way ANOVA was used to analyze the inhibitory effect of IL-1β treatment on COL1A2 mRNA expression. * indicates the results compared with the Control group (PBS), *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

[0045] Fig. 27 Two-way ANOVA was used to analyze the inhibitory effect of IL-1β treatment on COL3A1 mRNA expression. * indicates the results compared with the Control group (PBS), *P<0.05, **P<0.01, ***P <0.001, ****P<0.0001.

[0046] Fig.28 Fluorescence images of HSF cells transfected with shMETTL3 18 hours later (cultured for 6 days).

[0047] Fig.29 A is an immunoblot image of Western blotting to detect the protein levels of METTL3, COL1A1, and COL3A1 after shMETTL3 transfection.

[0048] Fig.29 B is the statistical analysis of the grayscale of COL1A1 protein after shMETTL3 transfection detected by Western blotting, analyzed by two-way ANOVA. *P<0.05, **P<0.01, ***P < 0.001, ****P<0.0001.

[0049] Fig.29 C is a statistical analysis of the grayscale of COL3A1 protein after shMETTL3 transfection detected by Western blotting, analyzed by two-way ANOVA. *P<0.05, **P<0.01, ***P < 0.001, ****P<0.0001.

[0050] Fig.29 D is the statistical analysis of the grayscale of METTL3 after shMETTL3 transfection detected by Western blotting, analyzed by two-way ANOVA. *P<0.05, **P<0.01, ***P < 0.001, ****P<0.0001.

[0051] Fig.30 To verify the knockdown efficiency of shMETTL3 on METTL3 mRNA by fluorescence quantitative PCR, two-way ANOVA analysis was performed. *P<0.05, **P<0.01, ***P < 0.001, ****P<0.0001.

[0052] Fig.31 Two-way ANOVA was used to analyze the changes in IL-6 mRNA levels after shMETTL3 treatment by fluorescence quantitative PCR. *P<0.05, **P<0.01, ***P < 0.001, ****P<0.0001.

[0053] Fig.32 Two-way ANOVA was used to analyze the changes in COL1A1 mRNA levels after shMETTL3 treatment. *P<0.05, **P<0.01, ***P < 0.001, ****P<0.0001.

[0054] Fig.33 Two-way ANOVA was used to analyze the changes in COL1A2 mRNA levels after shMETTL3 treatment using fluorescent quantitative PCR. *P<0.05, **P<0.01, ***P < 0.001, ****P<0.0001.

[0055] Fig.34 Two-way ANOVA was used to analyze the changes in COL3A1 mRNA levels after shMETTL3 treatment. *P<0.05, **P<0.01, ***P < 0.001, ****P<0.0001.

[0056] Fig.35 Two-way ANOVA analysis was used to detect the effect of STM2457 treatment for 4 hours on IL-6 mRNA expression after IL-1β (20 ng / ml, 16 h) pretreatment. *P<0.05, **P<0.01, ***P <0.001, ****P<0.0001.

[0057] Fig.36 Two-way ANOVA analysis was performed to detect the effect of STM2457 treatment for 4 h on the expression of METTL3 mRNA after pretreatment with IL-1β (20 ng / ml, 16 h). *P<0.05, **P<0.01, ***P <0.001, ****P<0.0001.

[0058] Fig.37 Two-way ANOVA analysis was performed to detect the effect of STM2457 treatment for 4 hours on COL1A1 mRNA expression after IL-1β (20 ng / ml, 16 h) pretreatment. *P<0.05, **P<0.01, ***P <0.001, ****P<0.0001.

[0059] Fig.38 Two-way ANOVA analysis was performed to detect the effect of STM2457 treatment for 4 hours on COL1A2 mRNA expression after IL-1β (20 ng / ml, 16 h) pretreatment. *P<0.05, **P<0.01, ***P <0.001, ****P<0.0001.

[0060] Fig.39 Two-way ANOVA analysis was performed to detect the effect of STM2457 treatment for 4 h on COL3A1 mRNA expression after IL-1β (20 ng / ml, 16 h) pretreatment. *P<0.05, **P<0.01, ***P <0.001, ****P<0.0001.

[0061] Fig.40 A is an immunoblot image of Western blotting to detect the level of COL1A1 protein.

[0062] Fig.40B is the grayscale statistical analysis of COL1A1 protein levels detected by Western blotting, analyzed by two-way ANOVA. *P<0.05, **P<0.01, ***P < 0.001, ****P<0.0001.

[0063] Fig.41 Two-way ANOVA analysis was performed to detect the effect of luteolin treatment for 4 h on IL-6 mRNA expression after IL-1β (20 ng / ml, 16 h) pretreatment. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

[0064] Fig.42 Two-way ANOVA analysis was performed to detect the effect of luteolin treatment for 4 h on the expression of METTL3 mRNA after pretreatment with IL-1β (20 ng / ml, 16 h). *P<0.05, **P<0.01, ***P <0.001, ****P<0.0001.

[0065] Fig.43 Two-way ANOVA analysis was performed to detect the effect of luteolin treatment for 4 h on COL1A1 mRNA expression after IL-1β (20 ng / ml, 16 h) pretreatment. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

[0066] Fig.44 Two-way ANOVA analysis was performed to detect the effect of luteolin treatment for 4 h on COL1A2 mRNA expression after IL-1β (20 ng / ml, 16 h) pretreatment. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

[0067] Fig.45 Two-way ANOVA analysis was performed to detect the effect of luteolin treatment for 4 h on COL3A1 mRNA expression after IL-1β (20 ng / ml, 16 h) pretreatment. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

[0068] Fig.46A is an immunoblot analysis of the effect of luteolin on the expression of METTL3 and COL1A1 proteins by Western blotting.

[0069] Fig.46 B is the grayscale statistical analysis of COL1A1 protein bands by Western blotting analysis of the effect of luteolin on the expression of METTL3 and COL1A1 proteins, analyzed by two-way ANOVA. *P<0.05, **P<0.01, ***P< 0.001, ****P<0.0001.

[0070] Fig.46 C is the METTL3 band grayscale statistical analysis diagram of the effect of luteolin on the expression of METTL3 and COL1A1 proteins by Western blotting analysis, analyzed by two-way ANOVA. *P<0.05, **P<0.01, ***P <0.001, ****P<0.0001. DETAILED DESCRIPTION

[0071] The present application is further described in detail below with reference to the accompanying drawings and embodiments.

[0072] 1. Experimental Methods 1.1 Cell culture 1.1.1 Cell passaging HSF is an adherent cell. The cells were cultured at a ratio of 1 ml DMEM complete medium (containing 10% FBS) per 5 cm² culture flask. When the cells in the logarithmic phase grow to 80%~90% of the bottom of the flask, the cells begin to show contact inhibition. At this time, the cells are digested with trypsin solution for subculture. The original culture medium in the cell culture flask is aspirated with a pipette, and 1 ml of 1 × PBS buffer is aspirated into the cell culture flask to cover the bottom of the flask. The flask is gently shaken to clean the bottom of the flask to remove apoptotic cells on the surface and residual culture medium, and the washing is repeated twice. Add 1 ml of 0.25% trypsin (containing EDTA) to cover the bottom of the flask. The cell culture flask is placed in a 37°C constant temperature CO2 cell culture incubator for cell digestion to destroy the cell-cell connection and the contact between the cell and the bottom of the flask. The time is about 1 min. Take out the culture flask from the incubator and place it under an optical microscope for observation. At this time, it should be observed that most of the cells have lost their original shape and detached from the bottom of the bottle. Gently tap the side of the culture bottle and the cells move like quicksand, which means that the cell digestion is successful. Then quickly add 3ml of complete cell culture medium to terminate the digestion, and gently blow the above solution with a pipette to make the digested cells completely fall off the bottom of the cell culture bottle. Transfer the above cell suspension to a 15 ml sterile centrifuge tube and centrifuge it in a low-speed centrifuge at room temperature for 5 min at a speed of 1000×g. Take out the centrifuge tube after centrifugation, carefully remove the supernatant and discard it into the waste tank, then add an appropriate amount of fresh complete cell culture medium to the cell sediment at the bottom of the tube, gently blow the cell sediment to mix, and form a uniform single cell suspension. The mixed cell suspension is inoculated into the cell culture bottle at a ratio of 1: 3, and gently mixed, and then placed in a 37℃ constant temperature CO2 cell culture incubator for static culture.

[0073] 1.1.2 Cell cryopreservation Select cells in the logarithmic growth phase, that is, the cell confluence is about 70%~80%, and remove the culture medium in the culture flask with a pipette. Add 1 ml of 1× PBS solution to the culture flask until it just covers the bottom of the flask, wash the culture flask, and repeat twice. Add 0.25% trypsin containing EDTA and digest in a cell culture incubator for 1 min until most cells are detached from the bottom of the flask. Then add 3 ml of complete DMEM culture medium to terminate the digestion. Use a pipette to gently blow and mix the cells and transfer them into a centrifuge tube. Centrifuge at 1000×g for 5 min in a centrifuge. After centrifugation, discard the supernatant, add an appropriate amount of serum-free cell freezing solution, and gently blow and mix with a pipette to resuspend the cells. The above cell resuspension is divided and added to sterile cryopreservation tubes, and 1 ml of cell suspension is added to each tube. Place the cryopreservation tube directly in a cryopreservation box and put it in a -80℃ refrigerator. After overnight, store the frozen cells in a liquid nitrogen tank.

[0074] 1.1.3 Cell recovery Take out a tube of frozen cells from the liquid ammonia tank, quickly put it into a 37℃ water bath to revive for about 1 min, wait until the frozen cell suspension is thawed to only soybean-sized frozen blocks, move the cryopreservation tube to room temperature, at this time, the cells have been completely frozen and thawed. Transfer the revived cells to a centrifuge tube through a pipette, add 3 ml of complete culture medium, and centrifuge at 1000×g for 5 min in a centrifuge. Discard the supernatant, add 4~5ml of complete culture medium to resuspend, and transfer to a sterile culture bottle of appropriate size, shake the culture bottle gently in a "cross" manner to mix, and observe under a microscope, then place the cells in a 37℃, 5% CO2 incubator for culture. After overnight, the revived cells adhere to the wall. This application replaces the normal complete culture medium for the revived cells to remove dead cells that are not attached to the wall.

[0075] 1.2 Lentiviral transfection experiment Prepare a cell culture medium at a density of 3 × 10 4 100 μl / well cell suspension, inoculate 2 ml / well cell suspension in a 6-well plate. Incubate in a 37°C, 5% CO2 incubator for 24 hours until the cell confluence is 20-30%. Calculate the amount of virus to be added based on the cell MOI and virus titer, add 40 μl infection reagent, and finally add complete culture medium to 1 ml to prepare the infection solution. Add 1 ml / well infection solution to a 6-well plate and culture in a 37°C, 5% CO2 incubator for 18 hours. Then, replace with complete culture medium and continue to culture for 48 hours. Add 5 μg / ml Puromycin to a 6-well plate and culture in a 37°C, 5% CO2 incubator for 48 hours. Change the cell medium, continue to culture for 24 hours, and collect RNA or protein samples.

[0076] 1.3 RNA extraction 1.3.1 Sample processing Discard the cell culture medium and wash once with 1×PBS. Add 500μl RNA-easy to each well of the six-well plate to fully cover the cell surface, and then blow the cells off with a pipette. Transfer the lysate to a centrifuge tube and repeatedly blow with a pipette until fully lysed.

[0077] 1.3.2 RNA extraction Add 200μl RNase-free ddH2O to the above lysate, mix by inverting, and let stand at room temperature for 5 min. Centrifuge at 12000×g for 15 min at room temperature. Remove the centrifuge tube. The solution is now separated into an upper aqueous phase (containing RNA) and a dark lower precipitate (containing impurities such as protein, DNA, polysaccharide, etc.). Carefully pipette the upper aqueous phase into a new centrifuge tube. Add an equal volume of isopropanol, mix by inverting, and let stand at room temperature for 10 min. Centrifuge at 12000×g for 10 min at room temperature. Usually a white precipitate can be seen. Carefully discard the supernatant. Add 500μl 75% ethanol (prepared with RNase-free ddH2O), flick the bottom of the tube to suspend the precipitate, and invert it several times. Centrifuge at 8000×g for 3min at room temperature and discard the supernatant. Repeat once, add 500μl 75% ethanol, flick the bottom of the tube to suspend the precipitate, and invert it several times. Centrifuge at 8000×g for 3 min at room temperature, discard the supernatant, leave to dry at room temperature, add appropriate amount of RNase-free ddH2O to dissolve the precipitate, vortex at room temperature for 3 min to fully dissolve the RNA precipitate, and store at -80℃ for a long time.

[0078] 1.3.3 Purity and concentration testing The purity of the product was detected by an ELISA instrument. An OD260 / OD280 ratio between 1.8 and 2.2 indicated that the RNA purity was high. The concentration of the product was detected by an ELISA instrument.

[0079] 1.4 cDNA synthesis 1.4.1 Removal of genomic DNA Prepare the reaction mixture on ice according to the ingredients in Table 1. To ensure the accuracy of the reaction mixture preparation, when performing each reaction, prepare the Master Mix according to the amount of reaction number + 1, then dispense it into each reaction tube, and finally add the RNA sample.

[0080] Table 1 Genomic DNA removal system Reagents Usage 5×gDNA Eraser Buffer 2.0 μl 5×gDNA Eraser 1.0 μl Total RNA 1 μg <![CDATA[RNase Free dH2O]]> up to 10 μl The above solution was mixed thoroughly, vortexed and centrifuged, reacted at 42°C for 2 min in a PCR instrument, and then transferred to ice at 4°C.

[0081] 1.4.2 Reverse transcription reaction Prepare the reaction solution on ice according to the ingredients in Table 2. To ensure the accuracy of the reaction solution preparation, when performing each reaction, you should first prepare the Master Mix according to the amount of reaction number + 1, and then dispense 10μl into each reaction tube. After gentle mixing, immediately perform the reverse transcription reaction.

[0082] Table 2 Reverse transcription reaction system Reagents Usage Reaction solution of step 1 10.0μl PrimeScript RT Enzyme Mix Ⅰ 1.0μl RT Primer Mix 1.0μl 5×PrimeScript Buffer 2 (for Real Time) 4.0μl <![CDATA[RNase Free dH2O]]> 4.0μl Total 20.0μl After the above reagents were mixed evenly, the reaction was carried out in a PCR instrument at 37°C for 15 min, 85°C for 5 sec, and finally maintained at 4°C until the end.

[0083] 1.5 Fluorescence quantitative PCR The reaction primers required for the experiment were ordered from Beijing Qingke Biotechnology Co., Ltd. Hangzhou Branch. The specific gene PCR primer sequences in this experiment are shown in Table 3.

[0084] Table 3 RT-qPCR primer sequences Target gene (human) Forward primer Reverse primer GAPDH CCACTCCTCCACCTTTGAC ACCCTGTTGCTGTAGCCA METTL3 TTGTCTCCAACCTTCCGTAGT CCAGATCAGAGAGGTGGTGTAG ELN GCAGGAGTTAAGCCCAAGG TGTAGGGCAGTCCATAGCCA COL1A1 GTGCGATGACGTGATCTGTGA CGGTGGTTTCTTGGTCGGT COL1A2 GGCCCTCAAGGTTTCCAAGG CACCCTGTGGTCCAACAACTC COL3A1 TTGAAGGAGGATGTTCCCATCT ACAGACACATATTTGGCATGGTT MYC AATGAAAAGGCCCCCAAGGTAGTTATCC GTCGTTTCCGCAACAAGTCCTCTTC IL-6 CCTGAACCTTCCAAAGATGGC TTCACCAGGCAAGTCTCCTCA Prepare the reaction system according to Table 4.

[0085] Table 4 RT-qPCR reaction system Reagents Usage 2×ChamQ SYBR Color qPCR Master Mix (High ROX Premixed) 10.0μl Primer1 (10 μM) 0.4μl Primer2 (10 μM) 0.4μl Template DNA / cDNA 1μl <![CDATA[ddH2O]]> To 20.0μl The RT-qPCR reaction conditions are shown in Table 5.

[0086] Table 5 RT-qPCR reaction conditions step Number of cycles temperature time Pre-denaturation 1 cycle 95℃ 30 sec Cyclic reaction 40 cycles 95℃ 10 sec Cyclic reaction 40 cycles 60℃ 30 sec Melting curve 1 cycle 95℃ 15 sec Melting curve 1 cycle 60℃ 60 sec Melting curve 1 cycle 95℃ 15 sec 1.6 Western Blot Analysis 1.6.1 Extraction of protein samples Wash the cells gently twice with 1×PBS, and use a pipette to completely remove the remaining liquid in the bottle, and try not to leave any liquid. Then, according to the density and number of cells, add the appropriate strong RIPA lysis buffer (containing the appropriate concentration of protease inhibitors) and place it on ice. Then, use a cell scraper to repeatedly scrape the cells until the white cell mass can be observed to fall. At this time, use a pipette to absorb the above lysis solution into a new 1.5 ml EP tube, and place it on ice to stand for 10 minutes. Then centrifuge at 4℃ for 20 minutes (speed 12000 rpm), and then transfer the supernatant to a new 1.5 ml EP tube, which can be used for subsequent protein sample preparation or can be temporarily stored in a -20℃ refrigerator.

[0087] 1.6.2 Protein concentration determination and denaturation Prepare a series of BSA standard solutions with known concentrations according to Table 6.

[0088] Table 6 Preparation of BSA standard solution Final BSA concentration (mg / ml) 0 0.05 0.1 0.15 0.2 0.25 0.3 0.35 0.4 0.5mg / ml BSA standard (μl) 0 3 6 9 12 15 18 21 24 <![CDATA[ddH2O(μl)]]> 30 27 24 21 18 15 12 9 6 Bradford (μl) 600 600 600 600 600 600 600 600 600 Preparation of the sample to be tested: 3μl of the protein sample to be tested + 27μl ddH2O + 600μl Bradford, that is, dilute the protein sample to be tested to one tenth of the original concentration. Pipette 200 μl / well of the prepared solution above and add it to a 96-well plate. For each concentration standard and protein sample to be tested, this application sets up 3 replicate wells for subsequent statistical analysis. Subsequently, this application uses an enzyme reader to detect the absorbance at 595 nm, and draws a standard curve based on the above-mentioned protein standards, and calculates the concentration of the protein sample to be tested based on the obtained standard curve. Protein sample denaturation: Add appropriate 2 × SDS Loading Buffer and protein sample according to the protein concentration, and then denature the protein sample in a 100℃ metal bath for about 10 min, and store it at -20℃ for use.

[0089] 1.6.3 Preparation of glue (taking a 1.5mm mini glue as an example) Before use, mix the components by inverting. Take 4.0 ml of lower gel solution and lower gel buffer of equal volume, and mix well. Add 80 μl of coagulant and mix well. Inject the mixed solution into the glass plate for making gel, so that the liquid level is about 1.5 cm from the upper edge of the short glass plate, and add 1 ml of isopropanol to cover the lower gel. After the lower gel solidifies (about 15-20 minutes), pour off the upper isopropanol. Take 1 ml of upper gel solution and colored upper gel buffer of equal volume, and mix well. Add 20 μl of coagulant to the mixed solution and mix well. Inject the mixed solution into the glass plate for making gel and insert the comb teeth. After the upper gel solidifies (about 15-20 minutes), remove the comb teeth and use it for electrophoresis.

[0090] 1.6.4 Protein electrophoresis Fix the gel plate in the electrophoresis tank as required. Note that the slot needs to be clamped tightly to prevent leakage of the electrophoresis solution. Fill the inner tank with 1 × electrophoresis buffer, then gently pull out the comb in the gel plate vertically upward, and then add an appropriate amount of 1 × SDS electrophoresis buffer to the outer tank until it covers the bottom of the electrophoresis tank. Then load the unilateral sample, and add equal volumes of protein samples to the comb holes in the experimental sequence. For the split protein sample, a control well needs to be set, and 1-3μl marker can be added to the well. Connect the power supply, select a constant voltage of 60V for about 30 min to concentrate the protein, and adjust the voltage to 100V after the sample runs from the concentrated gel to the separation gel, and continue to run the separation gel until bromophenol blue runs to the bottom of the separation gel. At the same time, the end time of electrophoresis should be determined in combination with the experimental requirements.

[0091] 1.6.5 Transfer Cut the 0.45 μm PVDF membrane according to the required protein band size in advance, and activate it in methanol solution for about 5 minutes. Use a plastic plate to cut out the protein tape required for electrophoresis, and discard the rest of the unnecessary parts. Soak the transfer clip in the pre-cooled transfer solution, and place the sponge, 3 layers of filter paper, protein tape, PVDF membrane (rinsed in TBST), 3 layers of filter paper, and sponge in order from the black baffle, pay attention to the discharge of bubbles, and finally press the white baffle. Put the transfer clip into the transfer tank. At this time, pay attention to the direction of the positive and negative poles. At the same time, put a blue plastic ice cube to help maintain the 4℃ environment, and then add the transfer solution that has been pre-cooled to minus 20 degrees to the top of the liquid surface. The transfer condition is 100V constant voltage for 100 min. After the transfer is completed, disconnect the power first, then take out the PVDF membrane and mark it (it is generally customary to make a notch in the upper left corner of the PVDF membrane to indicate the direction).

[0092] 1.6.6 Antigen-antibody reaction and development Prepare 3% BSA with 1 × TBST, remove the PVDF membrane and wet it in 1 × TBST, then place it in an appropriate amount of blocking solution for about 30 minutes (the specific time can be adjusted according to the experimental requirements). Then recover the blocking solution and rinse the PVDF membrane with 1 × TBST 2~3 times until the remaining BSA is washed away. Add an appropriate amount of primary antibody (prepare with primary antibody diluent according to the specific concentration required by the antibody manual) and shake slowly on a roller mixer at 4°C overnight (about 12~16 hours, the specific time can be adjusted according to the experimental requirements). Discard the primary antibody and wash the membrane with 1 × TBST on a shaker for 3 times × 10 minutes (the shaking speed in this step can be faster). Then add an appropriate amount of secondary antibody (diluted with 1 × TBST at a ratio of 1:3000) at room temperature until the PVDF membrane is covered, and slowly incubate on a roller mixer for about 1 hour. Discard the secondary antibody and wash the membrane with 1 × TBST for 10 minutes × 3 times. Development: Place the PVDF membrane in a pre-prepared luminescent dish, evenly drop the luminescent solution (developer A reagent and B reagent prepared in a 1:1 ratio) on the membrane, and incubate for about 10 seconds. Then, perform luminescence according to the instrument instructions.

[0093] 2 Experimental Results 2.1 Inhibition of METTL3 promotes collagen expression in human skin fibroblasts 2.1.1 METTL3 shRNA increases collagen expression in human skin fibroblasts Reference Figure 1-6 To investigate whether skin collagen is affected by m6 A modification regulation, this application uses shRNA to knock down METTL3. The concentration is 1×10 8 TU / ml, MOI=20 virus solution infects human skin fibroblasts. First, green fluorescence can be observed under the microscope, indicating that shRNA transfection is successful ( Figure 1 ). To determine the optimal shRNA sequence for effectively knocking down METTL3, real-time quantitative PCR detection of METTL3 mRNA levels showed that METTL3 shRNA-1 (shMETTL3-1) was the most effective shRNA for reducing METTL3 expression in HSF cells (Figure 3). Western blotting results also confirmed that shMETTL3-1 could inhibit the expression of METTL3 protein ( Figure 2 ). In order to detect the expression of collagen in the skin after METTL3 was inhibited, the mRNA levels of COL1A1, COL1A2 and COL3A1 were detected in this application. qPCR results showed that the mRNA levels of COL1A1, COL1A2 and COL3A1 were increased in METTL3-silenced HSF cells ( Figure 4 , Figure 5 and Figure 6 ). These results indicate that inhibiting the expression of METTL3 in human skin fibroblasts can promote collagen expression.

[0094] 2.1.2 STM2457 promotes collagen expression in human skin fibroblasts Reference Figure 7-11 To further determine the expression of collagen in the skin after METTL3 was inhibited, the present application used a METTL3 inhibitor (STM2457) to pharmacologically reduce the activity of METTL3. The present application treated HSF with different concentrations of STM2457 for 4 hours and then detected the mRNA levels of METTL3, COL1A1, COL1A2, and COL3A1. The qPCR results showed that compared with the control DMSO group, the mRNA levels of METTL3 in the 0.1μM, 1.0μM, and 10.0μM groups were increased ( Figure 7 ), and the protein levels of each group did not change ( Figure 8 ), indicating that the small molecule compound STM2457 directly inhibits the activity of METTL3 and affects m 6 A level; the mRNA levels of COL1A1, COL1A2, and COL3A1 increased in the 0.1μM and 1.0μM groups, but did not change in the 10.0μM group ( Fig. 9 , Fig.10 and Fig.11 ). From the results, 0.1 μM STM2457 was used in subsequent experiments.

[0095] 2.1.3 Natural products promote collagen expression in human skin fibroblasts Reference Figure 12-15 In order to screen natural products that can act as METTL3 inhibitors and promote the expression of collagen in the skin, this application selected luteolin, quercetin, and baicalein to act on HSF. This application first treated HSF with different concentrations of luteolin for 4 hours and then detected the mRNA levels of METTL3, COL1A1, COL1A2, and COL3A1. The qPCR results showed that compared with the control group DMSO group, the mRNA level of METTL3 in the 100μM group was reduced ( Fig.12 ), while there was no change in the 1μM group; the mRNA levels of COL1A1, COL1A2, and COL3A1 increased in the 100μM group, while there was no change in the 1μM group ( Fig.13 , Fig.14 and Fig.15 ).

[0096] Reference Figure 16-19 Next, the present invention treated HSF with different concentrations of quercetin for 24 hours and then detected the mRNA levels of METTL3, COL1A1, COL1A2 and COL3A1. The qPCR results showed that compared with the control group DMSO group, the mRNA level of METTL3 in the 10 μM group was reduced ( Fig.16 ), while there was no change in the 1μM and 100μM groups; the mRNA levels of COL1A1, COL1A2, and COL3A1 increased in the 10μM group, while there was no change in the other two groups ( Fig.17 , Fig.18 and Fig.19 ).

[0097] Reference Figure 20-23 Finally, the present invention treated HSF with different concentrations of baicalin for 24h and then detected the mRNA levels of METTL3, COL1A1, COL1A2 and COL3A1. The qPCR results showed that compared with the control group DMSO group, the mRNA level of METTL3 in the 10μM group was decreased ( Fig. 20 ), while there was no change in the 0.1μM and 1μM groups; the mRNA level of COL1A1 increased in the 1μM and 10μM groups, while there was no change in the 0.1μM group ( Fig.21 ); The mRNA levels of COL1A2 and COL3A1 increased in the 10μM group, while there was no change in the other two groups ( Fig. 22 and Fig.23 ).

[0098] 2.2 Aging Model Senescence Associated Secretory Phenotype (SASP) is one of the key signs of aging. It involves the secretion of a series of cytokines, including pro-inflammatory factors, growth factors, chemokines and proteases. Therefore, this application selected the pro-inflammatory factor IL-1β to treat HSF cells to make an aging model.

[0099] 2.2.1 Proinflammatory factors reduce collagen expression in human skin fibroblasts Reference Figure 24-27 In this application, HSF cells were first treated with IL-1β for different time periods, and the qPCR results showed that the mRNA level of IL-6 increased ( Fig.24 ), indicating that the model was successfully established. In order to detect the expression of collagen in the aging model, the present application detected the mRNA levels of COL1A1, COL1A2 and COL3A1. The qPCR results showed that the mRNA levels of COL1A1, COL1A2 and COL3A1 decreased ( Fig.25 , Fig.26 and Fig. 27 ), and is time-dependent.

[0100] 2.2.2 METTL3 inhibitor promotes collagen expression in human skin fibroblast aging model Reference Figure 28-34 In order to determine whether the inhibition of METTL3 can reverse the expression of collagen in the human skin fibroblast aging model, the present application first transfected HSF with shMETTL3, then treated HSF with IL-1β, and detected the expression of IL-6, METTL3, COL1A1, COL1A2 and COL3A1. First, green fluorescence was observed under a microscope ( Fig.28 ), Western blot results showed that the METTL3 protein level was decreased in the shMETTL3+PBS and shMETTL3+IL-1β groups ( Fig.29 In addition, the METTL3 mRNA levels in the shMETTL3+PBS and shMETTL3+IL-1β groups were also reduced ( Fig.30 ), indicating that METTL3 shRNA transfection was successful. Then qPCR results showed that the IL-6 mRNA level in the SCR+IL-1β and shMETTL3+IL-1β groups increased, while there was no change in the shMETTL3+PBS group ( Fig.31), indicating that the model was successfully established; compared with the control group (SCR+PBS), the mRNA levels of COL1A1, COL1A2 and COL3A1 in the shMETTL3+PBS group were increased, and the mRNA levels of COL1A1, COL1A2 and COL3A1 in the SCR+IL-1β group were decreased, while compared with the SCR+IL-1β group, the mRNA levels of COL1A1, COL1A2 and COL3A1 in the shMETTL3+IL-1β group were increased ( Fig.32 , Fig.33 , Fig.34 ), while the WB results of COL1A1, COL3A1 and METTL3 corresponded to the qPCR results ( Fig.29 B. Fig.29 C. Fig.29 D), indicating that inhibition of METTL3 can reverse the expression of collagen.

[0101] Reference Figure 35-40 Then, the present invention used IL-1β to treat HSF, and then used STM2457 to act on HSF, and detected the expression of IL-6, METTL3, COL1A1, COL1A2 and COL3A1. The qPCR results showed that the IL-6 mRNA level in the DMSO+IL-1β and STM2457+IL-1β groups increased, while there was no change in the STM2457+PBS group ( Fig.35 ), indicating that the model was successfully established; the mRNA level of METTL3 in the STM2457+PBS, DMSO+IL-1β, and STM2457+IL-1β groups did not change ( Fig.36 ); Compared with the control group (DMSO+PBS), the mRNA levels of COL1A1, COL1A2, and COL3A1 in the STM2457+PBS group were increased, and the mRNA levels of COL1A1, COL1A2, and COL3A1 in the DMSO+IL-1β group were decreased, while compared with the DMSO+IL-1β group, the mRNA levels of COL1A1, COL1A2, and COL3A1 in the STM2457+IL-1β group were increased ( Fig.37 , Fig.38 , Fig.39 ), meanwhile, the WB results of COL1A1 corresponded to the qPCR results ( Fig.40 B) indicates that drug treatment to inhibit the expression of METTL3 can also reverse the expression of collagen.

[0102] Reference Figures 41-46Finally, the present invention treated HSF with IL-1β and then treated HSF with luteolin to detect the expression of IL-6, METTL3, COL1A1, COL1A2 and COL3A1. The qPCR results showed that the IL-6 mRNA level in the DMSO+IL-1β and Luteolin+IL-1β groups increased, while there was no change in the Luteolin+PBS group ( Fig.41 ), indicating that the model was successfully established; the METTL3 mRNA level in the Luteolin+PBS and Luteolin+IL-1β groups decreased, while there was no change in the DMSO+IL-1β group ( Fig.42 ), and the results of METTL3 protein corresponded to it ( Fig.46 A), indicating that Luteolin had a successful effect; compared with the control group (DMSO+PBS), the mRNA levels of COL1A1, COL1A2 and COL3A1 in the Luteolin+PBS group were increased, and the mRNA levels of COL1A1, COL1A2 and COL3A1 in the DMSO+IL-1β group were decreased, while compared with the DMSO+IL-1β group, the mRNA levels of COL1A1, COL1A2 and COL3A1 in the Luteolin+IL-1β group were increased ( Fig.43 , Fig.44 , Fig.45 ), meanwhile, the WB results of COL1A1 and METTL3 corresponded to the qPCR results ( Fig.46 B and Fig.46 C), indicating that inhibiting the expression of METTL3 with luteolin can also reverse the expression of collagen.

[0103] This specific embodiment is merely an explanation of the present application and is not a limitation of the present application. After reading this specification, those skilled in the art may make modifications to the present embodiment without any creative contribution as needed, but such modifications are protected by the patent law as long as they are within the scope of the claims of the present application.

Claims

1. Application of METTL3 as a target in the preparation of anti-aging drugs or skin care products.

2. The use of METTL3 as a target in the preparation of skin anti-aging drugs or skin care products according to claim 1, characterized in that: The invention relates to a drug or skin care product for skin anti-aging, comprising a METTL3 inhibitor which specifically inhibits METTL3 or specifically interferes with the expression of the METTL3 gene.

3. The use of METTL3 as a target in the preparation of skin anti-aging drugs or skin care products according to claim 2, characterized in that: The METTL3 inhibitor includes a combination of one or more of a small molecule compound that specifically inhibits METTL3, an interfering molecule that specifically interferes with the expression of the METTL3 gene, and a natural product that specifically inhibits METTL3.

4. The use of METTL3 as a target in the preparation of skin anti-aging drugs or skin care products according to claim 2, characterized in that: The METTL3 inhibitor directly inhibits the activity of METTL3, thereby reducing m 6 A level, or targeted inhibition of METTL3 gene expression, or targeted inhibition of METTL3 protein activity.

5. Use of METTL3 as a target in the preparation of skin anti-aging drugs or skin care products according to any one of claims 1 to 4, characterized in that: The medicine or skin care product comprises a medically acceptable carrier and an effective amount of active ingredients, wherein the active ingredients directly inhibit the activity of METTL3, reduce m 6 A level, or specifically inhibit METTL3 gene expression, or target inhibit METTL3 protein activity.

6. The use of METTL3 as a target in the preparation of skin anti-aging drugs or skin care products according to claim 3, characterized in that: The small molecule compound that specifically inhibits METTL3 is STM2457.

7. The use of METTL3 as a target in the preparation of skin anti-aging drugs or skin care products according to claim 3, characterized in that: The interfering molecule that specifically interferes with the expression of the METTL3 gene is shMETTL3.

8. The use of METTL3 as a target in the preparation of skin anti-aging drugs or skin care products according to claim 3, characterized in that: The natural product that specifically inhibits METTL3 is a combination of one or more of luteolin, quercetin and baicalein.

9. The use of METTL3 as a target in the preparation of skin anti-aging drugs or skin care products according to claim 8, characterized in that: The natural product that specifically inhibits METTL3 is luteolin.

10. The use of METTL3 as a target in the preparation of skin anti-aging drugs or skin care products according to claim 1, characterized in that: The medicine or skin care product includes one or a combination of ointment, gel, cream, essence, and water solution.

Images