Nucleic acid aptamer combined with phaseolus vulgaris lectin and application of nucleic acid aptamer

Abstract

The invention provides a nucleic acid aptamer combined with phaseolus vulgaris lectin and application of the nucleic acid aptamer, the nucleic acid aptamer comprises nucleic acid aptamers capable of specifically combining with PHA-E protein and combining with PHA-E and PHA-L. By improving a screening device and screening conditions, the nucleic acid aptamer combined with the PHA protein with high affinity is obtained through screening, and the nucleic acid aptamer not only is suitable for detecting single PHA-E but also is suitable for detecting single PHA-L protein. The nucleic acid aptamer suitable for detecting the total amount of PHA protein is further refined and screened, the nucleic acid aptamers suitable for detecting free protein and fixed protein are respectively obtained, and the detection accuracy and sensitivity are effectively improved.

Description

Technical Field

[0001] The invention belongs to the technical field of nucleic acid aptamer screening, and in particular relates to a nucleic acid aptamer binding to Phaseolus vulgaris lectin and an application thereof. Background Art

[0002] Phaseolus vulgaris agglutinin (PHA) is a plant lectin extracted from Phaseolus vulgaris and is widely used in biomedical research. PHA proteins in beans are mainly composed of two subtypes of two different types of polypeptide chains: PHA-E (hemagglutination type) and PHA-L (leukoagglutination type). Among them, PHA-E protein has a stronger hemagglutination effect, while PHA-L protein has a stronger lymphocyte agglutination effect. Therefore, PHA-E and PHA-L proteins show different characteristics when activating the immune system. At the same time, different types of PHA proteins may cause different allergic reactions or side effects. By distinguishing these two PHA proteins, their safety for sensitive individuals can be better evaluated. At present, PHA protein quantification methods are divided into two categories: traditional analytical methods that rely on a large number of equipment or commercially available kits, and new biosensing methods developed for rapid and accurate detection of PHA proteins. However, there is a significant problem when separating and screening: insufficient resolution of PHA-E and PHA-L.

[0003] The existing methods for detecting lectins mainly include hemagglutination assay and immunoassay. Among them, hemagglutination can be used to detect multivalent components that can bind to blood cells, and PHA proteins can be screened by specifically binding and precipitating PHA proteins to specific cells (such as red blood cells or white blood cells). However, since the two subtypes of PHA-E and PHA-L proteins have similar structures in surface polysaccharides, hemagglutination assays are difficult to effectively distinguish them, resulting in limited specificity and inability to distinguish specific types of lectins. Immunoassays include technologies based on the interaction between antibodies and antigens to achieve targeted recognition, as seen in methods such as Western blotting (WB), rocket immunoelectrophoresis (RIEP), and enzyme-linked immunosorbent assay (ELISA). ELISA has become the most widely used of these technologies due to its high throughput, well-established large-scale production procedures, and relatively fast results, but the incubation process usually takes 1-2 hours and is very time-consuming. At the same time, the development of specific antibodies for PHA-E and PHA-L proteins still faces many challenges, and batch differences in antibody production can also lead to test results that will undermine the consistency of food safety assessments or germplasm assessments.

[0004] As an emerging biomolecular recognition tool, aptamers have high specificity and flexibility, but there is still a lack of aptamers for PHA proteins. The development of aptamers can provide a new method for the specific recognition of PHA proteins, thereby helping to achieve effective discrimination between PHA-E and PHA-L proteins. However, due to the lack of corresponding screening technology and aptamers for Phaseolus vulgaris lectin, it is difficult to meet this demand at this stage.

[0005] Therefore, in order to solve the problem of distinguishing PHA-E from PHA-L proteins, there is an urgent need to develop nucleic acid aptamers with high binding affinity, good specificity, easy modification and artificial synthesis, good stability, and convenient use, so as to achieve efficient detection in cell research and toxicity assessment. Summary of the invention

[0006] In view of the shortcomings of the prior art, the present invention provides a nucleic acid aptamer binding to Phaseolus vulgaris agglutinin and applications thereof, including nucleic acid aptamers that can specifically bind to PHA-E protein and nucleic acid aptamers that bind to PHA-E and PHA-L proteins. By improving the screening device and screening conditions, nucleic acid aptamers that bind to PHA protein with high affinity are screened and obtained, including nucleic acid aptamers suitable for detecting a single PHA-E and nucleic acid aptamers suitable for detecting the total amount of PHA protein. These two types of sequences are further refined and screened to obtain nucleic acid aptamers suitable for detecting free proteins and fixed proteins, respectively, thereby effectively improving the detection accuracy and sensitivity.

[0007] In one aspect, the present invention provides a nucleic acid aptamer that binds to PHA, having a nucleotide sequence as shown in any one of SEQ ID NO.3, SEQ ID NO.7, SEQ ID NO.9, SEQ ID NO.14, and SEQ ID NO.15 in the sequence listing, wherein the PHA includes PHA-E and PHA-L.

[0008] The present invention is based on the initial DNA library and uses a new nucleic acid aptamer screening chip to screen and obtain 60 different types of high-affinity and high-specific nucleic acid aptamers that bind to PHA. Then, through subsequent affinity screening, 5 nucleic acid aptamers with higher affinity to PHA-E+PHA-L protein are obtained: Seq5 (SEQ ID NO.3), Seq22 (SEQ ID NO.7), Seq27 (SEQ ID NO.9), Seq55 (SEQ ID NO.14), and Seq58 (SEQ ID NO.15). The 5 nucleic acid aptamers obtained by screening can specifically bind to both PHA-E and PHA-L, and therefore can be used to detect the total PHA protein content.

[0009] Furthermore, the nucleic acid aptamer has a nucleotide sequence as shown in any one of SEQ ID NO.3 and SEQ ID NO.15 in the sequence listing.

[0010] Among the five nucleic acid aptamers with higher affinity obtained through screening, the ones with the highest affinity are: Seq5 (SEQ ID NO. 3) and Seq58 (SEQ ID NO. 15).

[0011] In another aspect, the present invention provides a nucleic acid aptamer for free detection of PHA protein, having a nucleotide sequence as shown in any one of SEQ ID NO.3, SEQ ID NO.7, and SEQ ID NO.9 in the sequence listing, wherein the PHA includes PHA-E and PHA-L.

[0012] In another aspect, the present invention provides a nucleic acid aptamer for immobilizing and detecting PHA protein, having a nucleotide sequence as shown in any one of SEQ ID NO.14 and SEQ ID NO.15 in the sequence listing, wherein the PHA includes PHA-E and PHA-L.

[0013] The free detection described in the present invention refers to the free state in which the nucleic acid aptamer and the PHA protein bind to form a complex floating in the liquid, and the binding efficiency of the detection is indicated by detecting changes such as fluorescence generated by the complex.

[0014] The immobilization detection described in the present invention refers to the binding of nucleic acid aptamers and PHA proteins to form a complex which is fixed on a certain interface surface by physical adsorption or chemical bonds, and the binding efficiency of the detection is indicated by detecting the influence of the complex on the electrical, optical and other properties of the interface.

[0015] Since the environments of nucleic acid aptamers used for fixed detection and free detection are different, the performance of nucleic acid aptamers binding to target proteins will be affected. For example, during fixed detection, it may be affected by metal ions or charged particles generated by the electrode. It is necessary to select nucleic acid aptamers suitable for use in this environment to obtain the best detection effect.

[0016] The present invention classifies nucleic acid aptamers for free detection and nucleic acid aptamers suitable for fixed detection based on nucleic acid aptamers that bind to PHA with high affinity, respectively, by using a graphene oxide method and an electrochemical detection method.

[0017] Based on the nucleic acid aptamer with high affinity binding to PHA, the graphene oxide method uses the fluorescence intensity of the nucleic acid aptamer modified with a fluorescent group when it binds to the corresponding protein on the graphene oxide network, and the fluorescence quenching when it is not bound to the corresponding protein, to screen the nucleic acid aptamer suitable for free detection. The electrochemical detection method is to judge the binding of the nucleic acid aptamer and the protein by the inhibitory effect of the complex of the nucleic acid aptamer and PHA on electron transfer, and the current corresponding to the peak value changes with the concentration of the PHA protein or PHA-E protein.

[0018] Finally, the nucleic acid aptamers suitable for free detection of PHA protein were obtained: Seq5 (SEQ ID NO.3), Seq22 (SEQ ID NO.7), and Seq27 (SEQ ID NO.9), and the nucleic acid aptamers suitable for fixed detection of PHA protein were: Seq55 (SEQ ID NO.14) and Seq58 (SEQ ID NO.15).

[0019] In another aspect, the present invention provides a nucleic acid aptamer that binds to PHA-E, having a nucleotide sequence as shown in any one of SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8, SEQ ID NO.12, and SEQ ID NO.13 in the sequence listing.

[0020] The structure of PHA protein has two subtypes, E and L. Only E is harmful to the human body, so specific detection of PHA-E is very necessary.

[0021] The present invention is based on the initial DNA library and uses a new nucleic acid aptamer screening chip to screen and obtain 60 different types of high-affinity and high-specific nucleic acid aptamers that bind to PHA. Then, through subsequent affinity screening, 5 nucleic acid aptamers with higher affinity to PHA-E protein are obtained: Seq9 (SEQ ID NO.4), Seq19 (SEQ ID NO.6), Seq23 (SEQ ID NO.8), Seq43 (SEQ ID NO.12), and Seq49 (SEQ ID NO.13). The 5 nucleic acid aptamers obtained by screening can only specifically bind to PHA-E and cannot bind to PHA-L, so they can be used to detect the content of PHA-E protein.

[0022] Furthermore, the nucleic acid aptamer has a nucleotide sequence as shown in any one of SEQ ID NO.4 and SEQ ID NO.6 in the sequence listing.

[0023] Among the five nucleic acid aptamers with higher affinity obtained through screening, the ones with the highest affinity are: Seq9 (SEQ ID NO. 4) and Seq19 (SEQ ID NO. 6).

[0024] In another aspect, the present invention provides a nucleic acid aptamer for free detection of PHA-E protein, having a nucleotide sequence as shown in any one of SEQ ID NO.4 and SEQ ID NO.8 in the sequence listing.

[0025] In another aspect, the present invention provides a nucleic acid aptamer for fixing and detecting PHA-E protein, having a nucleotide sequence as shown in any one of SEQ ID NO.6, SEQ ID NO.12, and SEQ ID NO.13 in the sequence listing, wherein the PHA includes PHA-E and PHA-L.

[0026] The nucleic acid aptamers suitable for free detection of PHA-E protein were screened: Seq9 (SEQ ID NO.4) and Seq23 (SEQ ID NO.8), and the nucleic acid aptamers suitable for fixed detection of PHA-E protein were: Seq19 (SEQ ID NO.6), Seq43 (SEQ ID NO.12), and Seq49 (SEQ ID NO.13).

[0027] In another aspect, the present invention provides a method for detecting PHA protein, wherein the method uses the nucleic acid aptamer as described above for detection.

[0028] In another aspect, the present invention provides a method for detecting PHA-E protein, using the nucleic acid aptamer described above for detection.

[0029] In some embodiments, the present invention provides the use of the above-mentioned nucleic acid aptamer, its conjugate or its derivative in any one of the following:

[0030] 1) Quantitative or qualitative detection of PHA or PHA-E protein;

[0031] 2) Purification of PHA or PHA-E protein;

[0032] 3) Imaging of PHA or PHA-E protein;

[0033] 4) as an inhibitor of PHA or PHA-E protein;

[0034] 5) Preparation of drugs targeting PHA or PHA-E protein;

[0035] 6) Prepare reagents or drugs for diagnosing and treating abnormal expression of PHA or PHA-E.

[0036] In another aspect, the present invention provides a nucleic acid aptamer screening chip, the chip comprising a circulating screening flow channel, in which a protein for screening nucleic acid aptamers is fixed, and a sample can circulate in the circulating screening flow channel for repeated screening.

[0037] In the existing nucleic acid aptamer microfluidic screening chip, proteins are fixed in the flow channel. When the sample containing nucleic acid aptamer flows through, some nucleic acid aptamers can bind to the protein and can be screened out. However, macromolecular proteins usually have complex three-dimensional structures and have multiple different binding sites. When some samples flow through the protein, if they happen to encounter a suitable binding site, they can be successfully screened, but it is also possible that they will miss the selection due to encountering an inappropriate binding site in the three-dimensional structure. In the existing chip, the flow channel is usually a single flow channel, and the fluid can only flow through it once, and cannot circulate through the flow channel repeatedly, nor can it circulate repeatedly to meet the fixed protein, so it is easy to miss the selection, and the process of missing the selection may occur in the positive screening or reverse screening process, resulting in a large number of nucleic acid aptamers obtained in one screening, but often the affinity and specificity are not high, and amplification is required, and repeated screening is performed again. After multiple screening and multiple amplification, a better nucleic acid aptamer can be selected.

[0038] The nucleic acid aptamer screening chip provided by the present invention can enclose the sample containing the initial nucleic acid library in a closed flow channel by using microfluidic technology, allowing the sample to repeatedly contact the target protein or interfering protein in a small volume space. By controlling the flow environment and conditions, microfluidic technology significantly improves the success rate of binding between specific sequences and targets, and can effectively obtain the target sequence without relying on amplification, reducing the probability of non-specific results, making the screening process more efficient and accurate.

[0039] Since the chip provided by the present invention does not require PCR amplification during the screening process, it is suitable for the screening of DNA aptamers, RNA aptamers or non-natural XNA aptamers. Because RNA aptamer screening needs to be reverse transcribed into DNA for amplification and then transcribed back to RNA for the next round of screening during amplification, it is easy to increase the number of non-optimal sequences due to non-specific amplification during this process; XNA lacks efficient amplification enzymes, resulting in low amplification efficiency and accuracy. Therefore, aptamer screening without nucleic acid amplification can not only greatly shorten the screening time of RNA and XNA aptamers, but also improve the credibility of the final screening sequence.

[0040] Furthermore, the chip includes a positive screening module and a reverse screening module, the positive screening module is used to positively screen nucleic acid aptamers from a sample, and the reverse screening module is used to reversely screen nucleic acid aptamers from a sample; a first circulation screening flow channel is provided in the reverse screening module, and a second circulation screening flow channel is provided in the positive screening module; an interfering protein different from the target protein is fixed in the first circulation screening flow channel; and a target protein is fixed in the second circulation screening flow channel.

[0041] The forward screening refers to directly screening the target nucleic acid aptamers that can bind to the target protein, and the reverse screening refers to removing the nucleic acid aptamers that bind to impurities.

[0042] The chip provided by the present invention maximizes the recovery rate of the target nucleic acid aptamer through positive and negative screening, effectively removes impurities, and realizes accurate screening of the target aptamer. By setting a circular screening module in both the positive screening module and the reverse screening module, the sample is repeatedly screened in both the positive screening module and the reverse screening module, and all screening processes are completed once inside the chip without amplification and re-screening.

[0043] The chip provided by the present invention has both positive screening and negative screening, and its advantages are as follows: (1) It has strong specificity. Negative screening can effectively remove aptamers that non-specifically bind to target molecules, ensure the high specificity of the final screening results, and maximize the binding efficiency by adjusting the protein fixation density, flow channel length, etc.; (2) Positive and negative screening are performed on the same chip, which can more quickly identify high-affinity aptamers, shorten the screening cycle, and improve the screening efficiency; (3) Reduce interference. By removing background noise, negative screening makes the signal clearer and improves the accuracy of the screening results; (4) Allows precise control of fluid dynamics, which helps to optimize the binding efficiency of nucleic acids and proteins in positive and negative screening; (5) Reduce reagent consumption. The design of the microfluidic system makes the amount of reagents used in the screening process less, reducing costs and resource waste; (6) It does not rely on nucleic acid amplification, can improve the screening efficiency of RNA and XNA nucleic acid aptamers, and reduce the probability of invalid screening results caused by non-specific amplification generated during the amplification process.

[0044] It can be understood that the positive screening module and reverse screening module provided by the present invention can perform cycle screening separately or cross-cycle screening. However, when performing cross-cycle screening, the control requirements for the opening and closing of valves are higher and the cost is also higher. Separate screening can make the structure simpler and the control process easier.

[0045] Further, the first circulation screening flow channel and the second circulation screening flow channel both include annular flow channels;

[0046] In some embodiments, the circulating screening channel is an annular channel connected end to end, and the sample can circulate in the annular channel. The speed and number of cycles of the sample circulating in the annular channel can be controlled by controlling the flow rate and valve.

[0047] In some methods, the fluid channel of the reverse screening module is designed as an annular flow channel, which can enhance the contact opportunity between the nucleic acid and the target protein, and realize the negative circulation of the liquid by switching the electric valve. The positive screening module is also designed as an annular flow channel. Like the reverse screening module, when the positive screening is performed, the valve of the enrichment device is in a closed state, and the flow channel is still in a closed state.

[0048] Furthermore, the target protein and interfering protein are fixed by agarose fixation method.

[0049] In some embodiments, the agarose fixation method is as follows: 1%-1.5% agarose powder is dissolved in hot water to prepare a 1%-1.5% agarose solution, and heated and stirred at 50-60°C until completely dissolved; next, the activated glass slide is immersed in the agarose solution, and the agarose solution is evenly coated on the surface of the flow channel; after coating, the agarose-coated glass slide is cured at 40-45°C for 25-30 minutes to allow the agarose coating to stably adhere to the surface of the glass slide; after curing, the agarose-coated glass slide is immersed in a solution containing the target protein (80-100 mg / mL), or the protein solution is dripped on the surface of the glass slide; finally, after the protein is fixed, the glass slide needs to be cleaned to remove unbound proteins and other impurities, and dried for subsequent use. Because agarose has good biocompatibility and hydrophilicity, it can provide a suitable environment to promote the interaction between protein and agarose, thereby achieving protein fixation.

[0050] Large molecular proteins have complex three-dimensional structures and may have multiple potential binding sites. During the screening process, nucleic acid aptamers may not be able to be specifically identified. Repeated screening can improve the screening success rate. At the same time, the protein fixation method can also help improve the screening success rate. This is because different protein fixation methods can result in different degrees of protein fixation firmness and different exposed binding sites, and the screening results will also be different.

[0051] The present invention has been proved through a large number of studies that the agarose fixation method can screen more high-affinity and high-specificity nucleic acid aptamers, thereby helping the chip to achieve one-time screening and complete the screening process without amplification. The reason may be that after the agarose fixation method is fixed, the spacing of the protein fixation is moderate, which is conducive to the binding of the protein to the nucleic acid, the fixation strength is excellent, which is conducive to the protein capturing the nucleic acid, and also avoids the protein shedding caused by long-term circulation, which is more suitable for the technical route of repeated circulation in a single flow channel in the present invention, and the interaction between the protein and the substrate is minimal, which is conducive to avoiding the interference of the substrate on the protein-nucleic acid binding process.

[0052] In some embodiments, the annular flow channel is any one or more of a circular flow channel, an elliptical flow channel, a square flow channel, a rectangular flow channel, and an irregular flow channel.

[0053] In some embodiments, the annular flow channel is preferably a square flow channel, and the four corners of the square flow channel are arc-shaped corners, which can significantly increase the contact opportunity between the sample and the protein.

[0054] Furthermore, the lengths of the first circulation screening channel and the second circulation screening channel are both 16-28 cm respectively; in the second circulation screening channel, the fixed amount of the target protein is 15-30 mg / cm 2 In the first cycle screening flow channel, the fixed amount of interfering protein reaches 15-60mg / cm 2 .

[0055] In some embodiments, the total amount of the interfering protein fixed is preferably 15*N mg / cm 2 , N is the number of interfering protein types, N is not greater than 4, and the fixed amount of each interfering protein is 15 mg / cm 2 .

[0056] The annular circulating screening flow channel has different flow channel lengths. The sample hits the inner wall of the flow channel in a completely different manner during the circulating flow process, thereby making the contact mode and contact opportunity between the sample and the fixed protein different. The present invention preferably uses a circulating flow channel with a length of 16-28 cm, and more preferably uses a square circulating flow channel with a side length of 4.5-7 cm.

[0057] In some embodiments, the flow channel has a width of 200 to 450 μm and a height of 100 to 150 μm, which optimizes the flow velocity and mixing efficiency of the fluid, is suitable for processing larger molecular proteins, and improves the effectiveness of the experiment.

[0058] The different fixed amounts of target protein and interfering protein in the flow channel directly affect the contact mode between the sample and the fixed protein. Therefore, it is also necessary to screen the appropriate fixed amount to improve the screening success rate.

[0059] Furthermore, the positive screening module and the reverse screening module are connected via a connecting channel, and the connecting channel is separated by a barrier membrane, and the barrier membrane can block macromolecular proteins.

[0060] In some embodiments, a length of about 3 to 4 cm is reserved between the positive screen module and the reverse screen module as a connecting flow channel connecting the positive screen module and the reverse screen module, and the fluidity of the liquid between the flow channels is controlled by a valve.

[0061] By setting a barrier membrane on the connecting channel, the target protein and the interfering protein can be directly separated, so that the positive screening module and the reverse screening module do not interfere with each other when fixing the protein.

[0062] Furthermore, a first valve is provided on the connecting channel for controlling fluid connection or disconnection between the positive screening module and the reverse screening module; a second valve is provided on the circulating screening flow channel of the reverse screening module for controlling the sample to enter the positive screening module.

[0063] Furthermore, it also includes a sample tank and a liquid storage tank, the sample tank is located on the first circulation screening flow channel; the first circulation screening flow channel and the second circulation screening flow channel are respectively provided with pneumatic valves, which are respectively used to drive the flow of samples in the positive screening module and the reverse screening module; the liquid storage tank is connected to the positive screening module, and is used to collect the nucleic acid aptamer solution obtained by the positive screening module or the discharged waste liquid.

[0064] In some embodiments, the nucleic acid aptamer screening chip provided by the present invention includes a screening device, a driving device, a control device and an enrichment device. The screening device is used to screen the target nucleic acid aptamer, including a positive screening module and a reverse screening module.

[0065] The driving device is used to drive the sample to flow in the screening device to complete the screening.

[0066] In some embodiments, the driving device is designed with a bidirectional air pump, which can achieve positive and negative pressures by changing the working direction of the pump. A solenoid valve or a pneumatic valve is connected behind the unidirectional air pump to control the direction of the airflow. When the valve is switched, gas is pumped or extracted to achieve alternating positive and negative pressures. By alternating the rate of positive and negative pressures by the air pump, the flow rate and flow conditions in nucleic acid aptamer screening are adjusted, which can improve the binding and elution processes and enhance the selection of high-affinity nucleic acid aptamers. At the same time, the silicone layer in the chip undergoes downward squeezing and upward lifting due to changes in air pressure, thereby achieving the control of the absorption and extrusion of the liquid in the flow channel, and promoting the full combination of the nucleic acid library and the fixed protein in the sample.

[0067] The flexible airflow control, through the combination of a bidirectional air pump and an electric valve, enables the chip to easily achieve alternating positive and negative pressures, accurately control liquid flow, and enhance the operability of the experiment.

[0068] The control device includes various inventions arranged in the flow channel, and controls the flow direction of the sample by controlling the opening and closing of the valves in each flow channel.

[0069] In some embodiments, the control device includes a micro electric valve, which is electrically controlled to open and close to control the negative screening cycle and the flow of samples after negative screening to the positive screening module for further screening.

[0070] The enrichment device is used for eluting and enriching the screened nucleic acid aptamers.

[0071] In some embodiments, the enrichment device includes a liquid storage tank, and a flow channel of a certain distance is reserved at one end of the annular flow channel of the positive screen module, through which the liquid storage tank is connected to the positive screen module.

[0072] In some embodiments, the enrichment device enriches the nucleic acid aptamer by magnetic enrichment. After the positive screening is completed, NaoH solution is added to the positive screening module for elution, and the liquid elutes and carries the target nucleic acid aptamer, flows into the liquid storage tank through the flow channel, and is enriched by the magnetic enrichment device. The magnetic enrichment device can effectively recover the target nucleic acid aptamer and improve the yield and purity after screening.

[0073] In some embodiments, the nucleic acid aptamer screening chip provided by the present invention is divided into three layers of structure: upper, middle and lower. The upper plastic plate adopts 3D printing technology, and PETG (polyethylene terephthalate) is selected as the 3D printing material. PETG combines the advantages of PLA (polylactic acid) and ABS (acrylonitrile-butadiene-styrene), has good toughness and chemical resistance, and has moderate printing difficulty. At the same time, the upper plastic plate is pre-designed with three air holes on both sides for the introduction of the air pump, and the surface of the sample pool is reserved at the position corresponding to the negative screening, and the area for installing the valve in the control device is reserved. The middle silicone layer selects PDMS (polydimethylsiloxane), a material commonly used on the market, because of its excellent biocompatibility and transparency, it is suitable as a sealing layer, and the transparency of silicone is also convenient for observing the progress of the experiment. The silicone layer connects the upper and lower structures to create a sealed environment for the lower layer to prevent liquid from splashing out, and has good air tightness, which ensures the integrity and airtightness of the sample to be tested and the liquid reagent.

[0074] The driving device is convenient to alternately apply positive and negative pressure to drive the flow of the flow channel liquid. The upper and middle layers are made of PETG material and PDMS silicone layer manufactured by 3D printing technology, which reduces the material cost and ensures the performance. The lower layer uses silicate glass, which is suitable for the screening of nucleic acid aptamers due to its good optical transparency and chemical stability. The glass plate area is divided into two parts of equal area. The left and right sides are respectively controlled by valves for reverse screening and valves for forward screening. The transparency design of the lower silicate glass is convenient for monitoring and regulation, allowing real-time observation of the liquid situation in the flow channel, and precise control of the fluid flow is achieved by controlling the valve. The rectangular silicate glass plate is etched by a photolithography machine. The depth (height) of the flow channel designed according to fluid dynamics is 100-150μm. This design not only helps to improve the flow speed and mixing efficiency of the fluid, but also is suitable for the operation of larger molecules and cells.

[0075] In some embodiments, the edges of the upper, middle and lower structures are designed to leave space for fixing nuts and controlling valves. The upper, middle and lower layers are sealed and fixed by nuts and rubber rings. At the same time, the upper, middle and lower layers all leave space for sample pools to facilitate sample addition.

[0076] The layers are sealed and fixed by nuts and rubber rings, which is convenient for assembly and disassembly, and simplifies the maintenance and replacement process. The design leaves an area for the sample pool, which is convenient for rapid sample addition and reagent replacement, and improves the efficiency of the experiment.

[0077] The nucleic acid aptamer screening chip design provided by the present invention significantly improves the efficiency and reliability of nucleic acid aptamer screening by optimizing materials and structures and combining efficient fluid dynamics with flexible control methods, which not only improves the effectiveness of the experiment, but also provides a strong guarantee for future biomedical research.

[0078] In another aspect, the present invention provides a method for screening nucleic acid aptamers, wherein the method uses the nucleic acid aptamer screening chip as described above for screening.

[0079] Furthermore, the method comprises the following steps:

[0080] (1) preparing a nucleic acid aptamer screening chip, selecting a target protein to be fixed in a positive screening module, and selecting an interfering protein to be fixed in a negative screening module;

[0081] (2) adding a sample containing a random nucleic acid library to a sample tank, and driving the sample to undergo cyclic screening in a reverse screening module;

[0082] (3) After the reverse screening is completed, the sample is driven into the positive screening module for cyclic screening;

[0083] (4) After the positive screening is completed, the solution obtained by the screening is eluted and collected, the nucleic acid aptamers are enriched, and sequencing is performed.

[0084] Compared with the traditional SELEX technology, the screening mode designed in the present invention omits the amplification step in the screening process, does not rely on traditional high-precision screening methods, and achieves high-quality screening of targets through multiple and efficient cycle modes, greatly reducing the time and cost of screening and improving efficiency and accuracy.

[0085] The positive screening module and reverse screening module provided by the present invention can be used for cyclic screening separately, or cross-circulated screening can be used, such as 1. reverse screening is performed first, and then positive screening is performed; 2. cross-circular screening, such as reverse screening is performed first, then positive screening, then reverse screening, then positive screening, etc. There are many cross-circular screening methods, such as reverse screening cycle first, then positive screening cycle, then reverse cycle, then positive screening cycle, etc. Different circulation methods can be flexibly screened. The present invention has been proved by a large number of experiments that the first method has the highest screening efficiency, and the control method is simple and the cost is lower.

[0086] Furthermore, the number of cycles of the sample in step (2) in the reverse screening module is 5 to 15; the number of cycles of the sample in step (3) in the forward screening module is 5 to 15.

[0087] After 5 to 15 cycles of positive screening and reverse screening, target nucleic acid aptamers with high affinity and high specificity can be screened at one time.

[0088] In some embodiments, the method for screening a nucleic acid aptamer that binds to a PHA protein comprises the following steps:

[0089] (1) Synthesizing a random single-stranded DNA library and primers, adding 0.1-0.15M NaCl and 0.01-0.05M MgCl2 (adjusted according to the expected working environment ion concentration of the nucleic acid aptamer, as consistent as possible but not exceeding the range), and adding 0.5-3% polyvinyl alcohol (PVA). Among the above substances, sodium ions and magnesium ions play an important role in the folding of nucleic acids, thus affecting the screening efficiency. PVA can help the binding of proteins and nucleic acids in the microfluidic channel;

[0090] (2) Microfluidic chip screening: Perform at least 5 to 15 rounds of reverse and forward screening (no amplification between rounds like the traditional SELEX method). After 5 to 15 rounds of forward screening, the remaining samples in the microchannel are discharged (the liquid in the channel at this time is all nucleic acid aptamers with no binding effect), and then eluted with 2M NaOH, and the aptamer solution obtained after screening is collected, and the specific sequence is obtained by sequencing.

[0091] In some methods, a nucleic acid aptamer microfluidic screening chip is prepared first, and the silicate glass plate is first cleaned with deionized water and 70% ethanol to remove impurities, and then aminosilane (APTES) is used to coat the glass surface after drying, and reacted at room temperature for 1-2 hours. Rinse with deionized water to remove unbound activator.

[0092] Protein fixation is divided into positive screening channel protein fixation and negative screening channel protein fixation. For positive screening, PHA proteins (PHA-E and PHA-L) are dissolved in appropriate buffer (such as PBS) at a concentration of 10-15 μg / mL. The concentration is increased to ensure complete reaction during incubation and fully fixed to the silicate glass plate. The protein solution is added dropwise to the activated glass plate and incubated at room temperature for 1-2 hours. For negative screening, ConA (canavalin A), LCA (lentil agglutinin), SBA (soybean agglutinin), and BAS (hematoxylin agglutinin) are selected. These four proteins are common plant lectins and often appear in legumes and vegetables at the same time as PHA. The experimental background is set to PHA protein, and these proteins are considered to be interfering impurities in the screening process. The steps for fixing these four proteins to the negative screening channel are the same as the steps for positive screening fixation mentioned above. After the positive and negative screening incubations are completed, rinse with PBS buffer to remove unbound proteins. Dry at room temperature or in a low-temperature oven to ensure that the bound proteins are stable.

[0093] The conventional conditions for nucleic acid aptamer screening are carried out in an ion buffer (TE buffer). Adding a certain concentration of sodium chloride solution can reduce nonspecific binding by shielding electrostatic effects, ensuring the specific binding of nucleic acid aptamers to the target protein. This removes those sequences that have weak binding ability to the target PHA or are only adsorbed. Studies have shown that adding an appropriate concentration of sodium chloride (10-100nM) or magnesium chloride (1-10nM) solution to the initial sample for screening can help nucleic acids fold, making the screening process more affinity and obtaining nucleic acid aptamers with better binding effects.

[0094] At the same time, experiments have found that an appropriate amount (0.5-3%) of polyvinyl alcohol (PVA) can change the fluidity of the liquid in the flow channel. PVA has good biocompatibility, can help stabilize droplets, reduce surface tension, and is beneficial to further improve the screening efficiency by controlling the flow rate of the liquid in the flow channel.

[0095] Through the two modules of positive screening and negative screening, the nucleic acid aptamers screened out have higher affinity and better specificity. They only bind to PHA proteins and do not bind to other proteins, preparing for post-SPRi (surface plasmon resonance imaging) detection of different types of PHA proteins, as well as adapting to different detection modes and target PHA sequences.

[0096] The present invention screens nucleic acid aptamers that bind to PHA protein through a nucleic acid aptamer screening chip, and accurately optimizes and controls fluid flow, concentration and reaction time to improve the screening effect.

[0097] In order to further classify the selected aptamers that bind to PHA proteins, further testing is required using SPRi technology. The detected sequences are divided into two categories: aptamers specific to PHA-E, which are suitable for specific detection of PHA-E proteins, and aptamers that are selective for PHA-E and PHA-L, which are suitable for measuring the total amount of PHA proteins. At the same time, these two categories are further differentiated into aptamers suitable for measuring free PHA proteins and aptamers suitable for measuring fixed PHA proteins.

[0098] The beneficial effects of the present invention are:

[0099] 1. The nucleic acid aptamer for PHA was screened and obtained for the first time, solving the PHA detection problem in the existing technology;

[0100] 2. The structure of PHA protein has two subtypes, E and L, of which only E is harmful to the human body. The present invention obtains a nucleic acid aptamer that is only targeted at PHA-E through reverse screening, which has high specificity, and also obtains a nucleic acid aptamer that can bind to PHA-E and PHA-L at the same time;

[0101] 3. Screen out nucleic acid aptamers suitable for detection in fixed state and free state respectively, and improve the nucleic acid aptamer-protein binding efficiency of different detection methods;

[0102] 4. Provide a new nucleic acid aptamer screening chip with a circular screening flow channel. Through the microfluidic method, the nucleic acid aptamer initial library is repeatedly contacted with the fixed protein in the circular flow channel. The effects of different protein fixation methods on the screening of nucleic acid aptamers are compared, the flow rate is optimized and controlled for binding force screening, and weakly binding sequences are removed. The binding rate of specific sequences is guaranteed by controlling the cycle time, and the specificity is further improved through reverse screening;

[0103] 5. This chip can be used to complete positive and negative screening without amplification, and both positive and negative screening can be performed in cycles, which improves efficiency while ensuring specificity;

[0104] 6. Improved screening efficiency and screening success rate: For some target proteins, conventional screening methods require multiple rounds or are difficult to screen for high-affinity nucleic acid aptamers. With this chip, screening can be completed in one go without amplification, which is not only faster and more convenient, but also allows screening for nucleic acid aptamers with higher affinity and specificity;

[0105] 7. The nucleic acid aptamer screening chip adopts a three-layer convenient assembly, which is particularly suitable for screening nucleic acid aptamers of protein substances. Compared with the current method of usually fixing protein targets on magnetic beads (magnetic beads easily cause the screened nucleic acid aptamers to be specific to magnetic beads and are expensive), it has the characteristics of simple assembly, low cost and high specificity;

[0106] 8. It is suitable for the screening of DNA aptamers, RNA aptamers or non-natural aptamers;

[0107] 9. This method provides a novel and efficient solution for the nucleic acid aptamer screening process, which has broad potential application prospects, especially in the field of biological analysis that requires high sensitivity and high specificity. BRIEF DESCRIPTION OF THE DRAWINGS

[0108] Figure 1 is a stereoscopic diagram of the nucleic acid aptamer screening chip in Example 1;

[0109] Figure 2 This is an exploded view of the nucleic acid aptamer screening chip in Example 1;

[0110] Figure 3 A top view of the nucleic acid aptamer screening chip in Example 1;

[0111] Figure 4 Schematic diagram of the flow channel screening process in the nucleic acid aptamer screening chip in Example 1;

[0112] Figures 5 to 10 This is a schematic diagram of the detection result of SPRI detecting the affinity between nucleic acid aptamer and PHA-E protein in Example 3;

[0113] Fig.11 This is an example diagram showing that the nucleic acid aptamer can be highly responsive to the PHA-E protein in Example 6;

[0114] Fig.12 This is a schematic diagram of the detection results of sequence signal responses specific to both PHA-E and PHA-L proteins in Example 7;

[0115] Fig.13 Schematic diagram of the effect of Tris-HCl buffer solutions with different pH values ​​on the test results in Example 8;

[0116] Fig.14 Schematic diagram of the fluorescence intensity of the corresponding proteins of the nucleic acid aptamers for detecting PHA-E protein and the total amount of PHA protein in Example 8;

[0117] Fig.15 This is a signal diagram of the cyclic voltammetry curve for detecting PHA protein and PHA-E protein in Example 8; Fig.16 , Fig.17 This is a schematic diagram of the results of screening nucleic acid aptamers using the electrochemical method in Example 10. DETAILED DESCRIPTION

[0118] The present invention is further described in detail below in conjunction with the examples. It should be noted that the examples described below are intended to facilitate the understanding of the present invention and do not have any limiting effect on it. The reagents not particularly specified in the present examples are all known products and were obtained by purchasing commercially available products.

[0119] TCEP, K3[Fe(CN)6], phytohemagglutinin (PHA), TE buffer, and PBS buffer were purchased from Aladdin (Shanghai, China). PEG 2000, MgCl2, and NaCl were purchased from Hangzhou Shuanglin Chemical Reagent Co., Ltd. Ultrapure water was used in all experiments.

[0120] The adhesive prism was purchased from SensIR, USA, model number: SensIR: SPR-1; the gold chip was purchased from ElectronMicroscopy Sciences, USA, model number: Electron Microscopy Sciences: Au-20; the refractive index oil was purchased from Cargille Labs, model number: Cargille Labs: Series 1; and the graphene oxide was purchased from XG Science, USA, model number: XG Sciences: XG-100.

[0121] SPE (screen-printed electrode) was produced by Botan Technology Co., Ltd. (Weihai, China), including a gold working electrode, a platinum counter electrode, and an Ag / AgCl reference electrode. Electrochemical experiments were performed using a CHI660E electrochemical workstation (Shanghai Chenhua Instrument Co., Ltd.).

[0122] Example 1: Nucleic acid aptamer screening chip provided by the present invention

[0123] The nucleic acid aptamer screening chip 1 provided in this embodiment is as follows Figure 1 to Figure 4As shown, it includes a circulating screening flow channel 2, in which a protein 4 for screening nucleic acid aptamers 3 is fixed, and the sample can circulate in the circulating screening flow channel 2 and be screened repeatedly. The nucleic acid aptamer screening chip 1 includes a positive screening module 5 and a reverse screening module 6, the positive screening module 5 is used to positively screen nucleic acid aptamers from the sample, and the reverse screening module 6 is used to reversely screen nucleic acid aptamers from the sample; a first circulating screening flow channel 7 is provided in the reverse screening module 6, and a second circulating screening flow channel 8 is provided in the positive screening module 5; an interfering protein different from the target protein is fixed in the first circulating screening flow channel 7; and a target protein is fixed in the second circulating screening flow channel 8. The target protein and the interfering protein are fixed by agarose fixation method, and 1% agarose powder is dissolved in hot water to prepare a 1% agarose solution, and heated and stirred at 60°C until completely dissolved. Next, the activated glass sheet is immersed in the agarose solution, and the agarose solution is evenly coated on the surface of the flow channel. After coating, the glass slide coated with agarose is cured at 40°C for 30 minutes under appropriate conditions so that the agarose coating is stably attached to the surface of the glass slide. The curing conditions may include the control of factors such as temperature, time and humidity. After curing, the glass slide is immersed in a solution containing the target protein (100 mg / mL), or the protein solution is dripped on the surface of the glass slide. Since agarose has good biocompatibility and hydrophilicity, it can provide a suitable environment to promote the interaction between protein and agarose, thereby achieving protein fixation. Finally, after the protein is fixed, the glass slide needs to be washed to remove unbound proteins and other impurities, and dried for subsequent use. This fixation method can screen more high-affinity and high-specificity nucleic acid aptamers, which helps the chip to achieve one-time screening and complete the screening process without amplification.

[0124] The first circulation screening flow channel 7 and the second circulation screening flow channel 8 both include an annular flow channel connected end to end, and the sample can circulate in the annular flow channel. By controlling the flow rate and valve, the speed and number of circulations of the sample in the annular flow channel can be controlled. Among them, the reverse screening module 6 is provided with a first annular flow channel 9, which can enhance the contact opportunity between the nucleic acid and the target protein, and realize the negative circulation of the liquid by the switch of the electric valve. The positive screening module 5 is provided with a second annular flow channel 10, which is the same as the reverse screening module 6. When the forward screening is performed, the valve 11 of the enrichment device is in a closed state, and the flow channel is still in a closed state. The annular flow channel can be any one or more of a circular flow channel, an elliptical flow channel, a square flow channel, a rectangular flow channel, and an irregular flow channel. In the present embodiment, the first annular flow channel 9 and the second annular flow channel 10 are preferably square flow channels, and the four corners of the square flow channel are arc-shaped corners, which can significantly increase the contact opportunity between the sample and the protein.

[0125] In this embodiment, the lengths of the first circulation screening channel 7 and the second circulation screening channel 8 are both more than 15 cm. The annular circulation screening channel 2 has different channel lengths, and the way the sample hits the inner wall of the channel during the circulation process is completely different, so that the contact method and contact opportunity between the sample and the fixed protein will be different. This embodiment preferably uses a circulation screening channel 2 with a length of 20 cm, and more preferably uses a square circulation channel with a side length of 5 cm. Among them, the width of the circulation screening channel 2 is 100-150 μm (the preferred width in this embodiment is 120 μm), and the height is 100-150 μm (the preferred height in this embodiment is 120 μm). In the second circulation screening channel 8, the fixed amount of the target protein reaches 10-15 mg / cm 2 (This embodiment is preferably 15 mg / cm 2 ), in the first cycle screening flow channel 7, the fixed amount of interfering protein reached 30-60 mg / cm 2 (In this embodiment, the fixed amount of interfering protein is preferably 15*N mg / cm 2 , N is the number of interfering protein types, N is not greater than 4, and the fixed amount of each interfering protein is 15 mg / cm 2 ).

[0126] like Figure 1 to Figure 3 The positive screening module 5 and the reverse screening module 6 are connected by a connecting channel 12, and the length of the connecting channel 12 is about 3 to 4 cm. The fluidity of the liquid between the channels is controlled by a valve. A barrier membrane 13 is also provided on the connecting channel 12. The barrier membrane 13 can block large molecular proteins and can directly separate the target protein and the interfering protein, so that the positive screening module 5 and the reverse screening module 6 do not interfere with each other when fixing the protein. A first valve 14 is provided on the connecting channel 12, which is used to control the fluid connection or disconnection between the positive screening module 5 and the reverse screening module 6; the circulating screening channel of the reverse screening module 6 is provided with a second valve 15, which is used to control the sample entering the positive screening module 5. The nucleic acid aptamer screening chip 1 is also provided with a sample slot 16 and a liquid storage tank 17. The sample slot 16 is located on the first circulation screening channel 7; the first circulation screening channel 7 and the second circulation screening channel 8 are respectively provided with pneumatic valves 18, which are respectively used to drive the flow of samples in the positive screening module 5 and the reverse screening module 6; the liquid storage tank 17 is connected to the positive screening module 5, and is used to collect the nucleic acid aptamer solution obtained by screening the positive screening module 5 or the discharged waste liquid.

[0127] according to Figure 1 to Figure 4It can also be seen that the nucleic acid aptamer screening chip 1 includes a screening device 19, a driving device 20, a control device 21 and an enrichment device 22, and the screening device 19 is used to screen the target nucleic acid aptamer, including a positive screening module 5 and a reverse screening module 6. The driving device 20 is used to drive the sample to flow in the screening device 19 to complete the screening. The driving device 20 is designed with a two-way air pump (pneumatic valve 18), and positive pressure and negative pressure can be achieved by changing the working direction of the pump. The two-way air pump is connected to a solenoid valve or a pneumatic valve behind the one-way air pump to control the direction of the airflow. When the valve is switched, gas is pumped or extracted to achieve alternating positive and negative pressures. By alternating the rate of positive and negative pressures by the air pump, the flow rate and flow conditions in the nucleic acid aptamer screening are adjusted, the binding and elution processes can be improved, and the selection of high-affinity nucleic acid aptamers can be enhanced. At the same time, the silica gel layer in the chip undergoes downward squeezing and upward lifting due to changes in air pressure, thereby achieving the control of the flow of the liquid in the flow channel, and promoting the full reaction of the nucleic acid library and the fixed protein in the sample. By combining a bidirectional air pump with an electric valve, the chip can achieve flexible airflow control, conveniently realize alternating positive and negative pressures, accurately control liquid flow, and enhance the operability of the experiment. The control device 21 includes various inventions set in the flow channel, and controls the flow direction of the sample by controlling the switch of the valves in each flow channel. The control device 21 includes a micro electric valve, which is electrically controlled to open and close to control the reverse screening cycle and the flow of the reverse screened sample to the positive screening module 5 for further screening.

[0128] The enrichment device 22 is used to elute and enrich the screened nucleic acid aptamers. The enrichment device 22 includes a liquid reservoir 17, and a flow channel 23 is left at one end of the annular flow channel of the positive screening module 5. The liquid reservoir 17 is connected to the positive screening module 5 through the flow channel 23. The enrichment device 22 enriches nucleic acid aptamers through magnetic enrichment. When the positive screening is completed, NaoH solution is added to the positive screening module 5 for elution. The liquid is eluted and carries the target nucleic acid aptamer, flows into the liquid reservoir 17 through the flow channel 23, and is enriched by the magnetic enrichment device. The magnetic enrichment device can be a magnetic bead, which can effectively recover the target nucleic acid aptamer and improve the yield and purity after screening.

[0129] like Figure 1 and Figure 2The nucleic acid aptamer screening chip 1 provided by the present invention is divided into three layers of structure: upper, middle and lower. The upper plastic plate 24 adopts 3D printing technology and selects PETG (polyethylene terephthalate) as the 3D printing material. PETG combines the advantages of PLA (polylactic acid) and ABS (acrylonitrile-butadiene-styrene), has good toughness and chemical resistance, and has moderate printing difficulty. At the same time, the upper plastic plate 24 is pre-designed with three air holes on both sides for the introduction of the air pump, and the surface of the sample pool is reserved at the position corresponding to the negative screening, and the area for installing the valve in the control device is reserved. The middle silicone layer 25 selects PDMS (polydimethylsiloxane), a material commonly used on the market, because of its excellent biocompatibility and transparency, it is suitable as a sealing layer, and the transparency of silicone is also convenient for observing the progress of the experiment. The silicone layer connects the upper and lower structures to create a sealed environment for the lower layer to prevent liquid from splashing out, and has good air tightness, ensuring the integrity and airtightness of the sample to be tested and the liquid reagent.

[0130] The driving device is convenient to alternately apply positive and negative pressure to drive the flow of the flow channel liquid. The upper plastic plate 24 and the middle silicone layer 25 are made of PETG material and PDMS silicone layer made by 3D printing technology, which reduces the material cost and ensures the performance. The lower layer is a silicate glass layer 26. Because silicate glass has good optical transparency and chemical stability, it is suitable for the screening of nucleic acid aptamers. The glass plate area is divided into two parts of equal area. The left and right sides are respectively controlled by valves for reverse screening and valves for forward screening. The transparency design of the lower silicate glass is convenient for monitoring and regulation, allowing real-time observation of the liquid situation in the flow channel, and precise control of the fluid flow is achieved by controlling the valve. The rectangular silicate glass plate is etched by a photolithography machine, and the flow channel depth (height is 100-150μm) designed according to fluid dynamics. This design not only helps to improve the flow speed and mixing efficiency of the fluid, but also is suitable for the operation of larger molecules and cells. When designing the edges of the upper, middle and lower structures, space should be left for fixing nuts and control valves. The upper, middle and lower layers are sealed and fixed by nuts and rubber rings. At the same time, the upper, middle and lower layers all leave an area of ​​sample slot 16 for easy sample addition. Each layer is sealed and fixed by nuts and rubber rings, which is convenient for assembly and disassembly, simplifying the maintenance and replacement process. The area of ​​sample slot 16 is left in the design, which is convenient for quick sample addition and reagent replacement, improving the efficiency of the experiment.

[0131] The design of the nucleic acid aptamer screening chip 1 provided in this embodiment significantly improves the efficiency and reliability of nucleic acid aptamer screening by optimizing materials and structures, combining efficient fluid dynamics with flexible control methods. The preparation and assembly process is as follows:

[0132] 1. Material preparation: The upper material is a PETG plastic plate 24, which is used to seal the top of the chip; the middle material is a silicone layer 25, which has excellent flexibility and chemical stability, and is used to connect the upper and lower plates to promote the sealing of the assembly; the lower material is a silicate glass plate (silicate glass layer 26), which is engraved with a microfluidic chip flow channel and is designed to guide the flow of liquid. We use rubber rings and nuts as connectors to fasten the layers of materials. At the same time, prepare the air pump (pneumatic valve 18), liquid storage tank 17, and electric valves (first valve 14 and second valve 15).

[0133] 2. Assembly steps:

[0134] (1) Bottom layer preparation:

[0135] A clean silicate glass layer 26 with a suitable flow channel etched on the glass plate according to the experimental requirements is selected to ensure that the surface is dust-free and scratch-free.

[0136] (2) Middle layer assembly:

[0137] The silica gel layer 25 is placed on top of the silicate glass layer 26 to ensure that the inner film completely covers the flow channel area and that the inner film is firmly bonded to the bottom layer to prevent leakage.

[0138] (3) Upper assembly:

[0139] The plastic plate 24 is covered on the silica gel layer 25 to form the top structure of the nucleic acid aptamer screening chip 1 . The upper structure plays a role in squeezing the silica gel layer 25 to form the nucleic acid aptamer screening chip 1 with a complete three-layer structure.

[0140] (4) Connection module:

[0141] After aligning the upper, middle and lower layers, they are integrated and sealed with nuts and rubber rings. The rubber rings serve to reinforce the contact between the nuts and the three-layer plates. At the same time, the rubber rings are used to form a seal between the layers to prevent liquid leakage. Connect the flow channel of the positive screen module 5 to the liquid storage tank 17 to collect the screened liquid. Check the pressure and flow rate of the air pump to ensure the effectiveness of the screening process. Connect the air pump to the air holes 27 of the positive screen module 5 and the reverse screen module 6 to ensure that they can work normally and provide the required positive and negative pressures, so as to facilitate subsequent experiments to control the flow rate of the liquid in the flow channel. After completing the assembly, check whether each connection point is tight and confirm that there is no leakage. Perform preliminary debugging and test the flow of the fluid with the air pump to ensure that the positive screen module 5 and the reverse screen module 6 can work normally.

[0142] The method for screening nucleic acid aptamers using the nucleic acid aptamer screening chip 1 provided in this embodiment is as follows:

[0143] (1) preparing a nucleic acid aptamer screening chip, selecting a target protein to be fixed in a positive screening module, and selecting an interfering protein to be fixed in a negative screening module;

[0144] (2) synthesizing random single-stranded DNA libraries and primers to prepare initial samples;

[0145] (3) Adding samples to the sample tank, driving the samples to be circulated and screened in the reverse screening module, the number of circulated screening is 5 to 15 circles;

[0146] (4) After the reverse screening is completed, the sample is driven into the positive screening module for cyclic screening, and the number of cyclic screening circles is 5 to 15 circles;

[0147] (5) After the positive screening is completed, all the liquid in the flow channel is pumped into the waste liquid tank, and then the elution liquid is pumped into the flow channel. The waste liquid tank is replaced with a collection container to collect the eluted solution, which contains the nucleic acid sequence obtained by screening and is sequenced.

[0148] Preferably, 0.1-0.15M NaCl and 0.01-0.05M MgCl2 (adjusted according to the expected working environment ion concentration of the nucleic acid aptamer, as consistent as possible but not exceeding the range) are added to the initial sample, and 0.5-3% polyvinyl alcohol (PVA) is added. Among the above substances, sodium ions and magnesium ions play an important role in the folding of nucleic acids, and therefore affect the screening efficiency. PVA can help the binding of proteins and nucleic acids in the microfluidic channel.

[0149] Example 2: Effects of different protein fixation methods on screening results

[0150] This embodiment adopts the nucleic acid aptamer screening chip provided in Example 1, wherein the interfering proteins ConA (canavalin A agglutinin), LCA (lentil bean agglutinin), SBA (soybean agglutinin), and BAS (hematoxylin agglutinin) are fixed in the first cycle screening channel 7; the target protein PHA-E is fixed in the second cycle screening channel, and the fixing methods are respectively as follows:

[0151] 1. Agarose fixation method (Example 1): 1%-1.5% agarose powder is dissolved in hot water to prepare a 1%-1.5% agarose solution, and heated and stirred at 50-60°C until completely dissolved. Next, the activated glass slide is immersed in the agarose solution, and the agarose solution is evenly coated on the surface of the flow channel. After coating, the glass slide coated with agarose is cured at 40-45°C for 25-30 minutes under appropriate conditions so that the agarose coating is stably attached to the surface of the glass slide. The curing conditions may include the control of factors such as temperature, time and humidity. After curing, the glass slide is immersed in a solution containing the target protein (80-100 mg / mL), or the protein solution is dripped on the surface of the glass slide. Because agarose has good biocompatibility and hydrophilicity, it can provide a suitable environment to promote the interaction between protein and agarose, thereby achieving protein fixation. Finally, after the proteins have been fixed, the slides need to be washed to remove unbound proteins and other impurities and dried for subsequent use.

[0152] 2. Glutaraldehyde fixation method: Mix glutaraldehyde and solvent (such as methanol, ethanol, etc.) to obtain a 2.5% glutaraldehyde solution. Soak the slide in a solution containing the target protein (80-100 mg / mL), add glutaraldehyde solution to cover the entire flow channel, and fix for 0.5 to 2 hours.

[0153] 3. His tag method: Add a His tag to the protein, then perform plasma treatment on the glass surface to increase its hydrophilicity and reactivity, coat the glass surface with 10% APTES solution and incubate in a water bath at 50°C for one hour, inject the solution containing the target protein into the glass channel of the microfluidic chip and fix it for 2 hours, and then coat with bovine serum albumin to complete the surface sealing.

[0154] The random single-stranded DNA library and primers shown in the following sequences were synthesized:

[0155] Random single-stranded DNA library: 5'-TCCAGCACTCCACGCATAAC(36N)GTTATGCGTGCTACCGTGAA-3'; wherein "36N" represents a sequence formed by connecting 36 random nucleotide bases.

[0156] The nucleic acid aptamer screening method is as shown in Example 1, the number of rounds of reverse screening cycle screening is 5 to 15 rounds, and the number of rounds of positive screening cycle screening is also 5 to 15 rounds, wherein a sodium chloride (NaCl) solution of less than 0.15M is added to the sample, and NaOH solution is used for elution after the 5th to 15th rounds of positive screening, and the eluate is collected in a liquid storage tank and sequenced by a magnetic enrichment device. 30 nucleic acid aptamers with the highest affinity (the lower the KD value, the stronger the affinity) are screened from the chips prepared by each protein fixation method, and the effects of nucleic acid aptamer chips prepared by three different protein fixation methods on the screening results are compared. The results are shown in Table 2.

[0157] Table 2. Effects of different protein fixation methods

[0158] Fixation method KD value range (nM) 1 2～140 2 100～350 3 80～500

[0159] According to Table 2, the affinity of the aptamer screened by the nucleic acid aptamer screening chip prepared by the agarose fixation method is significantly higher than that of other protein fixation methods. The reason may be that the density and strength of protein fixation and the changes in the glass surface properties after fixation are most suitable for the binding of proteins and nucleic acids.

[0160] Therefore, by using the agarose fixation method provided in Example 1 to fix the protein, high-affinity and high-specificity nucleic acid aptamers can be screened once without amplification, while other protein fixation methods are difficult to achieve the same effect.

[0161] Example 3: Effect of flow channel length on screening results

[0162] This embodiment adopts the nucleic acid aptamer screening chip provided in Example 1, wherein the interfering proteins ConA (canavalin A agglutinin), LCA (lentil agglutinin), SBA (soybean agglutinin), and BAS (hematoxylin agglutinin) are fixed in the first circulation screening channel 7; the target protein PHA-E is fixed in the second circulation screening channel, wherein the circulation screening channel lengths of the positive screening module and the reverse screening module are 8, 12, 16, 24, 28, 30, and 36 cm, respectively. Using the random single-stranded DNA library provided in Example 2, chips prepared with each circulation screening channel length are used to screen out 30 nucleic acid aptamers with the highest affinity, and the effects of nucleic acid aptamer chips prepared with three different circulation screening channel lengths on the screening results are compared.

[0163] It was found that when the length of the circulating screening flow channel was 8-16 cm, 30 or 36 cm, the upper limit of the KD value of the nucleic acid aptamer obtained by the prepared chip screening was above 300 nM, that is, many inappropriate sequences were not removed during the screening process. When the length of the circulating screening flow channel was 16-28 cm, the KD value of the nucleic acid aptamer obtained by the prepared chip screening was generally lower than 200 nM. The reason may be that the length of the flow channel determines the contact area and release time of the protein and nucleic acid. Therefore, it is preferred to use a circulating screening flow channel length of 16-28 cm, which can significantly improve the screening success rate.

[0164] Example 4: Effect of protein fixation amount on screening results

[0165] This embodiment adopts the nucleic acid aptamer screening chip provided in Example 1, wherein the interfering proteins ConA (canavalin A), LCA (lentil lectin), SBA (soybean lectin), and BAS (hematoxylin lectin) are fixed in the first circulation screening flow channel 7; the target protein PHA-E is fixed in the second circulation screening flow channel, wherein the fixed amount of the target protein in the circulation screening flow channel of the positive screening module is 10, 15, and 20 mg / cm 2 , 4 interfering proteins were fixed in the circulating screening flow channel of the reverse screening module, and the fixed amount of each interfering protein was 4, 10, and 15 mg / cm 2 Using the random single-stranded DNA library provided in Example 2, chips prepared with different protein immobilization amounts were used to screen out 30 nucleic acid aptamers with the highest affinity, and the effects of nucleic acid aptamer chips prepared with different protein immobilization amounts on the screening results were compared. The results are shown in Table 3.

[0166] Table 3. Effect of different protein fixation amounts

[0167]

[0168] The detection found that the fixed amount of target protein was 15mg / cm 2 The interfering protein fixation amount is 15 mg / cm 2 The KD value of the nucleic acid aptamer obtained by the prepared chip screening was the smallest when the protein was too sparsely fixed, resulting in a decrease in the nucleic acid capture amount, and too dense protein fixation caused mutual interference between the binding of nucleic acid and protein, resulting in reduced efficiency. Therefore, it is preferred to use a target protein fixation amount of 15 mg / cm 2 The interfering protein fixation amount is 15 mg / cm 2 , which can significantly improve the screening effect.

[0169] Example 5: Screening of nucleic acid aptamers binding to PHA-E protein

[0170] This embodiment adopts the nucleic acid aptamer screening chip provided in Example 1, wherein the interfering proteins ConA (canavalin A agglutinin), LCA (lentil bean agglutinin), SBA (soybean agglutinin), and BAS (hematoxylin agglutinin) are fixed in the first cycle screening channel 7; the target protein PHA-E is fixed in the second cycle screening channel, and the fixing method is as shown in Example 1, and the fixed amount of the target protein is 15 mg / cm 2 The fixed amount of each interfering protein is 15 mg / cm 2 . The random single-stranded DNA library provided in Example 2 was used, and the nucleic acid aptamer screening method was as shown in Example 1. The number of rounds of reverse screening cycle screening was 8, and the number of rounds of positive screening cycle screening was also 8. After the sixth round of positive screening, a sodium chloride (NaCl) solution of less than 0.15M was added, and after the eighth round of positive screening, NaOH solution was used for elution. The eluate was collected in a liquid storage tank and sequenced by a magnetic enrichment device. Finally, a total of 60 nucleic acid aptamers that can bind to PHA-E protein were screened, named Seq1-60.

[0171] Example 6: Detection of nucleic acid aptamers specific to PHA-E protein by surface plasmon resonance imaging (SPRi)

[0172] For the 60 nucleic acid aptamers that can specifically bind to the PHA-E protein obtained by screening in Example 5, the 5' of each nucleic acid aptamer was modified with a thiol group, and the affinity of each nucleic acid aptamer to the PHA-E protein was detected by surface plasmon resonance imaging (SPRi). The specific method includes the following steps:

[0173] Before the experiment, the gold chip was immersed in 1 mL of fresh piranha solution (a mixture of concentrated sulfuric acid and 30% hydrogen peroxide solution, with a volume ratio of 7:3) for cleaning for 8 h, and then the chip surface was repeatedly rinsed with ethanol and deionized water.

[0174] HK2PO4 (1M, pH 9.25) was used to prepare a 20μM aptamer solution, with three spots for each aptamer, and a total of 30 spots for ten sequences. The gold chip (a combination of a prism and a gold chip, used to verify the affinity of the aptamer) was placed in a closed environment (humid box) with a room temperature and humidity of 80% for 24 hours to complete the fixation of the aptamer, and then washed with deionized water and dried.

[0175] The functionalized gold surface was immersed in 150 μM PEG2000 solution at room temperature for 90 minutes to effectively block nonspecific interactions on the surface. After immersion, the gold chip was washed again with deionized water and dried to ensure uniform coverage of PEG (polyethylene glycol).

[0176] The prism was cleaned with anhydrous ethanol to ensure that no contaminants remained, and then cleaned again with deionized water and wiped clean for subsequent experiments.

[0177] When attaching the prism and gold chip, use refractive index oil, with a recommended amount of 0.2-0.3 μL, to ensure good contact between the two to optimize signal transmission and detection.

[0178] The instrument was turned on and deionized water was added for cleaning, and the system was run at high speed for 40 minutes to ensure the cleanliness of the system. Then running buffer (HEPES 10 mM, MgCl2 5 mM, NaCl 150 mM, pH = 7.4) was added and the running buffer was run at low speed (20 μL / min) for 40 minutes to stabilize the system.

[0179] Ensure that the instrument is in normal status and prepare for testing. Create a work file, set up a work file for each experiment, and record relevant parameters. Click Plasmon to start surface plasmon resonance detection. Prepare a 1μM concentration of PHA-E protein candidate nucleic acid aptamer solution. Since we sample 30 points in one experiment and detect a total of 60 sequences, we need to detect twice. Manually define the properties of each sample point and name them. The 30 sequences detected for the first time are Seq1-30, and the 30 sequences detected for the second time are Seq31-60. Add glycerol solution for resonance angle calibration to ensure detection sensitivity. Add running buffer to rinse residual glycerol to keep the system clean. Switch mode, run buffer, and set the appropriate flow rate.

[0180] After completing the above preparations, the samples were tested by injecting PHA-E protein solutions with concentrations of 200nM, 100nM, 80nM, 50nM, 25nM, and 12.5nM in sequence, with the flow rate set to 50μL / min for 10 minutes or 20μL / min for 20 minutes. The chip can continue to be used after testing each concentration of protein solution, and the protein-aptamer complex can be dissociated by adding 50mM sodium hydroxide solution to regenerate the chip surface. Finally, after all batches of protein solutions are tested, running buffer is added to rinse the residual sodium hydroxide solution to restore the system state. The affinity test results of 60 nucleic acid aptamers and PHA-E protein are shown in the figure. Figures 5 to 10 shown.

[0181] After preliminary screening of the above sequences, sequences with weaker affinity were removed (the larger the KD value, the weaker the affinity), and the sequences with high affinity to PHA-E protein after screening were listed as shown in Table 4.

[0182] Table 4. Affinity of selected nucleic acid aptamers to PHA-E protein

[0183]

[0184]

[0185] However, in order to ensure that these sequences do not have a high affinity for other lectin proteins (PHA-L, Con A, LCA, SBA, BSA), this example performed another round of screening on the sequences in Table 4 by surface plasmon resonance imaging (SPRi) detection: candidate nucleic acid aptamers (Seq1, Seq2, Seq5, Seq9, Seq18, Seq19, Seq22, Seq23, Seq 27, Seq 35, Seq 40, Seq 43, Seq 49, Seq 55, Seq 58, Seq 60) were prepared at a concentration of 1 μM, three parallel points for each nucleic acid aptamer, and the experimental instrument operation procedure was the same as the screening step in the above-mentioned example.

[0186] The sequence signals of nucleic acid aptamers (Seq1, Seq2, Seq5, Seq9, Seq18, Seq19, Seq22, Seq 23, Seq 27, Seq 35, Seq 40, Seq 43, Seq 49, Seq 55, Seq 58, Seq 60) that are specific to PHA-E are shown in Fig.11 As shown, nucleic acid aptamers with better specificity were screened out and shown in Table 5.

[0187] Table 5. Analysis of specific screening results of nucleic acid aptamers and PHA-E protein

[0188] sequence Filter results Seq9 The response value of PHA-E protein is high, and the response values ​​of other protein signals are very weak Seq19 The response value of PHA-E protein is relatively high, while the response values ​​of other protein signals are very weak. Seq23 The response value of PHA-E protein is relatively high, and the response values ​​of other protein signals are within the normal impurity interference level Seq 43 The response value of PHA-E protein is high, and the response values ​​of other protein signals are very weak Seq 49 The response value of PHA-E protein is high, and the response values ​​of other protein signals are very weak

[0189] In this way, five nucleic acid aptamer sequences (Seq9, Seq19, Seq23, Seq43, and Seq49) were obtained, which have high affinity for PHA-E protein and low response values ​​to common impurities.

[0190] Among them, the two most preferred nucleic acid aptamers are Seq9 (SEQ ID NO.4) and Seq19 (SEQ ID NO.6), which have higher affinity and better specificity for binding to PHA-E protein.

[0191] Example 7: Surface plasmon resonance imaging (SPRi) detection of nucleic acid aptamers suitable for measuring the total amount of PHA protein

[0192] Among the specific sequences that can bind to PHA-E protein with high affinity screened in Table 4 of Example 6, it was found that most of them can only bind to PHA-E but not to PHA-L. However, there are 5 sequences that not only have a high response to PHA-E protein, but also show a high response value to PHA-L protein. Therefore, the signal response of these 5 sequences was screened out separately for analysis in this example. The specific detection diagram of these 5 sequences is shown in FIG. Fig.12 and Table 6.

[0193] Table 6. Screening results of nucleic acid aptamers with high affinity to PHA-E and PHA-L proteins

[0194]

[0195]

[0196] Thus, we obtained five sequences (Seq5, Seq22, Seq27, Seq55, and Seq58) that have high affinity for PHA-E and PHA-L proteins and low response values ​​to common impurities, and are suitable for measuring the total amount of PHA.

[0197] Among them, the two most preferred nucleic acid aptamers are Seq5 (SEQ ID NO.3) and Seq58 (SEQ ID NO.15), which have higher affinity and better specificity for binding to PHA proteins (including PHA-E and PHA-L proteins).

[0198] Example 8: Screening of nucleic acid aptamers suitable for detecting free PHA protein or PHA-E protein

[0199] The PHA protein aptamer sensor was prepared using graphene oxide (GO) and aptamers that bind to PHA proteins. The detection method based on high-affinity anti-PHA aptamers and graphene oxide was used. Due to its three-dimensional folding, the aptamer can recognize and bind to specific targets ranging from small molecules to whole cells. This method can be used to screen out aptamers suitable for free PHA protein detection.

[0200] Table 7. Suitable for detecting different types of nucleic acid aptamer sequences

[0201] Detection of PHA-E protein Detection of total PHA protein Seq9 (SEQ ID NO.4) Seq5 (SEQ ID NO.3) Seq19 (SEQ ID NO.6) Seq22 (SEQ ID NO.7) Seq23 (SEQ ID NO.8) Seq27 (SEQ ID NO.9) Seq 43 (SEQ ID NO.12) Seq 55 (SEQ ID NO.14) Seq 49 (SEQ ID NO.13) Seq 58 (SEQ ID NO.15)

[0202] The method for screening nucleic acid aptamers for detecting free proteins in this embodiment comprises the following steps:

[0203] (1) The above sequence is labeled with FAM, and the final effect is 5'-(6-FAM) (the fluorescent group is connected to the 6th carbon atom of the molecule), which can specifically recognize and bind to the PHA protein as a sensing element. If there is no PHA protein, the labeled nucleic acid aptamer will be adsorbed to the GO surface due to the π-π stacking of DNA bases and GO (graphene oxide), and the fluorescence will be quenched (that is, only the free state can be detected). If there is PHA protein, the labeled protein can bind to the PHA protein to form a complex, so that the nucleic acid aptamer is away from the GO surface and the fluorescence is restored.

[0204] (2) Fluorescence intensity and DNA formation are strongly affected by the pH value of the buffer. Moreover, high pH values ​​can cause PHA protein denaturation. Therefore, Tris-HCl buffer solutions with different pH values ​​were used to evaluate the effect of pH value. Fig.13 As shown, the fluorescence signal increases continuously from pH 5.2 to 7.2, and then decreases when the pH value exceeds 7.2. In order to ensure that the sensing system has high sensitivity, a Tris-HCl buffer solution with a pH of 7.2 was selected to measure the PHA protein.

[0205] (3) The above sequences were divided into two experimental groups. The first group used the PHA-E protein aptamer sequences screened out above, and the second group used the aptamer sequences for measuring the total amount of PHA protein screened out above. The surface of graphene oxide has abundant oxygen functional groups (such as carboxyl, hydroxyl, etc.), which can be non-covalently or covalently bound to the amino groups or other functional groups in the aptamer sequence, and further adsorb the aptamer onto the graphene oxide network. Prepare 200nM PHA-E protein and 200nM PHA protein at a concentration of 200nM, and add them to the graphene oxide network that has been incubated with PHA-E protein aptamers (each aptamer concentration is 10uM) or aptamers for the total amount of PHA protein (each aptamer concentration is 10uM), and use a fluorescence spectrometer to measure the fluorescence intensity at a wavelength of 520nm. For details on the specific fluorescence intensity, see Fig.14 and Fig.15 .

[0206] pass Fig.14 , Fig.15 It can be clearly seen that Seq5, Seq9, Seq22, Seq23, and Seq27 have higher fluorescence intensity values, while the fluorescence intensity of other sequences is poor. Thus, nucleic acid aptamers suitable for free detection were screened as shown in Table 8.

[0207] Table 8. Aptamer sequences suitable for free detection

[0208]

[0209]

[0210] As shown in Table 8, this example screened out five nucleic acid aptamer sequences (Seq5, Seq9, Seq22, Seq23, Seq27) suitable for free detection, among which Seq9 and Seq23 were suitable for free detection of PHA-E protein, and Seq5, Seq22, and Seq27 were suitable for free detection of total amount of PHA-E protein.

[0211] Example 9: Verification of the effect of free detection of PHA protein or PHA-E protein nucleic acid aptamer

[0212] This example uses the method provided in Example 8 to detect free PHA protein or PHA-E protein, and examines the quantitative lower limit and linear range of different nucleic acid aptamers when used for the detection of PHA protein or PHA-E protein.

[0213] Prepared concentrations of 1, 50, 100, 150, 200, 250, 300, 350nM PHA-E protein standard solution and 1, 50, 100, 150, 200, 250, 300, 350nM PHA protein standard solution, added to the graphene oxide network incubated with the nucleic acid aptamer of PHA-E protein (one of Seq9 and Seq23, the nucleic acid aptamer concentration is 10uM) or the nucleic acid aptamer of the total amount of PHA protein (one of Seq5, Seq22 and Seq27, the nucleic acid aptamer concentration is 10uM), and measured the fluorescence intensity at a wavelength of 520nm using a fluorescence spectrometer to establish a standard curve. It was found that the linear correlation coefficient of the standard curve can reach more than 0.99, and the linear range is good. According to the standard curve, the detection limit of the nucleic acid aptamer for detecting PHA-E protein or PHA protein was calculated, and the results are shown in Table 9.

[0214] Table 9. Lower limit of quantification of free detection

[0215]

[0216] It can be seen from Table 9 that when different nucleic acid aptamers are used for free detection of PHA protein or PHA-E protein, their lower limits of quantification are significantly different. The lower the lower limit of quantification, the higher the detection sensitivity.

[0217] For free detection of PHA-E protein, the aptamer Seq9 has the lowest limit of quantification and the highest detection sensitivity. For free detection of PHA protein, Seq5 and Seq22 are significantly better than Seq27, and the limits of quantification of Seq5 and Seq22 are relatively close, so Seq22 is the most preferred.

[0218] Example 10: Screening of nucleic acid aptamers suitable for immobilization and detection of PHA protein or PHA-E protein using electrochemical method

[0219] In this embodiment, the electrode (SPE, screen-printed electrode) is immersed in 75% ethanol, and then the organic contaminants on the electrode surface are removed by ultrasound, and then rinsed with water and air-dried. The 5′ thiol-modified nucleic acid aptamer is dissolved in TE buffer to obtain a 100 μM nucleic acid aptamer solution. The nucleic acid aptamer sequence is modified with ferrocene (Fc) labeling at 3′, and the disulfide bonds in the thiol-modified oligonucleotide are reduced to single thiol groups by mixing with 10mM TCEP solution and storing in a dark environment for 1.5h, and then the nucleic acid aptamer solution is adjusted to 10 μM as a grafting solution. The entire surface of the working electrode is immersed in the grafting solution in the dark for 3 hours, then rinsed with ultrapure water, and then the working electrode is completely covered with PEG 2000 solution for 1.5h to block the active sites on the surface.

[0220] The PHA protein aptamer sensor was prepared using graphene oxide (GO) and aptamers that bind to PHA proteins. The detection method based on high-affinity anti-PHA aptamers and graphene oxide was used. Due to its three-dimensional folding, the aptamer can recognize and bind to specific targets ranging from small molecules to whole cells. This method can be used to screen out aptamers suitable for free PHA protein detection.

[0221] After installing the SPE on the electrochemical workstation adapter, 50 μL of the test solution (10 mM NaCl, 10 mM MgCl2, 5 mM K3[Fe(CN)6]) in TE buffer at the desired PHA protein concentration (100 ng / mL) or PHA-E protein solution (100 ng / mL) was incubated on the electrode surface at room temperature for 15 min. After incubation, electrochemical measurements were performed according to the following parameters, cyclic voltammetry (CV): the scan rate was 0.05 Vs-1 in the potential range of -1 to 1 V, and in order to reduce the error caused by electrode wear, the results were obtained at the first use of the SPE.

[0222] Due to the inhibitory effect of nucleic acid aptamer PHA complexes on electron transfer, the current corresponding to the peak value decreases with the increase of PHA protein or PHA-E protein concentration, while the signal increases. This can be used to determine the sequence suitable for fixed detection of nucleic acid aptamers. We selected the sequences in Table 7 as our screening sequences, and obtained Fig.16 , 17 ,pass Fig.16 , 17 Signal analysis revealed five nucleic acid aptamers, Seq19, Seq43, Seq49, Seq55, and Seq58.

[0223] Table 10. Aptamer sequences suitable for fixed detection

[0224]

[0225] After screening, five sequences (Seq19, Seq43, Seq49, Seq55, Seq58) as shown in Table 10 were obtained as nucleic acid aptamers suitable for free detection, among which Seq19, Seq43, and Seq49 were suitable for fixed detection of PHA-E protein, and Seq55 and Seq58 were suitable for fixed detection of total PHA protein.

[0226] Example 11: Verification of the effect of immobilizing and detecting PHA protein or PHA-E protein aptamers

[0227] This example uses the method provided in Example 10 to perform electrochemical immobilization detection of PHA protein or PHA-E protein, and examines the quantitative lower limit and linear range of different nucleic acid aptamers when used for the detection of PHA protein or PHA-E protein.

[0228] The modified Seq19, Seq43, Seq49, Seq55, and Se58 aptamer solutions were used as grafting solutions to prepare SPE electrodes. The concentrations of 1, 50, 100, 150, 200, 250, 300, and 350 nM PHA-E protein standard solutions and 1, 50, 100, 150, 200, 250, 300, and 350 nM PHA protein standard solutions were prepared, respectively. After installing the SPE on the electrochemical workstation adapter, 50 μL of the test solution (10 mM NaCl, 10 mM MgCl2, 5 mM K3[Fe(CN)6]) in TE buffer was incubated on the electrode surface at room temperature for 15 min at the desired PHA protein concentration (100 ng / mL) or PHA-E protein solution (100 ng / mL). After incubation, electrochemical measurements were performed, cyclic voltammetry (CV): the scan rate was 0.05 Vs-1 in the potential range of -1 to 1 V, and a standard curve was established. It was found that the linear correlation coefficient of the standard curve could reach above 0.99, and the linear range was good. According to the standard curve, the detection limit of the nucleic acid aptamer for detecting PHA-E protein or PHA protein was calculated, and the results are shown in Table 11.

[0229] Table 11. Lower limit of quantitation for free detection

[0230]

[0231] It can be seen from Table 11 that when different nucleic acid aptamers are used to immobilize and detect PHA protein or PHA-E protein, their lower limits of quantification are significantly different. The lower the lower limit of quantification, the higher the detection sensitivity.

[0232] For the fixed detection of PHA-E protein, the aptamer Seq19 has the lowest limit of quantification and the highest detection sensitivity. For the fixed detection of PHA protein, Seq58 is significantly better than Seq49 and Seq55, so Seq58 is preferred, which has the highest detection sensitivity.

[0233] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical scheme and inventive concept of the present invention within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.

[0234] Sequence Listing

[0235] SEQ ID NO.1

[0236] Seq1

[0237] TACCCGCGCAGTAGTTGTGTTCGACAGCGATTTCAT

[0238] SEQ ID NO.2

[0239] Seq2

[0240] AAATGCGCAGCCGTTGTGTTCGACAGCATTCCAATA

[0241] SEQ ID NO.3

[0242] Seq5

[0243] TCACGTGGCCTCCGATCTTGCATAATGCGCTCGCGG

[0244] SEQ ID NO.4

[0245] Seq9

[0246] GCCAATCAGTCCCGCAGTAGTTGTGTTCGACAGGGC

[0247] SEQ ID NO.5

[0248] Seq18

[0249] CCCATAATGCGATAGCCTCTATCCTCCGATGGTTGA

[0250] SEQ ID NO.6

[0251] Seq19

[0252] GACGCACTCGTTAGTAGCTGTGACCGACCCGGTGTT

[0253] SEQ ID NO.7

[0254] Seq2

[0255] GATAATGCGAATCGCGACCGTGGTTCCTCCGATCTT

[0256] SEQ ID NO.8

[0257] Seq2

[0258] TGATCGGCATAATGCGGTCTTGCCCTCCGATGCACT

[0259] SEQ ID NO.9

[0260] Seq2

[0261] CCATACCTGCTGCAGTGCTGTGTTCGACAAGCCTAT

[0262] SEQ ID NO

[0263] Seq3

[0264] GCAACCACAGCGCAGTCATGTGTTCGACAGCTTGGG

[0265] SEQ ID NO.11

[0266] Seq4

[0267] AACGAGTGCGCGCAGTTCCGTGTCCGACAGTGTCTA

[0268] SEQ ID NO.12

[0269] Seq4

[0270] ATACTCTTAGTGCAGAGAGGCTGTTTGCTCGTCCCA

[0271] SEQ ID NO.13

[0272] Seq4

[0273] TTCCGCCCTCCGATCTTCGATAATGCGGCAGAGAAC

[0274] SEQ ID NO.14

[0275] Seq55

[0276] TGGATAATGCGCTGACACTGTCGCCTCCGATCCCAG

[0277] SEQ ID NO.15

[0278] Seq58

[0279] TTACGGGACCGCAGTGCCGTGTTCGACAGGTCAATA

[0280] SEQ ID NO.16

[0281] Seq60

[0282] CTCCTCCGATGTGGCCCTCAGAACCGCATAATGCGA 。

Claims

1. A nucleic acid aptamer that binds to PHA, characterized in that: The PHA has a nucleotide sequence as shown in any one of SEQ ID NO.3, SEQ ID NO.7, SEQ ID NO.9, SEQ ID NO.14 and SEQ ID NO.15 in the sequence listing, and the PHA includes PHA-E and PHA-L.

2. The nucleic acid aptamer according to claim 1, characterized in that It has a nucleotide sequence as shown in any one of SEQ ID NO.3 and SEQ ID NO.15 in the sequence listing.

3. A nucleic acid aptamer for free detection of PHA protein, characterized in that: The PHA has a nucleotide sequence as shown in any one of SEQ ID NO.3, SEQ ID NO.7 and SEQ ID NO.9 in the sequence listing, and the PHA includes PHA-E and PHA-L.

4. A nucleic acid aptamer for fixing and detecting PHA protein, characterized in that: The PHA has a nucleotide sequence as shown in any one of SEQ ID NO.14 and SEQ ID NO.15 in the sequence listing, and the PHA includes PHA-E and PHA-L.

5. A nucleic acid aptamer that binds to PHA-E, characterized in that: It has a nucleotide sequence as shown in any one of SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8, SEQ ID NO.12, and SEQ ID NO.13 in the sequence listing.

6. The nucleic acid aptamer according to claim 5, characterized in that It has a nucleotide sequence as shown in any one of SEQ ID NO.4 and SEQ ID NO.6 in the sequence listing.

7. A nucleic acid aptamer for free detection of PHA-E protein, characterized in that: It has a nucleotide sequence as shown in any one of SEQ ID NO.4 and SEQ ID NO.8 in the sequence listing.

8. A nucleic acid aptamer for fixing and detecting PHA-E protein, characterized in that: The PHA has a nucleotide sequence as shown in any one of SEQ ID NO.6, SEQ ID NO.12 and SEQ ID NO.13 in the sequence listing, and the PHA includes PHA-E and PHA-L.

9. A method for detecting PHA protein, characterized in that: The detection is performed using the nucleic acid aptamer as described in any one of claims 1 to 4.

10. A method for detecting PHA-E protein, characterized in that: The detection is performed using the nucleic acid aptamer as described in any one of claims 5 to 8.

Images