A specific PCR method for detecting cistanche tubulosa

By designing a PCR amplification method using specific primer pairs Ct9F and Ct11R combined with electrophoretic detection, the problem of the inability to identify Cistanche tubulosa in complex samples in existing technologies has been solved, enabling accurate identification of Cistanche tubulosa and providing an effective means of quality supervision.

CN119955972BActive Publication Date: 2025-11-21SHENYANG PHARMA UNIV
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202510131707.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-06
Publication Date
2025-11-21
Estimated Expiration
2045-02-06

AI Technical Summary

Technical Problem

Existing physicochemical and DNA molecular identification methods cannot effectively distinguish whether complex samples contain Cistanche tubulosa, especially in common foods containing other medicinal and edible herbs, where existing methods have detection deficiencies.

Method used

Specific primer pairs Ct9F and Ct11R were designed for PCR amplification and combined with agarose gel electrophoresis detection to achieve specific identification of Cistanche tubulosa. The presence of Cistanche tubulosa in the sample was determined by the 590bp characteristic band.

Benefits of technology

It can accurately identify Cistanche tubulosa in complex samples without interference from other raw materials, providing an effective means of quality supervision.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119955972B_ABST
    Figure CN119955972B_ABST
Patent Text Reader

Abstract

The application discloses a specific PCR method for detecting Cistanche tubulosa, and belongs to the technical field of detection and inspection. The application refers to the chloroplast genomes of Cistanche deserticola and Cistanche tubulosa, and specific primer pairs for identifying Cistanche tubulosa are obtained through sequence alignment design. Genomic DNA in a to-be-detected sample is extracted, PCR amplification reaction is carried out on the extracted genomic DNA template by using the specific primer pairs, and finally, 1% agarose gel electrophoresis is used to detect the obtained PCR amplification, and whether Cistanche tubulosa is contained is judged according to whether a band is present. The amplification results of ten representative ordinary foods containing Cistanche deserticola on the market are investigated. The specific primer pairs of the application can realize the identification of Cistanche tubulosa from four kinds of Cistanche deserticola, and are not affected by other raw materials in the ten ordinary foods not investigated, and can realize the detection of Cistanche tubulosa in ordinary foods containing Cistanche deserticola, thereby providing an effective means for the quality supervision of ordinary foods containing Cistanche deserticola raw materials.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of detection and testing technology, and relates to a method for detecting whether a sample contains Cistanche tubulosa using specific PCR technology. Specifically, it relates to a method for detecting whether a sample contains Cistanche tubulosa by combining PCR amplification and electrophoresis techniques. Background Technology

[0002] Cistanche deserticola is a traditional Chinese tonic herb. The current pharmacopoeia lists two original plants: Cistanche deserticola YCMa (hereinafter referred to as Cistanche deserticola (desert) for distinction) and Cistanche tubulosa (C. tubulosa (Schenk) Wight). In November 2023, Cistanche deserticola (desert) was included in the list of substances that are both food and traditional Chinese medicine, but the other original plant, Cistanche tubulosa, was not listed. Currently, a large number of common foods containing Cistanche deserticola (desert) have been developed and marketed. However, due to the disappearance of the medicinal form and the similarity in powder and physicochemical characteristics between the two original plants, the current pharmacopoeia's detection methods cannot verify whether Cistanche tubulosa has been added to common foods, creating a regulatory gap for products containing Cistanche deserticola (desert).

[0003] Chinese invention patent application number 200810009143.3 discloses the application of allantoin in the identification of Cistanche deserticola species and its novel use in lowering blood lipids. Compared with other Cistanche deserticola species, Cistanche tubulosa does not contain allantoin. Research by Zhao Jinjin et al. (Zhao Jinjin. Study on host evaluation of Cistanche deserticola and germplasm screening of Cistanche tubulosa [D]. Hebei Agricultural University, 2023. DOI:10.27109 / d.cnki.ghbnu.2023.000224.) shows that betaine was not detected in Cistanche tubulosa. However, the above two indicators are not suitable for distinguishing whether ordinary foods contain Cistanche tubulosa, because Cistanche tubulosa does not contain allantoin and betaine, and other common medicinal and edible herbs such as Lycium barbarum contain betaine (Hu Ying, Xu Xin, Zhang Chunyang, et al. Determination and comparative analysis of polysaccharide and betaine content in Lycium barbarum from different varieties [J]. Modern Chinese Materia Medica, 2022, 24(12):2383-2390.DOI:10.13313 / j.issn.1673-489 0.20220623008.), yam contains allantoin (Lv Hang, Zhang Quanli, Sun Xiangming. Study on determination of allantoin content in yam from different origins [J]. Journal of Harbin University of Commerce (Natural Science Edition), 2020, 36(01):13-16.DOI:10.19492 / j.cnki.1672-0946.2020.01.003.), these special cases undoubtedly make the conclusion that Cistanche tubulosa has been added to ordinary food lack credibility by using the above components. Therefore, the above two chemical indicators do not have the ability to identify whether Cistanche tubulosa is present in complex samples.

[0004] DNA molecular identification of Cistanche deserticola mainly falls into two categories: DNA barcoding technology and PCR amplification-based identification technology. DNA barcoding technology relies on first-generation sequencing, utilizing the species-specificity of the determined sequences for BLASTN analysis or secondary structural characteristics to determine species classification (Sun Zhiying, Han Jianping, Chen Shilin. DNA Barcoding Identification of Cistanche deserticola and its Adulterants Based on ITS2 Sequence [C] / / Medicinal Plants and Herbal Drugs Committee of the Botanical Society of China, Kunming Institute of Botany, Chinese Academy of Sciences, Proceedings of the 10th National Symposium on Medicinal Plants and Herbal Drugs, Institute of Medicinal Plants, Peking Union Medical College, Chinese Academy of Medical Sciences; School of Pharmacy, Shandong University of Traditional Chinese Medicine; 2011:1.). Alternatively, species attribution can be determined by single nucleotide polymorphisms (SNPs) at specific positions in sequencing results (Chinese invention patent application number 202410967992.9). This method is suitable for single-source medicinal material samples, such as processed medicinal slices, or samples containing plants of the same genus. However, it is not suitable for the detection of complex food samples containing plants from other families and genera. This is because during the amplification process, the ITS sequences of other species are also amplified simultaneously, resulting in a non-singular amplification product. The mixture of amplification products cannot be directly analyzed by first-generation sequencing technology, resulting in severe peak overlap and the inability to read effective sequences. Therefore, molecular identification methods based on DNA barcoding technology are not suitable for the detection of the original species of Cistanche deserticola in complex food samples.

[0005] Identification techniques based on PCR amplification include specific PCR and PCR-RFLP. Chinese invention patent application number 200410066785.9 discloses the identification primer sequences and identification methods for the traditional Chinese medicine Cistanche deserticola using polymerase chain reaction. It compares the sequence differences between Cistanche deserticola (desert) and three other Cistanche species (Cistanche tubulosa, Cistanche sandica, and Cistanche halophyte) and selects a pair of specific identification primers. The identification primers in this patent can identify whether there is Cistanche deserticola (desert), but cannot determine whether there are other species of Cistanche deserticola in complex samples. Chinese invention patent application number 202411065088.5 discloses a method for identifying the original plant of Cistanche deserticola using PCR-RFLP. However, this method only considers the specific restriction enzyme sites in the amplified sequences of Cistanche deserticola (desert) and Cistanche tubulosa. It uses a single restriction endonuclease to digest the PCR amplification product and determines whether Cistanche tubulosa is present based on whether the PCR amplification product can be cut into two strips. However, because it does not consider whether other species have the same restriction enzyme sites, it cannot meet the requirements for identifying the original species of Cistanche deserticola in complex samples. Therefore, the rigor of the above two types of DNA molecular identification methods in identifying whether Cistanche tubulosa is present in complex common food samples containing other medicinal and edible ingredients is not considered, and there are certain design flaws.

[0006] In summary, the physicochemical and DNA molecular identification methods reported so far for distinguishing between Cistanche deserticola (desert) and Cistanche tubulosa have limited applicability. They cannot meet the requirements for detecting the original species of Cistanche deserticola in highly complex samples, nor can they determine whether Cistanche tubulosa has been added to the sample. Summary of the Invention

[0007] Based on the above analysis, the purpose of this invention is to provide a specific PCR method for detecting Cistanche tubulosa. This invention can detect Cistanche tubulosa in complex samples and can be used to identify whether Cistanche tubulosa has been added to ordinary food or raw materials containing Cistanche tubulosa (desert) raw materials.

[0008] The objective of this invention is achieved through the following means:

[0009] In a first aspect, the present invention provides a molecular marker for identifying Cistanche tubulosa, the nucleotide sequence of which is shown in SEQ ID NO.3.

[0010] Secondly, the present invention provides a specific primer pair for amplifying the above-mentioned molecular marker, wherein the nucleotide sequence of the specific primer pair is as follows:

[0011] Ct9F: 5'-CACTATCGGACAAACCACCGGA-3' (SEQ ID NO.1),

[0012] Ct11R: 5'-AAGGGGTCCGATGGGTATCT-3' (SEQ ID NO. 2).

[0013] Thirdly, the present invention provides a PCR kit for identifying Cistanche tubulosa, comprising the above-mentioned specific primer pair.

[0014] Based on the above technical solution, the PCR kit further includes DNA polymerase, dNTPs, reaction buffer, and deionized water.

[0015] Fourthly, the present invention provides a specific PCR method for detecting Cistanche tubulosa in a sample, comprising the following steps:

[0016] (1) Extract genomic DNA from the sample to be tested;

[0017] (2) Use the above-mentioned specific primer pairs to perform PCR amplification on the genomic DNA template extracted in step (1);

[0018] (3) The PCR amplification obtained in step (2) was detected by 1% agarose gel electrophoresis. The presence or absence of bands was used to determine whether Cistanche tubulosa was present.

[0019] Based on the above technical solution, the method for extracting genomic DNA in step (1) further includes the CTAB method.

[0020] Based on the above technical solution, further, the PCR amplification reaction system in step (2) is 20 μL, containing 1-2 μL each of forward and reverse primers, 5-10 μL of reaction buffer, 0.4-200 ng of template, and the remainder is deionized water.

[0021] Based on the above technical solution, further, in step (2), the template concentration is 0.02 to 10 ng / μl, and the concentrations of both forward and reverse primers are 0.1 to 5 μM.

[0022] Based on the above technical solution, further, the PCR amplification program in step (2) is as follows: pre-denaturation at 93-95℃ for 4.5-5.5 min, denaturation at 93-95℃ for 25-35 s, annealing at 55-60℃ for 25-35 s, extension at 71-73℃ for 40-50 s, 30-45 cycles, extension at 71-73℃ for 9-11 min, cooling to 4℃ and holding for more than 10 min.

[0023] Based on the above technical solution, further, the nucleic acid dyes used in the agarose gel electrophoresis in step (3) include EtBr and Goldview fluorescent dye. The electrophoresis conditions are: 100-150V, 20min. The agarose gel is photographed in an ultraviolet transilluminator or gel imaging system.

[0024] Based on the above technical solution, further, in step (3), when a 590bp characteristic band appears in the amplification product, the sample to be tested contains Cistanche tubulosa; when no 590bp characteristic band appears in the amplification product, the sample to be tested does not contain Cistanche tubulosa.

[0025] The advantages of this invention over the prior art are as follows:

[0026] This invention can obtain a specific amplification product of approximately 590 bp of Cistanche tubulosa via specific PCR amplification. The amplification results of ten representative commercial foods containing Cistanche tubulosa were investigated. The results showed that the specific primer pair Ct9F and Ct11R in this invention can identify Cistanche tubulosa from four types of Cistanche tubulosa without being affected by other raw materials in the ten commercial foods investigated. This invention can detect Cistanche tubulosa in commercial foods containing Cistanche tubulosa, providing an effective means for the quality supervision of commercial foods containing Cistanche tubulosa. Attached Figure Description

[0027] To more clearly illustrate the embodiments of the present invention, the accompanying drawings involved in the embodiments will be briefly described below.

[0028] Figure 1 The images show the morphology of four types of Cistanche deserticola medicinal materials, including: A: Cistanche tubulosa; B: Cistanche deserticola; C: Cistanche sandy lobe; and D: Cistanche saline-alkali folia.

[0029] Figure 2 The results of agarose gel electrophoresis of four Cistanche deserticola species amplified using Ct9F and Ct11R primers are shown. Among them, H: desert Cistanche deserticola, G: tubular Cistanche deserticola, Y: halophyte Cistanche deserticola, and S: sand Cistanche deserticola.

[0030] Figure 3 The agarose gel electrophoresis results of the amplification products of four kinds of Cistanche deserticola under different annealing temperatures using primer combinations of Ct9F and Ct11R are shown. Among them, H: desert Cistanche deserticola, G: tubular Cistanche deserticola, Y: halophyte Cistanche deserticola, and S: sand Cistanche deserticola.

[0031] Figure 4 The agarose gel electrophoresis results of the amplification products of four kinds of Cistanche deserticola under different cycle numbers using Ct9F and Ct11R primer combinations are shown. Among them, H: desert Cistanche deserticola, G: tubular Cistanche deserticola, Y: halophyte Cistanche deserticola, and S: sand Cistanche deserticola.

[0032] Figure 5 The amplification effect of using different concentrations of genomic DNA as templates from Cistanche tubulosa was studied.

[0033] Figure 6 The results show the amplification of genomic DNA from common foods containing Cistanche deserticola using the Ct9F and Ct11R primer pairs.

[0034] Figure 7 The results of amplification of genomic DNA from common food containing Cistanche tubulosa genomic DNA using Ct9F and Ct11R primer pairs. Detailed Implementation

[0035] The present invention will be described in detail below with reference to the embodiments. However, the implementation of the present invention is not limited thereto. Obviously, the embodiments described below are only some embodiments of the present invention. For those skilled in the art, other similar embodiments can be obtained without creative effort and all fall within the protection scope of the present invention.

[0036] Example 1

[0037] The dried products of Cistanche deserticola, Cistanche tubulosa, Cistanche sandy lobe, and Cistanche halophila were extracted using the CTAB method. Figure 1The genomic DNA of *Cistanche deserticola* and *Cistanche tubulosa* was used as a template for PCR amplification using Ct9F and Ct11R primers (primers were designed by sequence alignment based on the chloroplast genomes of *Cistanche deserticola* and *Cistanche tubulosa*, Ct9F: 5'-CACTATCGGACAAACCACCGGA-3', Ct11R: 5'-AAGGGGTCCGATGGGTATCT-3'). The amplification system and conditions are shown in Table 1-2.

[0038] Table 1 PCR amplification reaction system

[0039]

[0040] Table 2 PCR amplification reaction conditions

[0041]

[0042] Take 5 μl of the obtained PCR product and perform 1% agarose gel electrophoresis. The nucleic acid dye is EtBr. The electrophoresis conditions are: 120V, 20min. Observe and photograph the agarose gel using a UV transilluminator or gel imaging system.

[0043] The experimental results are shown in Figure 2 The results showed that only *Cistanche tubulosa* yielded a specific amplification product band of 590 bp. The nucleotide sequence of the product obtained by amplifying *Cistanche tubulosa* using Ct9F-Ct11R as the specific primer pair is as follows:

[0044] CACTATCGGACAAACCACCGGATACTTGGCCCAATATTAGTTGGATCACTTA

[0045] GCCACGTTTCATAATTTGAAAAAAAAAAACGAGTATCGTGAAAATAAATGCCAC

[0046] TCAGCCAACGAAATATGATGGAGAGTTGACCAAAATGGACACTAAATATTTTTT

[0047] GAGAGATCTTCACTGATATAGCTATAGAAATCGTGAGCATCGGCATGTAGGTTC

[0048] CAGATCCAAGTGGTAGTAGTTGGATCCTTAGCTATTGTTCTTGAGAAATGACCT

[0049] GGTTTGGCCCATTCCTCGAAAGAAACTTTTACTTCCGGTTCAGGCGAACAAATAA

[0050] TCATTGAGTACTCCTCTTTCCGGACAACACATACAAACAAAGAGACCTGCCAAC

[0051] AGTCAAAATAATTAGTAAACCTTTGAGAAAGATTTATATAATTAGTTTATTGTTC

[0052] TTCTATTTTTCTATATTCCATTTATATATTTCTTTTAGTCCTTTACTATATTTTAC

[0053] TATAATTACTATAACAATTATGACTTGGAAGTTGATCTGGGATAAGTGTTTGGAT

[0054] TTATTATGACTATGACATAGTCATCAGATACCCATCGGACCCCTT (SEQ ID NO. 3).

[0055] Example 2

[0056] The experimental procedure in this embodiment is the same as that in Embodiment 1, except that the annealing temperatures are set to 55℃, 56℃, 57℃, 58℃, 59℃, and 60℃, respectively. The experimental results are shown below. Figure 3 Among the four types of Cistanche deserticola, only Cistanche tubulosa showed a band around 590bp, while the other Cistanche deserticolas did not show a band, indicating that the primers were specific.

[0057] Example 3

[0058] The experimental procedure in this embodiment is the same as that in Embodiment 1, except that the number of cycles is set to 30, 34, 38, and 42, respectively. The experimental results are shown below. Figure 4 The results showed that only Cistanche tubulosa could yield specific amplification products.

[0059] Example 4

[0060] The experimental procedure in this embodiment is the same as that in Example 1. The difference is that Cistanche tubulosa genomic DNA was used as a template to investigate the effect of different template concentrations on the amplification products (1× concentration was 10.0 ng / μl, 10× concentration was 1.0 ng / μl, 100× concentration was 0.1 ng / μl, 200× concentration was 0.05 ng / μl, 500× concentration was 0.02 ng / μl, 1000× concentration was 0.01 ng / μl, and 5000× concentration was 0.002 ng / μl).

[0061] The experimental results are shown in Figure 5 The results showed that Cistanche tubulosa could be detected in template concentration ranges of 0.02-10 ng / μl. In a 20 μl reaction system, the addition of 0.4 ng of template could effectively amplify the sample, thus enabling the identification of whether Cistanche tubulosa was present in the sample.

[0062] Example 5

[0063] Ten commercially available common food products containing Cistanche deserticola (ingredient list see Table 3) were tested. For liquid preparations (Cistanche deserticola concentrate, Cistanche deserticola extract, Huahong Alashan Cistanche deserticola essence drink, and Cistanche deserticola wine), appropriate samples were taken and subjected to nitrogen blowing to obtain product extracts, followed by DNA extraction. For Cistanche deserticola polyphenol tablets, which are compressed candies, the sugar coating was removed and the tablets were ground. For the remaining solid products, the products were ground into powder and then DNA was extracted.

[0064] Table 3. Names and ingredient information of ten commercially available common food products containing Cistanche deserticola.

[0065]

[0066] No specific bands of Cistanche tubulosa were detected in any of the ten common food products containing Cistanche deserticola mentioned above. Figure 6 However, specific bands were detected in the genomic DNA of representative common foods containing Cistanche tubulosa (serial numbers 1, 3, 4, 5, and 9, respectively). Figure 7 ).

[0067] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A specific PCR method for detecting Cistanche tubulosa in a sample, characterized in that, Includes the following steps: (1) Extract genomic DNA from the sample to be tested; (2) Use specific primer pairs to perform PCR amplification on the genomic DNA template extracted in step (1); (3) The PCR amplification products obtained in step (2) were detected by 1% agarose gel electrophoresis. The presence or absence of bands was used to determine whether Cistanche tubulosa was present. The nucleotide sequences of the specific primer pairs are shown in SEQ ID NO.1-2; In step (3), when a 590 bp characteristic band appears in the amplification product, the sample to be tested contains Cistanche tubulosa; when no 590 bp characteristic band appears in the amplification product, the sample to be tested does not contain Cistanche tubulosa.

2. The method according to claim 1, characterized in that, The methods for extracting genomic DNA in step (1) include the CTAB method.

3. The method according to claim 1, characterized in that, In step (2), the PCR amplification reaction system is 20 μL, containing 1~2 µl each of forward and reverse primers, 5~10 µl of reaction buffer, 0.4~200 ng of template, and the remainder is deionized water.

4. The method according to claim 3, characterized in that, In step (2), the template concentration is 0.02~10 ng / μl, and the concentrations of both forward and reverse primers are 0.1~5μM.

5. The method according to claim 1, characterized in that, The PCR amplification program in step (2) is as follows: pre-denaturation at 93~95℃ for 4.5~5.5 min, denaturation at 93~95℃ for 25~35 s, annealing at 55~60℃ for 25~35 s, extension at 71~73℃ for 40~50 s, 30~45 cycles, extension at 71~73℃ for 9~11 min, cooling to 4℃ and holding for more than 10 min.

6. The method according to claim 1, characterized in that, In step (3), the nucleic acid dyes used in agarose gel electrophoresis include EtBr and Goldview fluorescent dye. The electrophoresis conditions are: 100-150V, 20 min. The agarose gel is photographed using a UV transilluminator or gel imaging system.

Citation Information

Patent Citations

  • Application of allantoin in Cistanche plant variety identification and its novel use for decreasing blood fat

    CN101271089A

  • Primer composition, method and kit for identifying rare Cistanche deserticola and its counterfeits

    CN118497409B

  • Identification primer sequence of traditional Chinese medicinal broomrape polymerase chain reaction and identification method thereof

    CN1635148A

  • Primer composition, method and kit for identifying rare cistanche deserticola and adulterants thereof

    CN118497409A

  • PCR-RFLP identification method for cistanche decoction piece-based original plant

    CN118703601A