Micromolecular collagen peptide for promoting generation of seventeen-type collagen as well as production method and device of micromolecular collagen peptide

Abstract

The invention discloses a micromolecular collagen peptide for promoting generation of seventeen-type collagen and a production method and device thereof, and the production method comprises the following steps: pretreatment of livestock or fish skin: first water washing, soaking in a sodium chloride solution and soaking in a sodium hydroxide solution; washing for the second time, and adjusting the pH and the conductivity; performing enzymolysis on livestock and poultry or fish skin by using combined enzyme, and filtering enzymatic hydrolysate to obtain clear liquid; decoloring and filtering the clear liquid, exchanging water to obtain a solid matter, and filtering the solid matter to obtain a high-concentration solution; sterilizing the high-concentration solution, and drying to obtain coarse powder; the preparation method has the beneficial effects that impurities, grease, pigments, microorganisms and the like in livestock and poultry or fish skin are removed through the steps of washing, soaking and filtering, collagen is decomposed into micromolecular collagen peptide by adopting enzymolysis and superfine grinding technologies, and the micromolecular collagen peptide is obtained through sterilization and drying treatment. The stability of the product is improved, and the micromolecular collagen peptide is prepared by the production method and the device, and can effectively promote the generation of the seventeen-type collagen.

Description

Technical Field

[0001] The present invention relates to the field of small molecule collagen peptide production, and in particular to a small molecule collagen peptide that promotes the production of type 17 collagen, a production method thereof and functions thereof. Background Art

[0002] Type III collagen is mainly found in the skin of infants and young children. It is the main structural component of hollow organs such as large blood vessels, uterus, and intestines. In addition to being an extracellular matrix protein to maintain the morphology and structure of skin and tissues and organs, type III collagen also interacts with platelets in the coagulation cascade reaction. It is also an important signal molecule for wound healing. Type III collagen fibers are relatively small and are used to support the tenderness of the skin, making it delicate and elastic. The higher the content, the more delicate and tender the skin will be. Type III collagen can better restore the wound after trauma and is less likely to leave scars.

[0003] The oral products sold on the market are mainly type I collagen peptides and type II collagen peptides. The relevant technology discloses a method for extracting hydrolyzed type II collagen peptide powder, which includes the steps of pretreatment, defatting, enzymatic hydrolysis, isoelectric precipitation and purification.

[0004] The related technology discloses a large-scale preparation method of fish scale type I collagen peptides, which uses marine fish scales or freshwater fish scales as raw materials. After alkali and acid pretreatment to remove impurities, a one-step biological enzymatic hydrolysis technology is used to directly hydrolyze the type I collagen in the fish scales into type I collagen peptides with a relatively concentrated molecular weight distribution. Continuous centrifugal separation and membrane separation technology are then used to separate, purify and concentrate the directed enzyme solution at room temperature to obtain the fish scale type I collagen peptide solution, and finally the finished product is quickly dried using spray drying technology.

[0005] Recombinant human-derived type I collagen and type III collagen are mostly used in the medical beauty external use industry, but orally-administered type I collagen and type III collagen peptide products have not yet appeared, and there is room for further exploration of their preparation methods.

[0006] Collagen XVII is a transmembrane protein that is essential for maintaining cell junctions required for epidermal adhesion. It plays a key role in connecting the cytoskeleton and basement membrane and is associated with aging phenotypes such as hair loss and hair graying. The role of supplementation with type I collagen and type III collagen peptides in promoting type XVII collagen production remains to be explored. Summary of the invention

[0007] The purpose of the present invention is to overcome the above technical deficiencies, to provide a method and device for producing collagen peptides that promote the production of type 17 collagen, and to solve the technical problem that type I and type III collagen peptides cannot be produced simultaneously in the prior art.

[0008] In the first aspect, the present application provides a small molecule collagen peptide that promotes the production of type 17 collagen and a production method thereof using the following technical solutions:

[0009] A method for producing collagen peptides for promoting the production of type 17 collagen, comprising the following steps:

[0010] A, livestock or fish skin pre-treatment, including first water washing, sodium chloride solution soaking, sodium hydroxide solution soaking; second water washing, regulating pH and conductivity in the second water washing;

[0011] B. Use the group and enzyme to enzymolyze the skin of livestock and poultry or fish, and filter the enzymolyzate to obtain a clear liquid;

[0012] C. Decolorize the clear liquid, filter it, exchange water for solids, and filter the solids to obtain a high-concentration solution;

[0013] D. Sterilize the high concentration solution and dry it to obtain a coarse powder;

[0014] E. The coarse powder is ultrafinely crushed and sieved to obtain the finished product.

[0015] In some embodiments, the sterilization in step D is pulsed intense light sterilization, and the drying is vacuum belt drying.

[0016] In the second aspect, the present application provides a small molecule collagen peptide that promotes the production of type 17 collagen and a production device thereof, including a vacuum belt dryer, the vacuum belt dryer including a vacuum hood, a feed port being provided on one side of the vacuum hood, a discharge port being provided on the other side of the vacuum hood, a conveying mechanism, a material mixing mechanism and a drying mechanism being provided in the vacuum hood, the conveying mechanism being used to convey materials, the material mixing mechanism being used to spread materials evenly on the conveying mechanism, and the drying mechanism being used to dry materials.

[0017] In some embodiments, the conveying mechanism includes two rollers rotatably connected to a vacuum cover, a motor is provided in the vacuum cover, an output shaft of the motor is connected to the end of one of the rollers, and the two rollers are connected by a conveyor belt.

[0018] In some embodiments, the material leveling mechanism includes a material leveling plate arranged in the vacuum cover, the material leveling plate is located above the conveyor belt, the material leveling plate abuts against the supporting surface of the conveyor belt, the material leveling plate extends along the width direction of the conveyor belt, and the material leveling plate is provided with material leveling holes at intervals along the extension direction of the material leveling plate. Baffles are provided on both sides of the conveyor belt in the vacuum cover.

[0019] In some embodiments, an adjustment plate is slidably connected to the upper edge of the material leveling plate in the height direction of the material leveling plate, and a screw rod is rotatably connected to the material leveling plate. The screw rod passes through the adjustment plate and is threadedly connected to the adjustment plate. The adjustment plate is used to adjust the size of the material leveling hole.

[0020] In some embodiments, the screw rod is provided with an anti-loosening gear, the material leveling plate is provided with a groove, and an anti-loosening tooth block meshing with the anti-loosening gear is clamped in the groove.

[0021] In some embodiments, a plurality of stirring rods are rotatably connected to the material leveling plate, the stirring rods extend along the height direction of the material leveling plate, and the bottom of the stirring rods extends into the material leveling hole. A driving assembly for driving the stirring rods to rotate is provided on the vacuum cover, and the driving assembly includes a turbine provided on the top of the stirring rods. A worm is rotatably connected to the vacuum cover, and the worm is meshed with a plurality of turbines at the same time. A sprocket is provided at the end of the turbine, and a chain meshed with the sprocket is provided on the side of the conveyor belt.

[0022] In some embodiments, the drying mechanism includes a hot air blower disposed at the bottom of the vacuum hood, a hot air pipe is disposed in the vacuum hood, the outlet of the hot air blower is connected to the inlet of the hot air pipe, the outlet of the hot air pipe is disposed at the top of the vacuum hood, the hot air pipe is located below the conveyor belt, a heat transfer roller is rotatably connected to the hot air pipe, the heat transfer roller abuts against the bottom of the conveyor belt, and a sealing gasket is provided between the hot air pipe and the heat transfer roller.

[0023] In some embodiments, the small molecule collagen peptide can promote the production of type 17 collagen, and the type 17 collagen can be used in the production of collagen peptide products.

[0024] Compared with the prior art, the beneficial effects of the present invention include: through multiple treatment steps such as water washing, soaking and filtering, impurities, oils, pigments and microorganisms in livestock or fish skin are removed, so that the purity of the product is greatly improved; enzymatic hydrolysis and ultrafine grinding and other technologies are used to decompose collagen into small molecule collagen peptides, making it easier to be absorbed and utilized by the human body; after treatments such as sterilization and drying, the stability of the product is improved, it is not easy to deteriorate, and it is easy to store and transport. This production method and production device of type I and type III small molecule collagen peptides have the advantages of scientific working principle, high product quality, high production efficiency, environmental protection and energy saving, etc., and provide an effective solution for the production of collagen peptides.

[0025] The collagen peptide extracted from fish skin in the present application is a high-molecular functional protein, mainly including type I and type III collagen. Collagen is the main component of the skin, accounting for 80% of the dermis of the skin. It forms a fine elastic network in the skin, firmly locking moisture and supporting the skin. Collagen tripeptide is the smallest and most stable structural unit of collagen prepared from fish skin as raw material using advanced bioengineering technology. Since the molecular weight of collagen tripeptide is very small, it can be fully absorbed by the human body. Collagen tripeptide is rich in hydrophilic groups such as hydroxyl and carboxyl groups, as well as natural moisturizing factors such as hydroxyproline, hydroxylysine, and glycine. These ingredients help to improve the water storage capacity of the skin, thereby providing a good environment for the production of type XVII collagen. Secondly, tyrosine in collagen tripeptide combines with tyrosinase to inhibit the formation of skin melanin and achieve a whitening effect, which helps to reduce skin pigmentation and further promote the production of type XVII collagen. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 It is a schematic diagram of the overall structure of the production device provided by the present invention;

[0027] Figure 2 This is a first-view overall structural cross-sectional view of the production device provided by the present invention;

[0028] Figure 3 is a second perspective overall structural sectional view of the production device provided by the present invention;

[0029] Figure 4 This is a schematic diagram of the overall structure of the material sparging mechanism provided by the present invention from a first viewing angle;

[0030] Figure 5 This is a second perspective overall structural diagram of the material sparging mechanism provided by the present invention;

[0031] Figure 6 is a second perspective overall structural sectional view of the material leveling mechanism provided by the present invention;

[0032] Figure 7 It is a schematic diagram of the experimental results of the specific embodiment 1 of the effect of the small molecule collagen peptide provided by the present invention on the gene expression in the human dermal papilla cell model;

[0033] Figure 8 It is a schematic diagram of the experimental results of specific example 2 of the effect of the small molecule collagen peptide provided by the present invention on gene expression in a human dermal papilla cell model. Description of reference numerals: 1. Vacuum cover; 11. Feed inlet; 12. Discharge outlet; 2. Conveying mechanism; 21. Roller; 22. Motor; 23. Conveyor belt; 3. Material leveling mechanism; 31. Material leveling plate; 32. Material leveling hole; 33. Baffle; 34. Adjustment plate; 35. Screw; 36. Anti-loosening gear; 37. Groove; 38. Anti-loosening tooth block; 4. Drying mechanism; 41. Hot air blower; 42. Hot air pipe; 43. Heat transfer roller; 44. Sealing pad; 5. Agitator rod; 6. Drive assembly; 61. Turbine; 62. Worm; 63. Sprocket; 64. Chain. DETAILED DESCRIPTION

[0034] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0035] The present invention provides a method for producing a collagen peptide that promotes the production of type 17 collagen. Figure 1 - Figure 6 As shown, the following steps are included:

[0036] A, livestock or fish skin pre-treatment, including first water washing, sodium chloride solution soaking, sodium hydroxide solution soaking; second water washing, regulating pH and conductivity in the second water washing;

[0037] B. Use the group and enzyme to enzymolyze the skin of livestock and poultry or fish, and filter the enzymolyzate to obtain a clear liquid;

[0038] C. Decolorize the clear liquid, filter it, exchange water for solids, and filter the solids to obtain a high-concentration solution;

[0039] D. Sterilize the high concentration solution and dry it to obtain a coarse powder;

[0040] E. The coarse powder is ultrafinely crushed and sieved to obtain the finished product.

[0041] During use, impurities, oils, pigments and microorganisms in livestock or fish skin are removed through multiple steps of washing, soaking and filtering, so that the purity of the product is greatly improved. Collagen is decomposed into small molecule collagen peptides by using technologies such as enzymatic hydrolysis and ultrafine grinding, making it easier to be absorbed and utilized by the human body. After treatments such as sterilization and drying, the stability of the product is improved, it is not easy to deteriorate, and it is easy to store and transport. This production method and production device of type III small molecule collagen peptides have the advantages of scientific working principle, high product quality, high production efficiency, environmental protection and energy saving, etc., and provide an effective solution for the production of collagen peptides.

[0042] To improve sterilization and drying quality, please refer to Figure 1In a preferred embodiment, the sterilization in step D is pulsed intense light sterilization, and the drying is vacuum belt drying.

[0043] When used, pulsed light sterilization and vacuum belt drying play an important role in the production process of type III small molecule collagen peptides. Pulsed light sterilization can efficiently and quickly kill microorganisms in high-concentration solutions to ensure product safety; vacuum belt drying can dry high-concentration solutions at a lower temperature to maintain product quality and nutritional value.

[0044] The embodiment of the present application also discloses a small molecule collagen peptide for promoting the production of type 17 collagen and a production device thereof, including a vacuum belt dryer, the vacuum belt dryer including a vacuum hood 1, a feed port 11 being provided on one side of the vacuum hood 1, and a discharge port 12 being provided on the other side of the vacuum hood 1, a conveying mechanism 2, a material mixing mechanism 3 and a drying mechanism 4 being provided in the vacuum hood 1, the conveying mechanism 2 being used for conveying materials, the material mixing mechanism 3 being used for spreading materials evenly on the conveying mechanism 2, and the drying mechanism 4 being used for drying materials.

[0045] When in use, the material enters the dryer from the feed port 11 on one side of the vacuum cover 1. The conveying mechanism 2 undertakes the important task of conveying the material in the vacuum cover 1. The function of the material mixing mechanism 3 is to spread the material entering the dryer evenly on the conveying mechanism 2. This can ensure that the material is evenly heated during the drying process, improve the drying efficiency and product quality. The drying mechanism 4 is the core part of the vacuum belt dryer and is mainly used to dry the material. After being processed by the drying mechanism 4, the moisture in the material is fully removed to form a dry type III small molecule collagen peptide product. The dried product is discharged from the dryer from the discharge port 12 on the other side of the vacuum cover 1. This vacuum belt dryer efficiently and evenly dries the type III small molecule collagen peptide in a vacuum environment through the coordinated work of the feed port 11, the conveying mechanism 2, the material mixing mechanism 3 and the drying mechanism 4, providing a reliable equipment guarantee for the production of high-quality collagen peptide products.

[0046] To convey materials, please refer to Figure 2 In a preferred embodiment, the conveying mechanism 2 includes two rollers 21 rotatably connected to the vacuum cover 1, a motor 22 is provided in the vacuum cover 1, an output shaft of the motor 22 is connected to the end of one of the rollers 21, and the two rollers 21 are connected by a conveyor belt 23.

[0047] When in use, before starting, the motor 22 is in a stationary state, the two rollers 21 do not rotate, and the conveyor belt 23 is statically laid between the two rollers 21. When the vacuum belt dryer starts working, the motor 22 starts. The output shaft of the motor 22 is connected to the end of one of the rollers 21, and the rotational motion of the motor 22 is transmitted to the roller 21 through the output shaft. The roller 21 connected to the motor 22 starts to rotate around its own axis under the drive of the motor 22. Since the two rollers 21 are connected by the conveyor belt 23, the rotating roller 21 drives the conveyor belt 23 to move through friction. As the rollers 21 rotate, the conveyor belt 23 starts to circulate between the two rollers 21. The upper surface of the conveyor belt 23 carries the material to be dried and moves from the feed port 11 to the discharge port 12. This conveying mechanism 2 drives the roller 21 to rotate through the motor 22, drives the conveyor belt 23 to run, realizes the stable transportation and continuous drying of the material, and provides an important guarantee for the efficient operation of the vacuum belt dryer.

[0048] In order to spread the material evenly on the conveyor belt 23, please refer to Figure 2 In a preferred embodiment, the material leveling mechanism 3 includes a material leveling plate 31 arranged in the vacuum cover 1, the material leveling plate 31 is located above the conveyor belt 23, the material leveling plate 31 abuts against the receiving surface of the conveyor belt 23, the material leveling plate 31 extends along the width direction of the conveyor belt 23, and the material leveling plate 31 is provided with material leveling holes 32 at intervals along the extension direction of the material leveling plate 31, and baffles 33 are provided on both sides of the conveyor belt 23 in the vacuum cover 1.

[0049] When the material enters the vacuum cover 1 from the feed port 11 and falls on the conveyor belt 23, the material may be unevenly distributed. At this time, the accumulation of the material on the conveyor belt 23 may vary depending on the feeding method, the fluidity of the material, and other factors. The leveling plate 31 is located above the conveyor belt 23 and abuts against the receiving surface of the conveyor belt 23. As the conveyor belt 23 moves, the material will be leveled by the leveling plate 31 when passing through the leveling plate 31. Due to the close contact between the leveling plate 31 and the conveyor belt 23, the material at a higher position will be blocked by the leveling plate 31 and dispersed to both sides, so that the height of the material gradually tends to be uniform. Leveling holes 32 are provided at intervals on the leveling plate 31 along its extension direction. When the material passes through the leveling plate 31, a part of the material will fall through the leveling holes 32. These materials passing through the leveling holes 32 will fill the lower area on the conveyor belt 23, further promoting the uniform distribution of the material. Baffles 33 are provided on both sides of the conveyor belt 23 in the vacuum cover 1. These baffles 33 can limit the movement range of the material in the width direction of the conveyor belt 23, and prevent the material from overflowing from both sides of the conveyor belt 23. The material leveling mechanism 3 realizes the uniform distribution of the material on the conveyor belt 23 through the leveling effect of the material leveling plate 31, the adjustment effect of the material leveling hole 32, and the limiting and guiding effect of the baffle 33, which provides a good foundation for the subsequent drying process and ensures the uniformity of the drying effect and the stability of the product quality.

[0050] To adjust the size of the screed hole 32, please refer to Figure 3 In a preferred embodiment, an adjustment plate 34 is slidably connected to the material leveling plate 31 along the height direction of the material leveling plate 31, and a screw rod 35 is rotatably connected to the material leveling plate 31. The screw rod 35 passes through the adjustment plate 34 and is threadedly connected to the adjustment plate 34. The adjustment plate 34 is used to adjust the size of the material leveling hole 32.

[0051] When in use, when no adjustment is performed, the adjustment plate 34 is located at a certain initial position on the leveling plate 31, and the leveling hole 32 presents its default size. When the size of the leveling hole 32 needs to be adjusted, the operator decides to adjust the position of the adjustment plate 34. The operator rotates the screw rod 35 on the leveling plate 31 manually or automatically. Since the screw rod 35 passes through the adjustment plate 34 and is threadedly connected to the adjustment plate 34, when the screw rod 35 rotates, the adjustment plate 34 will slide along the height direction on the leveling plate 31. If the screw rod 35 rotates clockwise, the adjustment plate 34 may slide upward; if the screw rod 35 rotates counterclockwise, the adjustment plate 34 may slide downward. As the adjustment plate 34 slides on the leveling plate 31, it will gradually cover or expose part of the leveling hole 32, thereby changing the effective size of the leveling hole 32. When the adjustment plate 34 slides upward, it will block more of the sparging holes 32, making the sparging holes 32 smaller; when the adjustment plate 34 slides downward, the sparging holes 32 will gradually expose more and become larger. By adjusting the size of the sparging holes 32, the distribution thickness and uniformity of the material on the conveyor belt 23 can be optimized, thereby affecting the drying process. The appropriate size of the sparging holes 32 can make the material evenly heated under the action of the drying mechanism 4, thereby improving the drying efficiency and product quality. This sparging mechanism 3 with an adjustment plate 34 and a screw rod 35 adjusts the position of the adjustment plate 34 by rotating the screw rod 35, thereby achieving precise adjustment of the size of the sparging holes 32 to meet the uniform distribution requirements under different materials and drying requirements, thereby improving the adaptability and working efficiency of the vacuum belt dryer.

[0052] To reduce the possibility of screw 35 loosening, please refer to Figure 5 In a preferred embodiment, the screw rod 35 is provided with an anti-loosening gear 36 , the material leveling plate 31 is provided with a groove 37 , and an anti-loosening tooth block 38 meshing with the anti-loosening gear 36 is clamped in the groove 37 .

[0053] When in use, after the adjustment plate 34 is adjusted to the desired position by rotating the screw 35, the screw 35 is in a stationary state, and the anti-loosening gear 36 also stops rotating and is fixed at the corresponding position on the screw 35. An anti-loosening tooth block 38 is clamped in the groove 37 on the material leveling plate 31. Under normal working conditions, the anti-loosening tooth block 38 is in the groove 37 and does not contact the anti-loosening gear 36. When it is necessary to prevent the screw 35 from loosening, the anti-loosening tooth block 38 is ready to play a role. During the operation of the dryer, due to the vibration of the conveyor belt 23, the flow impact of the material or other external factors, the screw 35 may have a tendency to rotate slightly, thereby causing the position of the adjustment plate 34 to change, affecting the size stability of the material leveling hole 32 and the uniform distribution effect of the material. In order to prevent the screw 35 from loosening, the anti-loosening tooth block 38 is pushed into the groove 37 so that it is meshed with the anti-loosening gear 36. When the anti-loosening tooth block 38 is clamped into the groove 37 and meshed with the anti-loosening gear 36, it will prevent the anti-loosening gear 36 from rotating. Since the anti-loosening gear 36 is fixed on the screw rod 35, when the anti-loosening tooth block 38 prevents the anti-loosening gear 36 from rotating, the screw rod 35 is also prevented from rotating. In this way, the screw rod 35 can be effectively prevented from loosening under the influence of external factors, and the position of the adjustment plate 34 is ensured to be stable, thereby ensuring that the size of the material sparging hole 32 remains unchanged during the working process.

[0054] In order to make the material distribution more uniform and reduce the possibility of the material hole 32 being blocked, please refer to Figure 6 In a preferred embodiment, a plurality of stirring rods 5 are rotatably connected to the material leveling plate 31, the stirring rods 5 extend along the height direction of the material leveling plate 31, the bottoms of the stirring rods 5 extend into the material leveling holes 32, and the vacuum cover 1 is provided with a driving assembly 6 for driving the stirring rods 5 to rotate.

[0055] During use, when the material needs to be further uniformly processed, the drive assembly 6 on the vacuum cover 1 receives a start signal. The drive assembly 6 starts to operate and transmits power to the stirring rod 5. As the stirring rod 5 rotates, its bottom stirs the material passing through the material hole 32 in the material hole 32. The rotation of the stirring rod 5 can make the material looser and avoid the material from being blocked at the material hole 32, and it also helps to further evenly distribute the material. The rotation of the stirring rod 5 can also promote the flow of the material on the conveyor belt 23. Through the stirring action, the material can pass through the material hole 32 more smoothly and be more evenly distributed on the conveyor belt 23. This can improve the drying efficiency of the material and ensure that the material on the entire conveyor belt 23 can be fully dried.

[0056] To drive the stirring rod 5 to rotate, please refer to Figure 3In a preferred embodiment, the driving assembly 6 includes a turbine 61 arranged on the top of the stirring rod 5, and a worm 62 is rotatably connected to the vacuum cover 1. The worm 62 is simultaneously engaged with multiple turbines 61. A sprocket 63 is provided at the end of the turbine 61, and a chain 64 engaged with the sprocket 63 is provided on the side of the conveyor belt 23.

[0057] When in use, when the vacuum belt dryer starts to operate, the conveyor belt 23 starts to move. The chain on the side of the conveyor belt 23 moves synchronously with the movement of the conveyor belt 23. Since the chain is meshed with the sprocket 63, as the chain moves, the chain will drive the sprocket 63 to rotate. The sprocket 63 is arranged at the end of the turbine 61, so the rotation of the sprocket 63 will be transmitted to the turbine 61. The rotation of the sprocket 63 causes the turbine 61 to start rotating. The top of the stirring rod 5 is connected to the turbine 61, so the rotation of the turbine 61 drives the stirring rod 5 to rotate on the material leveling plate 31. At the same time, since the worm 62 is meshed with multiple turbines 61, when the turbine 61 rotates, it will drive the worm 62 to rotate. The worm 62 plays the role of transmitting power and coordinating the synchronous rotation of multiple turbines 61. As the stirring rod 5 rotates, its bottom stirs the material in the material leveling hole 32. The rotation of the stirring rod 5 makes the material looser, avoids the material from blocking the material leveling hole 32, and promotes the uniform distribution and flow of the material on the conveyor belt 23.

[0058] To dry the material, refer to Figure 2 In a preferred embodiment, the drying mechanism 4 includes a hot air blower 41 arranged at the bottom of the vacuum hood 1, a hot air pipe 42 is arranged in the vacuum hood 1, the outlet of the hot air blower 41 is connected to the inlet of the hot air pipe 42, the outlet of the hot air pipe 42 is arranged at the top of the vacuum hood 1, the hot air pipe 42 is located below the conveyor belt 23, a heat transfer roller 43 is rotatably connected to the hot air pipe 42, the heat transfer roller 43 abuts against the bottom of the conveyor belt 23, and a sealing pad 44 is provided between the hot air pipe 42 and the heat transfer roller 43.

[0059] When in use, when the material needs to be dried, the hot air blower 41 at the bottom of the vacuum hood 1 is started. After the hot air blower 41 heats the outside air, hot air is generated and discharged from the outlet. The hot air discharged by the hot air blower 41 enters the inlet of the hot air pipe 42. The hot air pipe 42 extends inside the vacuum hood 1 and transports the hot air from the bottom to the top. Since the hot air pipe 42 is located below the conveyor belt 23, the hot air gradually approaches the material to be dried during the transmission process. The outlet of the hot air pipe 42 is located at the top of the vacuum hood 1. The purpose of this design is to enable the hot air to form a circulating flow path in the entire vacuum hood 1. After the hot air rises from the bottom to the top, it will diffuse to the surroundings, and then under the action of the vacuum environment and airflow, it will flow downward again, passing through the material and the conveyor belt 23, forming a circulating dry airflow. When the hot air flows in the hot air pipe 42, the heat transfer roller 43 rotatably connected to the hot air pipe 42 plays a key role in heat transfer. The heat transfer roller 43 is in contact with the bottom of the conveyor belt 23, and the heat of the hot air is transferred to the heat transfer roller 43 through the hot air pipe 42. Since the heat transfer roller 43 is in contact with the conveyor belt 23, it transfers the heat to the conveyor belt 23, thereby heating the material on the conveyor belt 23. While transferring heat, the heat transfer roller 43 will also rotate with the movement of the conveyor belt 23. The sealing pad 44 plays a sealing role between the hot air pipe 42 and the heat transfer roller 43. It prevents the hot air from leaking from the connection between the hot air pipe 42 and the heat transfer roller 43, ensuring that the hot air can be fully transferred to the conveyor belt 23 and the material through the heat transfer roller 43, thereby improving the heat utilization efficiency and ensuring the drying effect.

[0060] The examples of the present application also disclose the effects of small molecule collagen peptides on gene expression in a human dermal papilla cell model. Specific embodiment 1:

[0062] This example aims to verify the effect of small molecule collagen peptide on COL17A1 gene expression in human dermal papilla cell model through experiments.

[0063] Experimental methods:

[0064] 1. Cell recovery and passaging:

[0065] -Take out the stored human dermal papilla cells from liquid nitrogen and quickly place them in a 37°C water bath to dissolve.

[0066] - Add 5 mL of complete medium preheated to 37°C, centrifuge at 1000 rpm for 5 minutes, and discard the supernatant.

[0067] - Add pre-warmed complete medium and gently pipette to resuspend the cells and culture.

[0068] - When the cells grew to 80-90%, they were washed twice with PBS, digested with 0.25% trypsin, incubated at 37°C for 1 minute, and then digested with culture medium.

[0069] - Centrifuge again at 1000 rpm for 5 minutes, discard the supernatant, add pre-warmed complete medium and gently pipette, resuspend the cells and perform 1:2-1:3 subculture.

[0070] 2. Cell inoculation and culture:

[0071] - Collect and count the human hair papilla cells grown to 80-90%. According to the counting results, 2 mL of cell suspension (3.0×10 5 cells / mL) were inoculated into 6-well plates.

[0072] - Place the inoculated 6-well plate in an incubator (37°C, 5.0% CO2, 95% RH) for 24 hours.

[0073] 3.H2O2 induced human dermal papilla cells:

[0074] -After culturing the cells for 24 hours, the culture medium in the wells was discarded, and the experimental group samples were added to each well in turn to pretreat the cells for 2 hours.

[0075] - The culture medium in the wells was discarded, and H2O2 was added to the other groups except the blank group for induction.

[0076] -After induction, 2 mL of complete medium was added to each well of the blank group, and the model group and sample group were added according to the table below. The 6-well plate was placed in an incubator (37°C, 5.0% CO2, 95% RH) and cultured for 24 hours.

[0077] Table 1 Effect of small molecule collagen peptide on COL17A1 gene expression induced by H2O2 in human dermal papilla cell model

[0078]

[0079] Note: BC is the blank group, and NC is the model group.

[0080] 4. RNA extraction and cDNA reverse transcription:

[0081] -Digest the cells with trypsin, collect them in a centrifuge tube, add 500μl of the lysis buffer RLF in the RNA extraction kit, add it to the gDNA Fiter Column, operate according to the instructions, and finally add 35μl of ddH2O for elution and store at -80℃.

[0082] -According to PrimeScript TM The operation was carried out according to the instruction manual of RT Master Mix (Takara), and 20 μl reaction system was prepared. The cDNA product was stored at -20°C.

[0083] 5.qRT-PCR:

[0084] -According to TB Premix Ex Taq TM The reaction system was configured according to the instruction manual of CFX-96 PCR instrument (Takara), and the reaction program was edited on the supporting software according to the instruction manual of CFX-96 PCR instrument.

[0085] - Primer sequences used: COL17A1-F: GCAGAGCTGAGTAGTCGCA, COL17A1-R: AATTCAGACCCTCGCAGCAA, GAPDH-F: GGAGCGAGATCCCTCCAAAAT, GAPDH-R: GGCTGTTGTCATACTTCTCATGG.

[0086] 6. Statistical analysis:

[0087] -Gene expression level uses GAPDH as the internal reference gene, and the formula gene relative expression level = 2 -ΔΔCq calculate.

[0088] - GraphPad Prism8 software was used for data analysis. Normally distributed quantitative data were expressed as mean ± standard deviation (x ± s). Multi-sample analysis of variance was used for comparison between groups with equal variance, and corrected analysis of variance was used for comparison between groups with unequal variance. If the difference between the groups was statistically significant, the LSD method was further used for pairwise comparison.

[0089] Experimental results:

[0091] Based on the H2O2-induced human dermal papilla cell model, compared with the blank group, the COL17A1 gene expression in the model group (NC group) was significantly decreased (p<0.001). Compared with the model group, the 1mg / mL and 5mg / mL small molecule collagen peptide sample groups could significantly increase the COL17A1 gene expression in human dermal papilla cells, with the increase rates being 6.07% (p<0.05) and 12.95% (p<0.05), respectively. The 0.5mg / mL small molecule collagen peptide sample group had no significant effect on the COL17A1 gene expression in human dermal papilla cells (p>0.05). Specific embodiment 2:

[0093] This specific example aims to evaluate the effect of small molecule collagen peptides on COL17A1 gene expression in a UVA-induced fibroblast model.

[0094] Experimental methods:

[0095] 1. Cell recovery and passage: Same as in Example 1

[0096] 2. Cell inoculation and culture: Same as in Example 1

[0097] 3. UVA induces fibroblasts:

[0098] -After culturing the cells for 24 hours, the culture medium in the wells was discarded, and the experimental group samples were added to each well to pretreat the cells for 2 hours.

[0099] - The culture medium in the wells was discarded, and 2 mL of PBS was added to each well. Except for the blank group, the other groups were induced by UVA.

[0100] -After induction, discard the PBS in the wells, add 2 mL of complete culture medium to each well of the blank group, and add samples to the model group and sample group according to Table 2, and continue to culture for 24 hours.

[0101]

[0102] Note: BC is the blank group, NC is the model group

[0103] 4. RNA extraction and cDNA reverse transcription: Same as in Specific Example 1

[0104] 5.qRT-PCR: Same as in Specific Example 1

[0105] 6. Statistical analysis: Same as in Example 1

[0106] Experimental results:

[0108] Based on the UVA-induced fibroblast model, compared with the blank group, the COL17A1 gene expression in the model group (NC group) was significantly decreased (p<0.001). Compared with the model group, the 1mg / mL and 5mg / mL small molecule collagen peptide sample groups can significantly increase the COL17A1 gene expression in fibroblasts, with the increase rates being 15.88% (p<0.05) and 26.79% (p<0.01), respectively. The 0.5mg / mL small molecule collagen peptide sample group had no significant effect on the COL17A1 gene expression in fibroblasts (p>0.05).

[0109] In order to better understand the present invention, the following Figure 1 - Figure 6The working principle of the technical solution of a small molecule collagen peptide and a production device thereof for promoting the production of type 17 collagen of the present invention is described in detail: the material enters the dryer from the feed port 11 on one side of the vacuum cover 1. The conveying mechanism 2 undertakes the important task of conveying the material in the vacuum cover 1. The function of the material mixing mechanism 3 is to enable the material entering the dryer to be evenly spread on the conveying mechanism 2. This can ensure that the material is evenly heated during the drying process, improve the drying efficiency and product quality. The drying mechanism 4 is the core part of the vacuum belt dryer, which is mainly used to dry the material. After being processed by the drying mechanism 4, the moisture in the material is fully removed to form a dry type III small molecule collagen peptide product. The dried product is discharged from the dryer from the discharge port 12 on the other side of the vacuum cover 1. This vacuum belt dryer efficiently and evenly dries the type III small molecule collagen peptide in a vacuum environment through the coordinated work of the feed port 11, the conveying mechanism 2, the mixing mechanism 3 and the drying mechanism 4, providing a reliable equipment guarantee for the production of high-quality collagen peptide products.

[0110] The specific implementation of the present invention described above does not constitute a limitation on the protection scope of the present invention. Any other corresponding changes and modifications made based on the technical concept of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. A small molecule collagen peptide for promoting the production of type 17 collagen and a production method thereof, characterized in that: The following steps are involved: A, livestock or fish skin pre-treatment, including first water washing, sodium chloride solution soaking, sodium hydroxide solution soaking; second water washing, regulating pH and conductivity in the second water washing; B. Use the group and enzyme to enzymolyze the skin of livestock and poultry or fish, and filter the enzymolyzate to obtain a clear liquid; C. Decolorize the clear liquid, filter it, exchange water for solids, and filter the solids to obtain a high-concentration solution; D. Sterilize the high concentration solution and dry it to obtain a coarse powder; E. The coarse powder is ultra-finely crushed and sieved to obtain the finished product.

2. A small molecule collagen peptide for promoting the production of type 17 collagen and a production method thereof according to claim 1, characterized in that: The sterilization in step D is pulsed intense light sterilization, and the drying is vacuum belt drying.

3. A small molecule collagen peptide for promoting the production of type 17 collagen and a production device thereof, using a method for producing a type III small molecule collagen peptide as described in any one of claims 1-2, characterized in that: include: A vacuum belt dryer, the vacuum belt dryer comprising a vacuum cover (1), a material feed port (11) being provided on one side of the vacuum cover (1), a material discharge port (12) being provided on the other side of the vacuum cover (1), a conveying mechanism (2), a material mixing mechanism (3) and a drying mechanism (4) being provided inside the vacuum cover (1), the conveying mechanism (2) being used for conveying materials, the material mixing mechanism (3) being used for evenly spreading materials on the conveying mechanism (2), and the drying mechanism (4) being used for drying materials.

4. A small molecule collagen peptide for promoting the production of type 17 collagen and a production device thereof according to claim 3, characterized in that: The conveying mechanism (2) comprises two rollers (21) rotatably connected to the inside of the vacuum cover (1); a motor (22) is provided inside the vacuum cover (1); an output shaft of the motor (22) is connected to the end of one of the rollers (21); and the two rollers (21) are connected via a conveying belt (23).

5. A small molecule collagen peptide for promoting the production of type 17 collagen and a production device thereof according to claim 4, characterized in that: The material leveling mechanism (3) comprises a material leveling plate (31) arranged in the vacuum cover (1), the material leveling plate (31) is located above the conveyor belt (23), the material leveling plate (31) abuts against the receiving surface of the conveyor belt (23), the material leveling plate (31) extends along the width direction of the conveyor belt (23), and material leveling holes (32) are arranged on the material leveling plate (31) at intervals along the extending direction of the material leveling plate (31), and baffles (33) are arranged on both sides of the conveyor belt (23) in the vacuum cover (1).

6. A small molecule collagen peptide for promoting the production of type 17 collagen and a production device thereof according to claim 5, characterized in that: An adjusting plate (34) is slidably connected to the material leveling plate (31) in the height direction of the material leveling plate (31), and a screw rod (35) is rotatably connected to the material leveling plate (31). The screw rod (35) passes through the adjusting plate (34) and is threadedly connected to the adjusting plate (34). The adjusting plate (34) is used to adjust the size of the material leveling hole (32).

7. A small molecule collagen peptide for promoting the production of type 17 collagen and a production device thereof according to claim 6, characterized in that: The screw rod (35) is provided with an anti-loosening gear (36), the material leveling plate (31) is provided with a groove (37), and an anti-loosening tooth block (38) meshing with the anti-loosening gear (36) is clamped in the groove (37).

8. The small molecule collagen peptide for promoting the production of type 17 collagen and the production device thereof according to claim 5, characterized in that: The material leveling plate (31) is rotatably connected to a plurality of stirring rods (5), the stirring rods (5) extending in the height direction of the material leveling plate (31), the bottoms of the stirring rods (5) extending into the material leveling holes (32), the vacuum cover (1) is provided with a driving assembly (6) for driving the stirring rods (5) to rotate, the driving assembly (6) comprising a turbine (61) arranged on the top of the stirring rods (5), the vacuum cover (1) is rotatably connected to a worm (62), the worm (62) simultaneously meshing with a plurality of turbines (61), a sprocket (63) is provided at the end of the turbine (61), and a chain (64) meshing with the sprocket (63) is provided on the side of the conveyor belt (23).

9. The small molecule collagen peptide for promoting the production of type 17 collagen and the production device thereof according to claim 4, characterized in that: The drying mechanism (4) comprises a hot air blower (41) arranged at the bottom of the vacuum cover (1); a hot air pipe (42) is arranged inside the vacuum cover (1); an outlet of the hot air blower (41) is connected to an inlet of the hot air pipe (42); the outlet of the hot air pipe (42) is arranged at the top of the vacuum cover (1); the hot air pipe (42) is located below the conveyor belt (23); a heat transfer roller (43) is rotatably connected to the hot air pipe (42); the heat transfer roller (43) abuts against the bottom of the conveyor belt (23); and a sealing pad (44) is arranged between the hot air pipe (42) and the heat transfer roller (43).

10. A small molecule collagen peptide for promoting the production of type 17 collagen and a production method and device thereof according to claims 1-9, characterized in that: The small molecule collagen peptide can promote the production of type 17 collagen, and the type 17 collagen can be applied to the production of collagen peptide products.

Images