Method for accurately quantifying miRNA copy number in extracellular vesicles

Abstract

The invention relates to the technical field of biological analysis and detection, in particular to a method for accurately quantifying miRNA copy number in extracellular vesicles, which comprises the following steps: providing a DNA tetrahedron probe which comprises a DNA tetrahedron and a molecular beacon connected with the DNA tetrahedron; the molecular beacon can be specifically combined with a target miRNA and can release a detectable signal; co-incubating the extracellular vesicles and the DNA tetrahedron probe, and detecting the signal intensity of the co-incubated extracellular vesicles; and then calculating the copy number of the target miRNA in the extracellular vesicle according to the signal intensity. The method provided by the invention can realize quantitative analysis of miRNA in single extracellular vesicles, and has the advantages of avoiding damage to vesicle structures, being simple and convenient in detection steps and the like.

Description

Technical Field

[0001] The present invention relates to the technical field of biological analysis and detection, and in particular to a method for accurately quantifying the copy number of miRNA in extracellular vesicles. Background Art

[0002] Extracellular vesicles (EVs) are secreted by cells and carry a wealth of biomolecules (including miRNA). The delivery of miRNA mediated by extracellular vesicles is one of the important pathways of intercellular communication. Due to the heterogeneity of extracellular vesicles, a single extracellular vesicle may express different markers, so it is crucial to understand in detail the miRNA carried by a single extracellular vesicle. Through single vesicle detection technology, researchers can gain a deeper understanding of the role of EVs in the occurrence and development of diseases, providing a new perspective for the diagnosis and treatment of diseases.

[0003] Due to the low abundance and high heterogeneity of miRNA in extracellular vesicles, existing detection methods usually adopt a signal amplification strategy. For example, Lee et al. fused liposomes encapsulating chain hybridization reaction probes with vesicles, carried out chain hybridization reactions with targets in the vesicles, and amplified signals to achieve in situ miRNA detection [Nat. Commun. 2017, 8(1), 1683]. However, the signal amplification methods in the prior art rely on complex liposome delivery systems and different amplification efficiencies between different vesicles, resulting in the loss of original information of natural extracellular vesicles. Secondly, the prior art can also adopt a probe delivery strategy to deliver the detection probe into the lumen of the extracellular vesicles through perforation, membrane fusion or nanoparticle carriers, but they have limitations such as vesicle structure destruction, miRNA loss, complex preparation and low delivery efficiency.

[0004] Therefore, there is an urgent need to develop technologies that can accurately quantify miRNAs in single extracellular vesicles without destroying the integrity of the vesicle structure. Summary of the invention

[0005] The purpose of the present invention is to provide a method for accurately quantifying the copy number of miRNA in extracellular vesicles, by which the copy number of target miRNA in a single extracellular vesicle can be quantified, and the method has the advantages of simple operation and no destruction of the vesicle structure.

[0006] To this end, in a first aspect, the present invention provides a DNA tetrahedron probe, which comprises a DNA tetrahedron and a molecular beacon connected thereto;

[0007] The molecular beacon can specifically bind to a target miRNA and release a detectable signal after binding to the target miRNA.

[0008] Furthermore, the molecular beacon includes a fluorescent molecular beacon, and the 5' end and the 3' end are connected to a fluorescent group and a quenching group respectively.

[0009] Furthermore, the fluorescent group is selected from at least one of FAM, HEX, TAMRA, Cy3, and Cy5; and the quenching group is selected from at least one of BHQ and Dabcyl.

[0010] Furthermore, the nucleotide sequence of the molecular beacon is SEQ ID NO: 1.

[0011] Furthermore, the DNA tetrahedron probe is obtained by self-assembly of a single-stranded DNA having the following nucleotide sequence:

[0012] SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5.

[0013] A second aspect of the present invention provides a method for quantifying the copy number of a target miRNA in an extracellular vesicle, comprising:

[0014] Providing a DNA tetrahedron probe, the DNA tetrahedron probe comprising a DNA tetrahedron and a molecular beacon connected thereto; the molecular beacon specifically binds to the target miRNA and releases a detectable signal after binding to the target miRNA;

[0015] Co-incubating the extracellular vesicles with the DNA tetrahedron probe, and detecting the signal intensity of the extracellular vesicles after co-incubation;

[0016] The copy number of the target miRNA in the extracellular vesicles is calculated according to the signal intensity.

[0017] Furthermore, the molecular beacon includes a fluorescent molecular beacon, and the detectable signal includes fluorescence; the fluorescence is detected by single-molecule fluorescence imaging.

[0018] Furthermore, the single-molecule fluorescence imaging includes total internal reflection fluorescence microscopy imaging.

[0019] Furthermore, the co-incubation conditions include 20-35° C., 1-4 h.

[0020] Furthermore, before detecting the signal of the extracellular vesicles after co-incubation, the method further includes the following steps: capturing the extracellular vesicles after co-incubation on a carrier.

[0021] Furthermore, the carrier includes a glass sheet; the glass sheet is pretreated with glutaraldehyde; the glutaraldehyde pretreatment step includes: ultrasonically treating the glass sheet in ultrapure water, methanol, acetone and sodium hydroxide aqueous solution in sequence, then immersing it in a mixed solution of sulfuric acid and hydrogen peroxide, and then activating it with 3-aminopropyltriethoxysilane and glutaraldehyde.

[0022] Furthermore, the method for quantifying the copy number of target miRNA in extracellular vesicles also includes drawing a standard curve, which includes:

[0023] Providing extracellular vesicles containing different known target miRNA copy numbers as standards; for example, providing extracellular vesicles containing 1, 2, or 3 target miRNA copy numbers as standards;

[0024] The standard is co-incubated with the DNA tetrahedron probe, and then the co-incubated standard is subjected to photobleaching analysis and signal detection, and the photobleaching step curve and signal intensity distribution are statistically analyzed, and then the linear relationship between the target miRNA copy number and the signal intensity is obtained by fitting.

[0025] In some embodiments, the step of drawing a standard curve comprises:

[0026] Extracellular vesicles containing known copy numbers of different target miRNAs are provided as standards;

[0027] The standard is co-incubated with the DNA tetrahedron probe, and then the co-incubated standard is subjected to photobleaching analysis and fluorescence intensity detection, and the photobleaching step curve and fluorescence intensity distribution are statistically analyzed, and then the linear relationship between the target miRNA copy number and the fluorescence intensity is obtained by fitting.

[0028] Further, the copy number of the target miRNA in the extracellular vesicles is calculated according to the signal intensity using the standard curve.

[0029] Furthermore, the molecular beacon includes a fluorescent molecular beacon, and the 5' end and the 3' end are connected to a fluorescent group and a quenching group respectively.

[0030] Furthermore, the fluorescent group is selected from at least one of FAM, HEX, TAMRA, Cy3, and Cy5; and the quenching group is selected from at least one of BHQ and Dabcyl.

[0031] Furthermore, the nucleotide sequence of the molecular beacon is SEQ ID NO: 1.

[0032] Furthermore, the DNA tetrahedron probe is obtained by self-assembly of a single-stranded DNA having the following nucleotide sequence:

[0033] SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5.

[0034] Compared with the prior art, the technical solution of the present invention has the following beneficial effects:

[0035] The present invention provides a detection method, which can quantitatively detect miRNA in a single extracellular vesicle. The method mainly delivers molecular beacons to extracellular vesicles through DNA tetrahedral probes, which can not only avoid damage to the vesicle structure, but also has excellent delivery efficiency. By fixing the vesicles delivered by DNA tetrahedral probes on a carrier and performing single-molecule imaging analysis, the copy number of target miRNA in the extracellular vesicle can be calculated. Based on the above method, the present invention also discovered a new distribution pattern of miRNAs in extracellular vesicles. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Various other advantages and benefits will become apparent to those of ordinary skill in the art by reading the detailed description of the preferred embodiments below. The accompanying drawings are only used for the purpose of illustrating the preferred embodiments and are not to be considered as limiting the present invention. In the accompanying drawings:

[0037] Figure 1 :Schematic diagram of the working principle of in situ detection of miRNA in single extracellular vesicles using DNA tetrahedral probes;

[0038] Figure 2 : Results of characterization of native extracellular vesicles;

[0039] Among them, (A) NTA and TEM characterization of the size and shape of natural extracellular vesicles, scale: 100nm; (B) Western blotting analysis results of extracellular vesicle protein markers;

[0040] Figure 3 : Total internal reflection fluorescence image of extracellular vesicles on coverslip;

[0041] The left picture shows the total internal reflection fluorescence image of extracellular vesicles after fixation on a cover glass without glutaraldehyde modification; the right picture shows the total internal reflection fluorescence image of extracellular vesicles after fixation on a cover glass modified as above; the scale bar is 2 μm;

[0042] Figure 4 : Gel electrophoresis analysis results of DNA tetrahedral probe;

[0043] Figure 5 :Analysis of specificity and sensitivity of DNA tetrahedron probe binding to target miR-21-5p;

[0044] Among them, (A) fluorescence spectra of different concentrations of target miR-21-5p after incubation with DNA tetrahedron probe; (B) linear range of DNA tetrahedron probe detecting different concentrations of target miR-21-5p; (C) comparative analysis of fluorescence intensity of DNA tetrahedron probe detecting targets with 1bp mismatch, targets with 2bp mismatch, and targets without mismatch;

[0045] Figure 6 :Using DNA tetrahedron probe to image and analyze vesicles;

[0046] Among them, (A) DNA tetrahedrons without molecular beacons are used, which can enter the vesicles without destroying the vesicle structure, and the entry efficiency is about 70%; (B) DNA tetrahedrons with molecular beacons are used, which specifically mark the vesicles containing target miRNA;

[0047] Figure 7 : Schematic diagram of detecting the copy number of target molecules in liposomes;

[0048] Figure 8 : Detection results of liposomes with one target DNA tetrahedron;

[0049] Among them, (A) Total internal reflection fluorescence image of liposomes with a target DNA tetrahedron (Cy5), the upper left is a control without fluorescent probe, the scale bar is 2μm; (B) Single-step photobleaching analysis results of the signal in Figure A;

[0050] Fig. 9 : Detection results of liposomes loaded with different numbers of target DNA tetrahedrons;

[0051] Among them, (A) the results of multi-step photobleaching analysis of different numbers (1, 2, 3) of target DNA tetrahedrons loaded in liposomes; (B) statistical analysis of the fluorescence intensity after incubation of the above liposomes with DNA tetrahedron detection probes; (C) the linear fitting results of the number of targets and fluorescence intensity in Figure B;

[0052] Fig.10 : DNA tetrahedron probes were used to quantitatively analyze miRNAs in extracellular vesicles from different cell lines;

[0053] Among them, (A) is a total internal reflection fluorescence image of Dio-labeled extracellular vesicles after incubation with DNA tetrahedral probe (Cy5); the scale bar is 2μm; (B) statistical analysis of the co-localization ratio of miRNA and extracellular vesicles in Figure (A); (C) distribution of miRNA copy number in extracellular vesicles from different cell lines; (D) schematic diagram of the model with low occupancy and uneven distribution of miRNA in vesicles from different cell lines. DETAILED DESCRIPTION

[0054] The exemplary embodiments of the present disclosure will be described in more detail below with reference to the accompanying drawings. Although the exemplary embodiments of the present disclosure are shown in the accompanying drawings, it should be understood that the present disclosure can be implemented in various forms and should not be limited by the embodiments described herein. On the contrary, these embodiments are provided in order to enable a more thorough understanding of the present disclosure and to fully convey the scope of the present disclosure to those skilled in the art.

[0055] the term

[0056] As used herein, the term "DNA tetrahedron", also known as nucleic acid tetrahedron (tFNA) or DNA nano-pyramid structure, is a three-dimensional nanostructure self-assembled by a specially designed single-stranded DNA through the principle of base complementary pairing. Typically, a DNA tetrahedron is spontaneously assembled into a tetrahedral shape by single-stranded A through base complementary pairing, and the size is usually about 6-10nm.

[0057] As used herein, the term "molecular beacon" is a nucleic acid probe that can specifically bind to a target molecule and release a detectable signal (e.g., fluorescence). In some embodiments, a molecular beacon can be a fluorescently labeled oligonucleotide probe, which includes three parts: a loop region, which is composed of 15 to 30 nucleotides that can specifically bind to a target molecule and is the recognition site of the molecular beacon; a stem region, which is generally composed of 5 to 8 base pairs that can reversibly dissociate to form a hairpin structure; a fluorescent group and a quenching group, which are respectively marked at the two ends of the molecular beacon. When there is no target molecule, the fluorescent group and the quenching group are close to each other, and the fluorescence is quenched. After binding to the target molecule, the spatial configuration of the molecular beacon changes, resulting in fluorescence recovery. Those skilled in the art can design corresponding molecular beacons according to the sequence characteristics of the target.

[0058] As used herein, the term "total internal reflection fluorescence microscopy imaging" is a high-resolution imaging technique that utilizes the evanescent wave generated by total internal reflection to illuminate the sample and achieve direct detection of single fluorescent molecules. A commercially available total internal reflection fluorescence microscope (TIRFM) can be used for related imaging analysis, and the specific operation method can be referred to the accompanying instruction manual.

[0059] The following will list the embodiments of the present invention, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these embodiments are used to illustrate the present invention, rather than to limit the present invention.

[0060] Example 1

[0061] This example identifies and images miRNA in a single extracellular vesicle, and the specific steps include:

[0062] 1. Collection and purification of extracellular vesicles

[0063] To isolate extracellular vesicles from cell lines, when the cell confluence reached 70%, the culture medium was replaced with serum-free medium, and the cell supernatant was collected after 48 hours. The collected culture medium was centrifuged at 300g for 10 minutes, then at 2000g for 10 minutes, and finally at 10000g for 30 minutes. The supernatant was filtered through a 0.22μm filter membrane and concentrated with a 100k D ultrafiltration tube. The vesicle components were collected using a size exclusion chromatography column.

[0064] The size and shape of the collected extracellular vesicles were characterized by nanoparticle tracking analysis (NTA) and transmission electron microscopy (TEM). Western blotting analysis was performed for protein markers of extracellular vesicles. Figure 2 shown.

[0065] 2. Modification of the glass slide for vesicle capture

[0066] The coverslips were ultrasonically treated in ultrapure water, methanol, acetone, and 5 mol / L NaOH solution for 30 min. They were then immersed in a 3:1 mixture of H2SO4 and H2O2 at 75°C for 40 min and activated with 3-aminopropyltriethoxysilane (APTES, 5% v / v in 95% acetone for 20 min) and glutaraldehyde (GA, 1% v / v, 1×PBS, 1h). Subsequently, the extracellular vesicles prepared in step 1 were covalently fixed on the surface of the coverslip for 1h. Then, the remaining active groups were quenched with triethanolamine (Tris-ETHA, 0.1M Tris buffer and 50mM ethanolamine for 30min) and bovine serum albumin (BSA, 0.05% w / v, 1×PBS, 90min) to reduce nonspecific binding. At the same time, the following control was set up: the extracellular vesicles were directly fixed on the surface of the unmodified coverslip.

[0067] The vesicle signals on the glass slide were observed by labeling with Dio dye and imaging with total internal reflection fluorescence microscopy. Figure 3 As shown. The left picture is a total internal reflection fluorescence image of extracellular vesicles fixed on a cover glass without glutaraldehyde modification; the right picture is a total internal reflection fluorescence image of extracellular vesicles fixed on a cover glass modified as above. The above results show that unmodified glass slides cannot effectively capture extracellular vesicles.

[0068] 3. Sensitivity and specificity verification of tetrahedral probes

[0069] (1) Preparation of DNA tetrahedral probe. Single-stranded DNA (ssDNA) was slowly annealed (95°C to 4°C) in 1×TAE buffer to form a DNA tetrahedral structure, wherein the sequence of the molecular beacon is SEQ ID NO: 1 (GCGGCTCAACATCAGTCTGATAAGCTAGCCGC), with BHQ-3 and Cy5 modifications at both ends, respectively. The nucleotide sequence of the above single-stranded DNA is shown in Table 1, wherein S1 contains a molecular beacon, the underline shows the molecular beacon, and the bold font shows the sequence paired with the target miRNA. The synthesized DNA tetrahedral probe was subjected to gel electrophoresis analysis, and the results are shown in Table 1. Figure 4 shown.

[0070] Table 1

[0071]

[0072] (2) The synthetic target miRNA (miR-21-5p, whose sequence is SEQ ID NO: 6, TAGCTTATCAGACTGATGTTGA) and the target miRNA with a mismatch of 1-2 bp were incubated with the tetrahedral detection probe at room temperature for 1 hour, and the spectrum was detected and analyzed by fluorescence spectrometer. Figure 5 As shown, it can be seen that the tetrahedral probe provided in this embodiment can specifically bind to miR-21-5p and has excellent sensitivity and specificity.

[0073] 4. Detection of miRNA in vesicles using tetrahedral probes

[0074] (1) DNA tetrahedrons carrying Cy5 fluorescent dye (without molecular beacons paired with target miR-21-5p, the preparation method is the same as step 3, except that the sequence of S1 does not contain molecular beacons and S1 is modified with Cy5) were incubated with Dio-stained extracellular vesicles at room temperature for 3 h, and then captured on a glass slide modified in step 2 and imaged by total internal reflection fluorescence microscopy. The results are shown in Figure 2. Figure 6 As shown in (A), co-localization signals of Cy5 and Dio can be observed, indicating that the tetrahedral structure of DNA can enter the vesicle without destroying the structure of the vesicle, and its entry efficiency is about 70%.

[0075] (2) The DNA tetrahedron probe with molecular beacon carrying Cy5 fluorescent dye (i.e., the DNA tetrahedron probe prepared in step 3) was incubated with Dio-stained extracellular vesicles at room temperature for 3 h, and then captured on the glass slide modified in step 2 and imaged by total internal reflection fluorescence microscopy. The results are shown in Figure 2. Figure 6 As shown in (B), the target miRNA in the vesicles can be detected by observing the co-localization signals of Cy5 and Dio.

[0076] Example 2

[0077] refer to Figure 7 The principle diagram shown in the figure shows that this embodiment verifies that the method provided by the present invention can accurately quantify the copy number of miRNA in extracellular vesicles by drawing a standard curve. The specific steps include:

[0078] 1. Preparation of Liposomes

[0079] 100 μL of dioleoylphosphatidylcholine (DOPC) (10 mg / mL) was dissolved in 3 mL of CHCl3, and the solvent was removed by rotary evaporation to form a thin film. 3 mL of filtered PBS was added, hydrated at 4°C overnight, and ultrasonicated for 10 min.

[0080] 2. Synthesis of target DNA tetrahedron

[0081] The single-stranded DNA (ssDNA) was slowly annealed (95°C to 4°C) in 1×TAE buffer to form a DNA tetrahedron structure. Target DNA tetrahedrons with 1, 2, and 3 target molecules were synthesized. Synthesis with 1 target molecule was annealed using T-S1, T2, T3, and T4, synthesis with 2 target molecules was annealed using T-S1, T-S2, T3, and T4, synthesis with 3 target molecules was annealed using T-S1, T-S2, T-S3, and T4. The nucleotide sequence of the single-stranded DNA involved in this step is shown in Table 2, where the underline represents the target sequence.

[0082] Table 2

[0083]

[0084]

[0085] (3) Obtaining liposomes containing at most one target DNA tetrahedron

[0086] The target DNA tetrahedron and liposome were mixed at a ratio of 1:10. 7 After incubation with a ratio of , the free target DNA tetrahedrons were separated using a size exclusion chromatography column, and then the liposomes were uniformly monodispersed and dispersed on a glass slide. Then, total internal reflection fluorescence microscopy was used to image, and the ratio of photobleaching steps was counted to obtain liposomes containing at most one target DNA tetrahedron. The test results are as follows Figure 8 shown.

[0087] (4) Construction of a linear standard curve between miRNA fluorescence intensity and copy number

[0088] Liposomes containing target DNA tetrahedrons with known different target numbers were incubated with DNA tetrahedron detection probes and monodispersed onto GA-modified glass slides. Total internal reflection fluorescence microscopy was used to image the photobleaching step curve and fluorescence intensity distribution. The peak intensities of single liposomes containing 1 to 3 target molecules were fitted to be 95.99, 197.01, and 293.49, respectively, with the target copy number as the horizontal axis and the fluorescence intensity as the vertical axis. Detection and fitting results can be found in Fig. 9 shown.

[0089] The above standard curve shows that there is a linear relationship between the target copy number and the fluorescence intensity. According to the method provided by the present invention, the copy number of the target molecule can be accurately identified by detecting the fluorescence intensity.

[0090] Example 3

[0091] This example detects the miRNA copy number of extracellular vesicles based on Example 2. The specific steps include:

[0092] The DNA tetrahedron probe with molecular beacon prepared in Example 1 was incubated with Dio-stained extracellular vesicles at room temperature for 3 h, and then captured on a modified glass slide and imaged by total internal reflection fluorescence microscopy. The results are as follows: Fig.10 As shown in (A), the co-localization signals of Cy5 and Dio can be observed, and the fluorescence intensity and co-localization ratio of the miRNA signal are statistically analyzed. Fig.10 (B) shown.

[0093] The standard curve obtained in Example 2 was then used to calculate the copy number of miRNA in the extracellular vesicles. The copy number calculation results of miR-21-5p in different cell lines are as follows: Fig.10 (C) is shown. Then, a copy number distribution model of miRNA in extracellular vesicles was established, and the results are shown in Fig.10 As shown in (D), it can be found that the miRNA occupancy in extracellular vesicles of different cell lines is low and the distribution is uneven.

[0094] The above is only a preferred specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any changes or substitutions that can be easily thought of by a person skilled in the art within the technical scope disclosed by the present invention should be included in the protection scope of the present invention. Therefore, the protection scope of the present invention shall be based on the protection scope of the claims.

Claims

1. A DNA tetrahedron probe, characterized in that: The DNA tetrahedron probe comprises a DNA tetrahedron and a molecular beacon connected thereto; The molecular beacon can specifically bind to a target miRNA and release a detectable signal after binding to the target miRNA.

2. The DNA tetrahedron probe according to claim 1, characterized in that The molecular beacon includes a fluorescent molecular beacon, wherein the 5' end and the 3' end are connected to a fluorescent group and a quenching group respectively; Preferably, the fluorescent group is selected from at least one of FAM, HEX, TAMRA, Cy3, and Cy5; the quenching group is selected from at least one of BHQ and Dabcyl; Preferably, the nucleotide sequence of the molecular beacon is SEQ ID NO:

1.

3. The DNA tetrahedron probe according to claim 1 or 2, characterized in that: The DNA tetrahedron probe is obtained by self-assembly of a single-stranded DNA having the following nucleotide sequence: SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO:

5.

4. A method for quantifying the copy number of a target miRNA in an extracellular vesicle, characterized in that: include, Providing a DNA tetrahedron probe, the DNA tetrahedron probe comprising a DNA tetrahedron and a molecular beacon connected thereto; the molecular beacon specifically binds to the target miRNA and releases a detectable signal after binding to the target miRNA; Co-incubating the extracellular vesicles with the DNA tetrahedron probe, and detecting the signal intensity of the extracellular vesicles after co-incubation; The copy number of the target miRNA in the extracellular vesicles is calculated according to the signal intensity.

5. The method according to claim 4, characterized in that The detectable signal comprises fluorescence; the fluorescence is detected by single molecule fluorescence imaging; Preferably, the single-molecule fluorescence imaging comprises total internal reflection fluorescence microscopy imaging.

6. The method according to claim 4, characterized in that The co-incubation conditions include 20-35° C., 1-4 h.

7. The method according to claim 4, characterized in that Before detecting the signal of the extracellular vesicles after co-incubation, the method further includes the following steps: capturing the extracellular vesicles after co-incubation on a carrier; Preferably, the carrier comprises a glass sheet; Preferably, the glass sheet is pretreated with glutaraldehyde; the glutaraldehyde pretreatment step comprises: ultrasonically treating the glass sheet in ultrapure water, methanol, acetone and sodium hydroxide aqueous solution in sequence, then immersing the glass sheet in a mixed solution of sulfuric acid and hydrogen peroxide, and then activating the glass sheet with 3-aminopropyltriethoxysilane and glutaraldehyde.

8. The method according to claim 4, characterized in that The method for quantifying the copy number of target miRNA in extracellular vesicles also includes drawing a standard curve, which includes: Extracellular vesicles containing known copy numbers of different target miRNAs are provided as standards; The standard is co-incubated with the DNA tetrahedron probe, and then the co-incubated standard is subjected to photobleaching analysis and signal detection, and the photobleaching step curve and signal intensity distribution are statistically analyzed, and then the linear relationship between the target miRNA copy number and the signal intensity is obtained by fitting.

9. The method according to claim 8, characterized in that The copy number of the target miRNA in the extracellular vesicles is calculated according to the signal intensity using the standard curve.

10. The method according to claim 4, characterized in that The molecular beacon includes a fluorescent molecular beacon, the 5' end and the 3' end of which are connected to a fluorescent group and a quenching group respectively; Preferably, the fluorescent group is selected from at least one of FAM, HEX, TAMRA, Cy3, and Cy5; the quenching group is selected from at least one of BHQ and Dabcyl; Preferably, the nucleotide sequence of the molecular beacon is SEQ ID NO: 1; Preferably, the DNA tetrahedron probe is obtained by self-assembly of single-stranded DNA having the following nucleotide sequences: SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5.

Images