IQUB gene molecular marker related to sizes of testis and epididymis of Hu sheep and application of IQUB gene molecular marker

Abstract

The invention discloses an IQUB gene molecular marker related to the sizes of Hu sheep testis and epididymis and application of the molecular marker. The molecular marker is obtained by amplifying an IQUB gene sequence through a designed specific primer, the nucleotide sequence of the molecular marker is shown as SEQ ID NO.1 in a sequence table, the 147bp position of the SEQ ID NO.1 in the sequence table has base mutation of A / C, and the mutation causes Mlu I-RFLP enzyme digestion polymorphism. By analyzing the correlation between Hu sheep IQUB genotyping and testis and epididymis sizes, the result shows that genotypes of Hu sheep individuals are divided into an AA genotype, an AC genotype and a CC genotype, and the testis weight and epididymis total weight of the AC genotype individuals are obviously higher than those of the AA genotype individuals and those of the CC genotype individuals. The molecular marker is used for Hu sheep seed selection, the accuracy is high, Hu sheep individuals with high reproductive capacity can be screened out when hu sheep rams are young, early breeding of the Hu sheep variety is achieved, and therefore the breeding process is accelerated.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology and specifically relates to a method for determining the size of testicles and epididymis of Hu sheep. IQUB Genetic molecular markers and their applications. Background Art

[0002] Hu sheep is a unique lamb sheep breed in China, with delicious meat and high reproduction rate. The development and protection of its excellent traits are crucial to the sustainable development of my country's mutton sheep industry. However, some unplanned hybridization behaviors are gradually changing the genetic characteristics of Hu sheep, posing a threat to its long-term development. In this context, purposeful protection and improvement of Hu sheep's reproductive capacity, especially male reproductive capacity, has become the focus of Hu sheep research and practice.

[0003] Male fertility is a complex polygenic trait that is affected by multiple gene loci and environmental factors. In large-scale sheep farms, the fertility of rams is directly related to the production level and economic benefits of the entire flock. Therefore, improving the utilization rate and coverage of excellent breeding rams is of great significance to improving the overall production level. Semen quality is an important indicator for measuring the fertility of breeding rams, but the evaluation of this indicator is complicated and easily affected by many factors, such as age, nutritional level, season, etc. This makes it quite difficult to objectively and accurately evaluate semen quality. In contrast, the size of testicles and epididymis is a simple, easy-to-measure and highly heritable indicator. It is significantly positively correlated with reproductive performance parameters such as ejaculation volume, sperm density, and sperm motility, and is significantly negatively correlated with sperm deformity rate. It is also closely related to growth performance and conception rate of inseminated females. Therefore, the size of testicles and epididymis can be used as an important selection indicator for the fertility of genetically improved males and offspring females. In breeding practice, traditional breeding methods are often time-consuming and inefficient. As an advanced breeding method, molecular marker-assisted selection can significantly improve the accuracy of trait selection, reduce breeding costs, and improve breeding efficiency. However, the candidate genes and molecular markers related to the size of testicles and epididymis of livestock are still very limited.

[0004] IQ and ubiquitin-like domain-containing protein (IQUB) was first isolated from a rat cryptorchid model. The protein it encodes mainly contains two domains, namely the IQ motif and the ubiquitin-like domain, and its expression is spermatogenic cell specific. Studies have found that IQUB can affect sperm flagella formation by inhibiting the activity of RSPH3 and p-ERK1 / 2. Mice with IQUB knockout gene (Zhang ZH et al., 2023) and nonsense mutations on homozygous IQUB gene (Tu T et al., 2025) can cause abnormal sperm motility, resulting in male infertility in mice and humans. Therefore, it can be considered that there is a correlation between the IQUB gene and the fertility of males. However, no relevant research on IQUB in Hu sheep or even sheep fertility has been reported. Summary of the invention

[0005] The purpose of the present invention is to provide a method for measuring the size of Hu sheep testicles and epididymis. IQUB Genetic molecular markers provide a molecular marker for auxiliary selection for the detection of the size of the testicles and epididymis of Hu sheep, improve the accuracy of selection, make early breeding of Hu sheep varieties possible, and accelerate the breeding process.

[0006] The objective of the present invention is achieved through the following technical solutions: The present invention provides a method for determining the size of Hu sheep testicles and epididymis. IQUB Gene molecular markers, the molecular markers are based on chromosome 4 of the Hu sheep reference genome ARS-UI_Ramb_v3.0 version IQUB The gene sequence was amplified by the designed specific primers, and its nucleotide sequence was shown in SEQ ID NO.1. At 147 bp of the sequence SEQ ID NO.1, r indicated an A / C base mutation, which resulted in Mlu Ⅰ-RFLP restriction enzyme polymorphism.

[0007] The primer pairs for amplifying the above molecular markers are as follows: Forward primer F: CACTTTAGGATTCATTGATTTTCCT; Reverse primer R: CTGAGTGACCAGAGCGTTTC.

[0008] The testicle size and epididymis size of Hu sheep are the total weight of testicles and the total weight of epididymis respectively.

[0009] Using the above data related to the size of Hu sheep testicles and epididymis IQUB Genetic molecular markers can be used in molecular marker-assisted selection of Hu sheep, especially in molecular marker-assisted selection of Hu sheep rams with well-developed testicles.

[0010] The present invention collects testicular tissue of Hu sheep rams to extract genomic DNA, designs specific primer pairs to perform PCR amplification on the Hu sheep genome, and uses the MluⅠ-RFLP method to perform PCR amplification on the Hu sheep genome. IQUB Gene SNP loci were genotyped and Hu sheep were analyzed IQUB The association between genotyping and the size of testicles and epididymis. The results showed that the genes of Hu sheep individuals were divided into AA genotype, AC genotype and CC genotype, among which the total testicular weight and total epididymal weight of AC genotype individuals were significantly higher than those of AA genotype and CC genotype individuals. Therefore, AC genotype individuals can be selected in the early selection of Hu sheep rams, so as to achieve the early selection of Hu sheep rams with better testicular development.

[0011] By using the molecular markers provided by the present invention to carry out molecular marker-assisted selection, it is only necessary to detect the characteristic amplification bands of the molecular markers to predict the testicular development of young Hu sheep rams in adulthood. This method is simple and feasible, with high selection efficiency. Hu sheep individuals with better testicular development can be selected when they are young. The selection target is clear and is not affected by the growth environment, so that the early breeding of Hu sheep varieties can be achieved, which accelerates the breeding process. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 It is the lake sheep of the present invention IQUB Partial gene sequencing results and SNP sites; Figure 2 The present invention is the lake sheep IQUB Electrophoresis results of gene PCR amplification products. The agarose concentration is 1.5%. The markings in the figure are as follows: Lane M is BioGold 2000 DNA Marker (including 6 band types of 100 bp, 250 bp, 500 bp, 750 bp, 1000 bp and 2000 bp); Figure 3 The present invention is the lake sheep IQUB Gene MluⅠ-RFLP test results. The agarose concentration is 2%, and the reference marks in the figure are the same Figure 2 As shown in the figure; the fragment size of AA genotype is 443 bp, the fragment sizes of CC genotype are 146 bp and 297 bp respectively; the fragment sizes of AC genotype are 146 bp, 297bp and 443 bp respectively. DETAILED DESCRIPTION

[0013] The following embodiments are further explanations of the present invention, but are not to be construed as limitations of the present invention. Without departing from the spirit and substance of the present invention, any modification or replacement of the present invention shall fall within the scope of protection of the present invention.

[0014] The 6-month-old Hu sheep ram sample of the present invention was collected from Minqin County Defu Agricultural Biotechnology Co., Ltd.

[0015] 1. Collection of Hu sheep testicular tissue The left testicular tissue of the above-mentioned Huyang ram was obtained and stored in liquid nitrogen for RNA and DNA extraction.

[0016] 2. Testicular RNA Extraction (1) Grind the testicular tissue block into powder in liquid nitrogen; (2) Transfer 100 mg of testicular tissue powder to a 1.5 mL centrifuge tube and add 1 mL of Trizol to fully lyse for 5 min; (3) Add 200 μL of chloroform, cover the centrifuge tube, oscillate for 15 seconds, and leave at room temperature for 10 minutes; (4) Centrifuge at 12,000 rpm for 10 min at 4°C. Transfer the supernatant to another new centrifuge tube and add 0.5 mL of isoamyl alcohol. Mix well and place at room temperature for 5-10 min. (5) Centrifuge the new centrifuge tube at 12,000 r / min for 10 minutes at 4°C, discard the supernatant, add 1 mL of 75% ethanol to suspend the precipitate, and continue centrifuging at 12,000 r / min at 4°C for 5 minutes, then discard the ethanol and place in the air for 5-10 minutes to obtain RNA precipitate; (6) Dissolve the RNA precipitate in 50 μL of RNase-free water (DEPC), measure the concentration using a spectrophotometer, and store at -80°C.

[0017] 3. Reverse transcription reaction According to the instructions of the EasyScript One-Step gDNA Removal and cDNA Synthesis SuperMix Kit, the extracted RNA was diluted to the same concentration (1 μg / μL), and 1 μL of RNA dilution was transferred to a new PCR tube. 1 μL Anchored Oligo (dT) Primer, 10 μL 2×ES Reaction Mix, 1 μL EasyScript RT / RI Enzyme Mix, 1 μL gDNA Remover, and 6 μL RNase-free Water were added to the PCR tube to a total volume of 20 μL, and gently mixed. The reverse transcription reaction was performed using a PCR instrument under the following conditions: incubation at 42°C for 15 min, heating at 85°C for 5 s to inactivate EasyScript RT / RI Enzyme Mix and gDNA Remover. The cDNA generated by reverse transcription was diluted to 20 ng / μL and stored at -80°C.

[0018] 4. Polymerase chain reaction (PCR) According to the Huyang provided by NCBI IQUB The mRNA sequence of the gene (XM_042248759.1) was designed using the Primer-BLAST tool. Four pairs of primers (P1-P4, as shown in Table 1) were used to amplify the mRNA sequence of the gene. Specifically, the cDNA of 50 Hu sheep ram individuals was mixed (every 10 Hu sheep individuals were one mixed pool), and the mixed pool cDNA was used as a template to PCR amplify the target fragment. The total PCR amplification reaction system was 20 μL: 4 μL of cDNA template (20 ng / μL), 10 μL of 2×Easy Taq PCR SuperMIX (TransGen), 0.5 μL of the above forward primer and reverse primer (10 μM), and ddH2O was added to 20 μL. PCR amplification reaction conditions: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 60.2°C for 30 s, extension at 72°C for 40 s, 34 cycles; final extension at 72°C for 5 min; storage at 4°C to obtain PCR products, which were then detected by electrophoresis using 1% agarose gel.

[0019] 5. IQUB Gene single nucleotide polymorphism screening The PCR products obtained above were sequenced. After sequencing comparison, it was found that the PCR product amplified by the P1 primer had an A / C base mutation. This mutation produced a restriction endonuclease MluⅠ restriction site (A↓[C / A]GCGT) single nucleotide polymorphism (SNP). The results of the sequencing peak diagram are as follows: Figure 1 shown.

[0020] 6. Genomic DNA Extraction (1) Grind the testicular tissue block into powder in liquid nitrogen; (2) Transfer 20 mg of testicular tissue powder to a 1.5 mL centrifuge tube, add 200 μL of tissue lysis buffer GA, and shake until thoroughly suspended; (3) Add 20 µL of proteinase K solution, mix the tissue solution, and digest in a 56°C water bath for 30 min until the cell pellet is completely digested. Centrifuge briefly to remove water droplets on the inner wall of the tube cap before proceeding to the next step. (4) Add 200 μL of buffer GB, mix thoroughly by inversion, incubate at 70°C for 10 min, and centrifuge briefly to remove water droplets on the inner wall of the tube cap; (5) Add 200 μL of anhydrous ethanol and vortex thoroughly for 15 seconds. Flocculent precipitation may appear at this time. Centrifuge briefly to remove water droplets on the inner wall of the tube cap. (6) Add the solution and flocculent precipitate obtained in the previous step to an adsorption column (place the adsorption column in a collection tube), centrifuge at 12,000 rpm for 30 sec, pour out the waste liquid, and place the adsorption column back into the collection tube.

[0021] (7) Add 500 μL of buffer GD to the adsorption column, centrifuge at 12,000 rpm for 30 sec, discard the waste liquid, and place the adsorption column in a collection tube.

[0022] (8) Add 600 μL of rinse solution PW to the adsorption column, centrifuge at 12,000 rpm for 30 sec, discard the waste liquid, and place the adsorption column in a collection tube.

[0023] (9) Repeat step 7.

[0024] (10) Place the adsorption column back into the collection tube, centrifuge at 12,000 rpm for 2 min, and discard the waste liquid. Leave the adsorption column at room temperature for several minutes to completely dry the residual rinse liquid in the adsorption material.

[0025] (11) Transfer the adsorption column into a clean centrifuge tube, add 100 μL of elution buffer TE to the middle of the adsorption membrane, leave it at room temperature for 2-5 min, centrifuge it at 12,000 rpm for 2 min, and collect the solution into the centrifuge tube to obtain the DNA solution.

[0026] 7. Restriction fragment polymorphism (RFLP) test according to IQUB DNA sequence (Gene Bank ID: 101105744) A pair of specific primers P5 were designed near the mutation site found above. The target fragment was amplified by PCR using the genomic DNA of Hu sheep extracted in step 6 as a template. The sequence of primer P5 is shown in Table 1. The PCR reaction amplification system was 20 μL. The reaction conditions were: 2×Easy Taq PCR Super MIX (TransGen) 10 μL, DNA template 4 μL, 0.5 μL of the forward primer and reverse primer mentioned above, and 5 μL of ddH2O. PCR amplification conditions: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 61℃ annealing for 30 s, 72℃ extension for 30 s, a total of 34 cycles; 72℃ extension for 5 min. PCR products were detected by 1.5% agarose gel electrophoresis.

[0027] Table 1 Hu sheep IQUB Gene PCR primer sequences

[0028] The DNA sequence amplified by the primer pair P5 is shown in the sequence table SEQ ID NO.1, and there is an A / C single nucleotide polymorphism (SNP) at 147 bp of the sequence. IQUB The gene SNP site was genotyped, and the enzyme digestion reaction system was 15 μL: 8 μL of PCR product, 0.5 μL of restriction endonuclease (MluⅠ), 1.5 μL of 10× buffer, and 5 μL of ddH2O. The sample was mixed and centrifuged, and incubated at 37℃ for 1 h.

[0029] Take 5 μL of the digested product and run it through 2% agarose gel electrophoresis, then perform genotyping and identification. Figure 2 As shown. The size of this amplified fragment is 443 bp, and the polymorphic site is located at 147 bp of the fragment. When the variable site is C base, a restriction endonuclease MluⅠ restriction site (A↓[C / A]GCGT) will be generated. After MluⅠ digests the PCR product, two bands with sizes of 146 bp and 297 bp will be generated, and its genotype is CC type; when the site is A base, no MluⅠ restriction enzyme site can be generated. After MluⅠ digests the PCR product, it is still a 443 bp band, and its genotype is AA type; when the site is A / C heterozygous, due to the presence of A and C bases at the same time, MluⅠ digests the PCR product to produce three bands with sizes of 443 bp, 146 bp and 297 bp, and its genotype is AC type.

[0030] 8. Hu Sheep IQUB Association analysis between genotype and testicular traits The experiment detected the polymorphism of 255 Hu sheep. The genotype test results showed that among the 255 Hu sheep individuals, 96 had AA genotype, 148 had AC genotype, and 11 had CC genotype. IQUB The genotype frequency distribution of the single nucleotide polymorphism on the gene was analyzed, and the association analysis between genotype and phenotype was performed using SPSS 25.0 software. If the data met the normality test, one-way ANOVA was used for analysis, otherwise nonparametric tests were used. All values ​​were reported as mean ± standard error, and P < 0.05 was considered statistically significant. The analysis results are shown in Table 2.

[0031] Table 2 IQUB Correlation between different genotypes of genes and testicular traits

[0032] The results in Table 2 show that the total testicular weight of Hu sheep AC genotype individuals is extremely significantly higher than that of AA and CC genotype individuals, and the total epididymis weight is significantly higher than that of AA and CC genotype individuals. Therefore, AC genotype individuals can be selected in the early selection of Hu sheep rams, thereby realizing the early selection and breeding of Hu sheep rams with better testicular development.

Claims

1. A study on the size of Huyang sheep testicles and epididymis IQUB Gene molecular markers, characterized in that The molecular marker IQUB The gene sequence was amplified by the designed specific primers, and its nucleotide sequence was shown in SEQ ID NO.

1. At 147 bp of the sequence SEQ ID NO.1, r indicated an A / C base mutation, which resulted in Mlu Ⅰ-RFLP restriction enzyme polymorphism.

2. A method for determining the size of Hu sheep testicles and epididymis as claimed in claim 1. IQUB Gene molecular markers, characterized in that Said IQUB The gene sequence comes from chromosome 4 of the Hu sheep reference genome ARS-UI_Ramb_v3.0 version.

3. A method for determining the size of Hu sheep testicles and epididymis as claimed in claim 2. IQUB Gene molecular markers, characterized in that The primer pairs for amplifying the molecular markers are as follows: Forward primer F: CACTTTAGGATTCATTGATTTTCCT; Reverse primer R: CTGAGTGACCAGAGCGTTTC.

4. A method for determining the size of Hu sheep testicles and epididymis as claimed in claim 3. IQUB Gene molecular markers, characterized in that The testicle size and epididymis size of Hu sheep are the total weight of testicles and the total weight of epididymis respectively.

5. A method for determining the size of Hu sheep testicles and epididymis as described in any one of claims 1 to 4. IQUB Application of gene molecular markers in molecular marker-assisted selection of Hu sheep.

6. The method for determining the size of Hu sheep testicles and epididymis as claimed in claim 5 IQUB The application of gene molecular markers in molecular marker-assisted selection of Hu sheep is characterized by: Said IQUB Gene molecular markers can be used for molecular marker-assisted selection of Hu sheep rams with better testicular development.

Images