Application of specific DNA (Deoxyribose Nucleic Acid) molecule in identifying genuine dendrobium quality and identifying method

Abstract

The invention provides application of a specific DNA (deoxyribonucleic acid) molecule in identifying the genuine dendrobium quality. The specific DNA molecule comprises a sequence as shown in SEQ ID NO. 1. According to the epigenetics principle, the environment-related molecular marker is found in dendrobium growing in different environments, the marker is used for fluorescent quantitative PCR, the growth environment of a dendrobium material can be distinguished within one day, steps are simplified, operation is easy, cost is controllable, and an objective qualitative detection method is provided for dendrobium genuine ground quality.

Description

Technical Field

[0001] The invention relates to the fields of molecular biology and genetic engineering, and in particular to an application of a specific DNA molecule in identifying the authentic quality of dendrobium and an identification method. Background Art

[0002] Dendrobium huoshanense (CZ Tang et SJ Cheng), also known as rice dendrobium, is a perennial herb of the genus Dendrobium in the Orchidaceae family. It has the effects of strengthening yin and body fluid, nourishing the kidney and improving strength, improving eyesight and prolonging life. Relevant studies have shown that the main chemical components of Huoshan Dendrobium are alkaloids, polysaccharides, flavonoids and amino acids, which can be anti-viral, anti-tumor, anti-oxidant, lower blood sugar and regulate immunity.

[0003] The cultivation of Huoshan Dendrobium is mainly divided into two modes: greenhouse cultivation and simulated wild cultivation. Greenhouse cultivation is usually carried out in greenhouse facilities. This method has a high survival rate and a fast growth rate, but it will affect the authentic quality of Dendrobium. Simulated wild cultivation simulates the natural growth environment of Dendrobium, usually carried out under the forest or on rocks. This method is closer to the natural growth conditions of Dendrobium and helps to maintain its authentic quality, but the growth rate is slower and the management is more difficult. The Huoshan Dendrobium obtained by different cultivation methods is difficult to recognize in appearance, but there is a clear difference in their authentic quality.

[0004] Therefore, it is of great significance to establish a standardized quality standard system for Huoshan Dendrobium products to provide a theoretical basis for the quality-based use of Huoshan Dendrobium, high-quality products at high prices and scientific management, regulate the market and promote the healthy development of Huoshan Dendrobium. Summary of the invention

[0005] In view of this, in order to at least partially solve at least one of the above-mentioned technical problems, the present invention provides an application of a specific DNA molecule in identifying the authentic quality of Dendrobium and an identification method.

[0006] According to an embodiment of one aspect of the present invention, there is provided an application of a specific DNA molecule in identifying the authentic quality of Dendrobium officinale, wherein:

[0007] The specific DNA molecule includes the sequence shown in SEQ ID NO.1.

[0008] According to an embodiment of the present invention, the authentic quality includes superior authentic quality Dendrobium grown under simulated wild cultivation conditions and inferior authentic quality Dendrobium grown under non-simulated wild cultivation conditions.

[0009] According to an embodiment of the present invention, the dendrobium is Dendrobium huoshanense;

[0010] The specific DNA molecule related to the authentic quality of Huoshan Dendrobium is the upstream promoter region 42078801~42089000bp located at the serine kinase coding site on chromosome 9 of Huoshan Dendrobium.

[0011] According to an embodiment of the present invention, identifying the authentic quality of Dendrobium officinale includes identifying the quality of fresh strips, dried strips, pods or powder of Dendrobium officinale.

[0012] According to another embodiment of the present invention, a primer for identifying the authentic quality of Dendrobium officinale is provided, wherein:

[0013] The identification primers include a forward and a reverse primer pair;

[0014] The nucleotide sequence of the forward primer is shown in SEQ ID No.2, and the nucleotide sequence of the reverse primer is shown in SEQ ID No.3.

[0015] According to another embodiment of the present invention, a molecular identification method for the authentic quality of Dendrobium officinale is provided, comprising:

[0016] Extract RNA from the tested Dendrobium and remove genomic DNA;

[0017] Reverse transcription of RNA was performed to obtain cDNA;

[0018] By using the fluorescent quantitative PCR method, cDNA was used as a template, the 18S locus was used as an internal reference gene, and the primers shown in SEQ ID No. 2 and SEQ ID No. 3 were used for amplification to obtain a fluorescent signal;

[0019] The authenticity of the tested Dendrobium is determined based on the fluorescence signal.

[0020] According to an embodiment of the present invention, when the ΔCt value obtained according to the fluorescence signal is below the first preset value, it is determined that the Dendrobium to be tested is a Dendrobium of superior quality grown under simulated wild cultivation conditions;

[0021] When the ΔCt value obtained according to the fluorescence signal is greater than the second preset value, it is determined that the Dendrobium to be tested is a non-wild-cultivated Dendrobium of Huoshanense of secondary authentic quality.

[0022] Preferably, when the 18S locus is used as the internal reference gene, the first preset value is 15.5 and the second preset value is 16.

[0023] According to an embodiment of the present invention, the variety of Dendrobium to be tested is Dendrobium huoshanense, other Dendrobium, or a hybrid of Dendrobium huoshanense and other Dendrobium; other Dendrobium is any one of the following: Dendrobium officinale, Dendrobium huangshanense, Dendrobium slender-stemmed, Dendrobium henanense, Dendrobium chrysantha, Dendrobium chinense, Dendrobium dentata, Dendrobium roheense, Dendrobium meihuaensis, Dendrobium sparse-flowered and Dendrobium cup sheath.

[0024] According to another embodiment of the present invention, there is provided an identification kit, comprising primers shown in SEQ ID No. 2 and SEQ ID No. 3, and the identification kit is used for identifying the authentic quality of Dendrobium officinale.

[0025] According to an embodiment of the present invention, the identification kit further includes a fluorescent dye, a DNA polymerase, and dNTP.

[0026] According to an embodiment of the present invention, based on the principle of epigenetics, environment-related molecular markers were found in Dendrobium grown in different environments. Fluorescence quantitative PCR was performed using the markers, and the growth environment of the Dendrobium material can be distinguished within one day. The steps are streamlined, easy to operate, and cost-controlled, providing an objective and qualitative detection method for the authenticity quality of Dendrobium. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] The above and other objects, features and advantages of the present invention will become more apparent through the following description of the embodiments of the present invention with reference to the accompanying drawings, in which:

[0028] Figure 1 This is a comparison chart of the results of fluorescent quantitative PCR detection of the authentic quality of Huoshan Dendrobium in the embodiments of the present invention. DETAILED DESCRIPTION

[0029] Below, embodiments of the present invention will be described with reference to the accompanying drawings. However, it should be understood that these descriptions are exemplary only and are not intended to limit the scope of the present invention. In the following detailed description, for ease of explanation, many specific details are set forth to provide a comprehensive understanding of embodiments of the present invention. However, it is apparent that one or more embodiments may also be implemented without these specific details. In addition, in the following description, descriptions of known structures and technologies are omitted to avoid unnecessary confusion of concepts of the present invention.

[0030] The terms used herein are only for describing specific embodiments and are not intended to limit the present invention. The term "comprising" used herein indicates the existence of features, steps, operations, but does not exclude the existence or addition of one or more other features.

[0031] In the case of using expressions such as "at least one of A, B, and C, etc.", it should generally be interpreted in accordance with the meaning of the expression generally understood by those skilled in the art (for example, "a system having at least one of A, B, and C" should include but is not limited to a system having A alone, B alone, C alone, A and B, A and C, B and C, and / or A, B, C, etc.). In the case of using expressions such as "at least one of A, B, or C, etc.", it should generally be interpreted in accordance with the meaning of the expression generally understood by those skilled in the art (for example, "a system having at least one of A, B, or C" should include but is not limited to a system having A alone, B alone, C alone, A and B, A and C, B and C, and / or A, B, C, etc.).

[0032] In the process of realizing the concept of the present invention, it was found that 15 local standards have been formed for the relevant quality detection methods of Huoshan Dendrobium, including morphological identification and molecular identification of Huoshan Dendrobium. Among them, "DB34 / T 486-2016 Huoshan Dendrobium" describes the plant morphology of Huoshan Dendrobium in detail, and "DB34 / T 2938-2017 Huoshan Dendrobium Maple Bean Quality Inspection Technical Regulations" provides detailed provisions for the sensory indicators, physical and chemical indicators, etc. of Huoshan Dendrobium Maple Bean. "DB34 / T 3244~2018 Huoshan Dendrobium Molecular Identification Technical Regulations" uses molecular means to identify Huoshan Dendrobium, which can be used for qualitative molecular identification between Huoshan Dendrobium and Henan Dendrobium, Slender Stem Dendrobium, Officinale Dendrobium, and Nobile Dendrobium. This method uses three pairs of primers to identify the species of Dendrobium Huoshanense, of which primers TY2s and TY2a are used to detect the quality of the template, and CP2s and CP2a are specific primers to amplify Dendrobium Huoshanense, but Dendrobium slender stem can also be amplified. The PCR fragments amplified by HuoS and HuoA are sequenced, and the one with G at position 56 is Dendrobium Huoshanense. The 2020 edition of the Chinese Pharmacopoeia includes Dendrobium Huoshanense for the first time. PCR-RFLP technology is used to identify Dendrobium Huoshanense. The sample DNA template is amplified using identification primers, and the PCR product is added with Alu I endonuclease and digested at 37°C for 30 minutes. A standard Dendrobium Huoshanense reference substance and sterile ultrapure water are taken as positive control and blank control, respectively. The digestion product is subjected to agarose gel electrophoresis, and the electrophoresis results are inspected by a gel imager. In the gel electrophoresis pattern of Huoshan Dendrobium, there should be a single DNA band at about 100~200bp at the corresponding position of the gel electrophoresis pattern of the control medicinal material, and the band positions of the PCR product and the enzyme-cut product are consistent, and the blank control has no band. In addition to the technologies used in the above two standards, the molecular marker technology for Dendrobium identification also includes random amplified polymorphic DNA (RAPD) technology, sequence-related amplified polymorphism (SRAP) technology, simple sequence repeat (SSR) technology, target start codon polymorphism (SCoT) and gene chips. The purpose of identification can also be achieved by using matK, rbcL, rpoC of the chloroplast genome of Dendrobium and the introns of the nad1 gene of the mitochondria.

[0033] The research on molecular identification methods of the 2020 edition of the Chinese Pharmacopoeia and molecular technologies such as RAPD, SRAP, and SSR can distinguish Huoshan Dendrobium from other varieties of Dendrobium, but cannot be associated with the growth environment of Huoshan Dendrobium. Therefore, the above-mentioned related molecular identification methods cannot provide information related to the growth environment of Huoshan Dendrobium. The present invention provides an objective, rapid and effective authentic quality identification method, which is of great significance to the development of the Dendrobium industry.

[0034] Specifically, according to an embodiment of one aspect of the present invention, there is provided an application of a specific DNA molecule in identifying the authentic quality of Dendrobium officinale, wherein:

[0035] The specific DNA molecule includes the sequence shown in SEQ ID NO.1.

[0036] The sequence shown in SEQ ID NO.1 is:

[0037]

[0038] According to an embodiment of the present invention, based on the principle of epigenetics, environment-related molecular markers were found in Dendrobium grown in different environments. Fluorescence quantitative PCR was performed using the markers, and the growth environment of the Dendrobium material can be distinguished within one day. The steps are streamlined, easy to operate, and cost-controlled, providing an objective and qualitative detection method for the authenticity quality of Dendrobium.

[0039] According to an embodiment of the present invention, the authentic quality includes superior authentic quality Dendrobium grown under simulated wild cultivation conditions and inferior authentic quality Dendrobium grown under non-simulated wild cultivation conditions.

[0040] According to the embodiments of the present invention, Dendrobium uses "air roots" to fix free nitrogen in the air and absorb nutrients. It will rot when buried in the soil and is not resistant to waterlogging. It needs to grow in stone walls, gravel and rock cracks. Simulated wild cultivation completely simulates the wild ecological environment of medicinal materials, without pesticides, fertilizers, excessive human intervention, and only selectively removes a certain proportion of weeds instead of all. Under simulated wild cultivation conditions, light intensity, light time, day and night temperature difference, air humidity, seasonal changes, air composition and other conditions are completely consistent with wild ones.

[0041] Furthermore, the simulated wild planting method has a significant positive impact on the quality of Dendrobium. The simulated wild planting Dendrobium is closer to the wild type in appearance, has a higher content of main medicinal ingredients, high economic benefits and better efficacy. Dendrobium grown by non-simulated wild planting methods or greenhouse planting methods has significant differences in alcohol-soluble extracts, polyphenols and flavonoids compared with pure wild Dendrobium officinale, and its benefits and quality are poor. Distinguishing the authentic quality of simulated wild planting and greenhouse planting Dendrobium is of great significance for ensuring the quality of medicinal materials, improving economic benefits, protecting the ecological environment and meeting consumer needs.

[0042] According to an embodiment of the present invention, the Dendrobium is Dendrobium huoshanense; the specific DNA molecule associated with the authentic quality of Dendrobium huoshanense is 42078801-42089000bp of the upstream promoter region located at the serine kinase coding site on chromosome 9 of Dendrobium huoshanense.

[0043] According to an embodiment of the present invention, the genome data of Dendrobium huoshanense has been assembled and published in NCBI, numbered GCA_016618105.1, and the genome analysis of the present invention is based on this genome. The specific DNA molecule is located in the upstream promoter region 42078801~42089000bp of the serine kinase coding site on chromosome 9 of Dendrobium huoshanense, marked as site 8801.

[0044] According to an embodiment of the present invention, identifying the authentic quality of Dendrobium officinale includes identifying fresh strips, dried strips, pods or powder of Dendrobium officinale.

[0045] According to the embodiments of the present invention, because the authenticity quality of Dendrobium is identified through specific DNA molecules, it is not limited by the morphological characteristics and developmental stages of the species, and its authenticity quality can be identified efficiently and accurately.

[0046] According to an embodiment of another aspect of the present invention, there is provided an identification primer for the authentic quality of Dendrobium officinale, the identification primer comprising a forward primer pair and a reverse primer pair, the target sequence of the primer pair being shown in SEQ ID NO.1; the forward primer nucleotide sequence being shown in SEQ ID No.2, and the reverse primer nucleotide sequence being shown in SEQ ID No.3.

[0047] Forward primer SEQ ID No. 2: TTGCTGAAGCTGCTGATTCATC;

[0048] Reverse primer SEQ ID No. 3: CTTCCTCTACACCATCTTTGTTTGTT.

[0049] In some specific embodiments of the present invention, primer pairs can be designed according to the target sequence shown in SEQ ID NO.1 to achieve the purpose of amplifying the target sequence shown in SEQ ID NO.1.

[0050] According to another embodiment of the present invention, a molecular identification method for the authentic quality of Dendrobium officinale is provided, comprising:

[0051] Step S1: extracting RNA from the Dendrobium to be tested and removing genomic DNA;

[0052] Step S2: reverse transcription of RNA to obtain cDNA;

[0053] Step S3: using fluorescent quantitative PCR method, using cDNA as a template, 18S locus as an internal reference gene, and using primers shown in SEQ ID No. 2 and SEQ ID No. 3 to amplify and obtain a fluorescent signal;

[0054] Step S4: determining the authenticity quality of the Dendrobium officinale to be tested according to the fluorescence signal.

[0055] According to an embodiment of the present invention, in step S1, the RNA of the dendrobium to be tested can be extracted using a commercial kit to extract the dendrobium RNA, and the genomic DNA and polysaccharides and polyphenols are removed to reduce the impact of polysaccharides and polyphenols on subsequent steps. The RNA extraction method uses a chloroform reagent that does not contain phenol, and effectively removes substances such as polysaccharides and polyphenols, reducing the impact of residual organic matter on subsequent experiments. The amount of RNA extracted per tube sample is between 50 mg and 150 mg.

[0056] According to an embodiment of the present invention, in step S2, a one-step reverse transcription method can be used to complete the first-strand DNA and cDNA in the same reaction system, which is easy to operate and has a low contamination rate. A micro-spectrophotometer can also be used to detect the quality of the cDNA template and determine the concentration.

[0057] According to an embodiment of the present invention, in step S3, a two-step method is used to perform fluorescence quantitative PCR, collecting during annealing, using SYBR Green dye, and using ROX as a fluorescent reference dye.

[0058] Furthermore, three-step fluorescence quantitative PCR can be performed using specific fluorescence quantitative primers for the 8801ORF1 site, SYBR Green fluorescent dye, and the 18S site as an internal reference gene.

[0059] According to an embodiment of the present invention, when the ΔCt value obtained according to the fluorescence signal is below the first preset value, it is determined that the Dendrobium to be tested is a Dendrobium of superior quality grown under simulated wild cultivation conditions;

[0060] When the ΔCt value obtained according to the fluorescence signal is greater than the second preset value, it is determined that the Dendrobium to be tested is a non-wild-cultivated Dendrobium of Huoshanense of secondary authentic quality.

[0061] In some specific embodiments of the present invention, when the 18S locus is used as the internal reference gene, the first preset value is 15.5 and the second preset value is 16.

[0062] According to an embodiment of the present invention, the internal reference gene can be selected from 18S rRNA, β-actin and GAPDH, etc., which is not limited by the present invention. The first preset value and the second preset value can be determined according to the selected internal reference gene and the actual detection result of the sample.

[0063] According to an embodiment of the present invention, based on the 8801 loci obtained by using methylome differential analysis, the 18s gene is used as an internal reference gene. In the Huoshan Dendrobium under non-wild-simulated cultivation conditions such as greenhouse cultivation, the expression level of the gene is low. In the Huoshan Dendrobium under simulated wild cultivation conditions, the expression level of the gene is high. Based on this characteristic, fluorescent quantitative PCR was performed on samples collected in greenhouses and collected in simulated wild cultivation methods. According to the PCR results, the gene expression pattern ΔCt (8801-18s) was below 15.5, and it was identified as Huoshan Dendrobium under simulated wild cultivation conditions with good authentic quality. The gene expression pattern ΔCt (8801-18s) was above 16, and it was identified as non-wild-simulated cultivation Huoshan Dendrobium with slightly inferior authentic quality. The molecular markers provided by the present invention are associated with growth environment factors, are obtained based on omics data screening, and do not require sequencing. They can quickly and low-cost detect the authentic quality of Huoshan Dendrobium.

[0064] According to an embodiment of the present invention, the variety of Dendrobium to be tested is Dendrobium huoshanense, other Dendrobium, or a hybrid of Dendrobium huoshanense and other Dendrobium; other Dendrobium is any one of the following: Dendrobium officinale, Dendrobium huangshanense, Dendrobium slender-stemmed, Dendrobium henanense, Dendrobium chrysantha, Dendrobium chinense, Dendrobium dentata, Dendrobium roheense, Dendrobium meihuaensis, Dendrobium sparse-flowered and Dendrobium cup sheath.

[0065] According to an embodiment of the present invention, the specific DNA molecular sequence shown in SEQ ID No. 1 belongs to the common sequence of the Dendrobium population, and the authenticity quality of multiple varieties of Dendrobium can be identified based on the specific DNA molecular site.

[0066] According to another embodiment of the present invention, there is provided an identification kit, comprising primers shown in SEQ ID No. 2 and SEQ ID No. 3, and the identification kit is used for identifying the authentic quality of Dendrobium officinale.

[0067] According to the embodiments of the present invention, by using specific primers, PCR amplification can be performed on specific DNA molecular sites of Dendrobium, so as to accurately identify the authentic quality of Dendrobium, and quickly distinguish the authentic quality of Dendrobium of different varieties and different forms, thereby ensuring its quality and medicinal value.

[0068] According to an embodiment of the present invention, the identification kit further includes a fluorescent dye, a DNA polymerase, and dNTP.

[0069] The scheme of the present invention will be further explained below with reference to specific examples. Unless otherwise stated in the following examples, conventional commercial reagents are used.

[0070] Example 1 Extraction and purification of RNA from Dendrobium huoshanense

[0071] Step 1: Sample collection and pretreatment: Clean the surface dust of the Huoshan Dendrobium samples, wrap them with tin foil, seal them in self-sealing bags and mark them, then quickly immerse them in liquid nitrogen for quick freezing and transport them with dry ice or liquid nitrogen.

[0072] Step 2: After grinding the plant leaves with liquid nitrogen, collect ≤100mg of plant samples into a centrifuge tube. Add 500µl of lysis buffer / 10µl of β-mercaptoethanol mixture and vortex to mix immediately. Note: Add 20µl of β-mercaptoethanol to every 1ml of lysis buffer, pre-mix in a 55℃ water bath for 1~3 minutes, and centrifuge at room temperature for 5 minutes at 10,000×g.

[0073] Step 3: Place the DNA adsorption column filter into a 2 ml collection tube to adsorb and remove the transgenic genomic DNA, transfer the supernatant to the DNA adsorption column, and centrifuge at 14,000 × g for 2 minutes at room temperature.

[0074] Step 4: Add an equal volume of isopropanol buffer to the filtrate and vortex mix for 20 seconds.

[0075] Step 5: Place the RNA adsorption column into a 2 ml collection tube, transfer half of the mixture (<700 µl) to the RNA adsorption column, centrifuge at 12,000 × g for 1 min at room temperature, and discard the filtrate.

[0076] Step 6: Repeat step 5 until all the mixture has been transferred through the column.

[0077] Step 7: Place the RNA adsorption column into the same 2 ml collection tube, add 400 µl of ethanol washing buffer to the RNA adsorption column, centrifuge at 10,000 × g for 30 seconds at room temperature, and discard the filtrate;

[0078] Step 8: Place the RNA adsorption column into the same 2 ml collection tube, add 500 µl of ethanol washing buffer to the RNA adsorption column, centrifuge at 10,000 × g for 30 seconds at room temperature, and discard the filtrate.

[0079] Step 9: Repeat step 8.

[0080] Step 10: Place the RNA adsorption column and the binding column into the same 2 ml collection tube, centrifuge at 10,000 x g for 2 min at room temperature, and spin dry the RNA adsorption column and the binding column matrix.

[0081] Step 11: Put the RNA adsorption column into a new 1.5ml centrifuge tube, take 50~100µl DEPC water, preheat the DEPC water to 65℃ before use, and add it accurately to the center of the RNA adsorption column membrane. After adding DEPC water to the column, let it stand at 65℃ for 2min, centrifuge at 10,000×g at room temperature for 1min, and use new DEPC water to elute RNA for the second time.

[0082] Example 2 Fluorescence quantitative PCR detection of the authentic quality of Huoshan Dendrobium

[0083] The template RNA obtained by the method of Example 1 from the samples of Dendrobium huoshanense collected in the simulated wild planting environment and the samples of Dendrobium huoshanense grown in the greenhouse was added to the reverse transcription system, and the first-strand cDNA was synthesized with random reverse primers and OligodT.

[0084] After incubation at 45°C for 15 minutes, 37°C for 30 minutes, and 85°C for 5 seconds, the synthesized cDNA template was added with forward primer SEQ ID No.2 and reverse primer SEQ ID No.3, and other reaction systems, dNTP, DNA enzyme and other components, and then centrifuged.

[0085] The qPCR steps were: 94°C for 30 s; (94°C for 5 s, 55°C for 15 s, 72°C for 15 s) for 40 cycles.

[0086] The results are shown in the following table:

[0087]

[0088] To verify the quality of the primers, a melting curve experiment was performed after the PCR stage.

[0089] Figure 1 This is a comparison chart of the results of fluorescent quantitative PCR detection of the authentic quality of Huoshan Dendrobium in the embodiments of the present invention.

[0090] according to Figure 1 It can be seen that after using the primers designed for the specific DNA molecules of the present invention to perform fluorescent quantitative PCR, there is a clear distinction between the Huoshan Dendrobium grown in the wild and in the greenhouse. Therefore, the authentic quality of Huoshan Dendrobium can be identified by the specific DNA molecules of the present invention.

[0091] The specific embodiments described above further illustrate the objectives, technical solutions and beneficial effects of the present invention in detail. It should be understood that the above description is only a specific embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. Application of a specific DNA molecule in identifying the authentic quality of Dendrobium officinale, wherein: The specific DNA molecule includes the sequence shown in SEQ ID NO.

1.

2. The use according to claim 1, wherein: The authentic quality includes superior authentic quality Dendrobium grown under simulated wild cultivation conditions and secondary authentic quality Dendrobium grown under non-simulated wild cultivation conditions.

3. The use according to claim 1, wherein: The dendrobium is Dendrobium huoshanense; The specific DNA molecule related to the authentic quality of the Huoshan Dendrobium is 42078801-42089000bp in the upstream promoter region of the serine kinase coding site on chromosome 9 of the Huoshan Dendrobium.

4. The use according to claim 1 or 2, wherein: The identification of the authentic quality of Dendrobium includes identifying the quality of fresh strips, dried strips, pods or powder of Dendrobium.

5. A primer for identifying the authentic quality of Dendrobium officinale, wherein: The identification primers include a forward and a reverse primer pair; The nucleotide sequence of the forward primer is shown in SEQ ID No.2, and the nucleotide sequence of the reverse primer is shown in SEQ ID No.

3.

6. A molecular identification method for the authentic quality of Dendrobium officinale, comprising: Extract RNA from the tested Dendrobium and remove genomic DNA; Reverse transcription of RNA was performed to obtain cDNA; By using the fluorescent quantitative PCR method, cDNA was used as a template and the primers shown in SEQ ID No. 2 and SEQ ID No. 3 were used for amplification to obtain a fluorescent signal; The authenticity quality of the Dendrobium to be tested is determined according to the fluorescence signal.

7. The molecular identification method according to claim 6, wherein: When the ΔCt value obtained according to the fluorescence signal is below a first preset value, it is determined that the Dendrobium to be tested is a Dendrobium of superior quality grown under simulated wild cultivation conditions; When the ΔCt value obtained according to the fluorescence signal is greater than the second preset value, it is determined that the Dendrobium to be tested is a Dendrobium of secondary authentic quality that is not cultivated in the wild. Preferably, when the 18S locus is used as the internal reference gene, the first preset value is 15.5 and the second preset value is 16.

8. The molecular identification method according to claim 6, wherein: The variety of the Dendrobium to be tested is Dendrobium huoshanense, other Dendrobium, or a hybrid of Dendrobium huoshanense and the other Dendrobium; the other Dendrobium is any one of the following: Dendrobium officinale, Dendrobium huangshanense, Dendrobium slender-stemmed, Dendrobium henanense, Dendrobium chrysantha, Dendrobium chinense, Dendrobium dentata, Dendrobium roheense, Dendrobium meihuaensis, Dendrobium sparse-flowered and Dendrobium cup sheath.

9. An identification kit, comprising primers shown in SEQ ID No. 2 and SEQ ID No. 3, wherein the identification kit is used for identifying the authentic quality of Dendrobium officinale.

10. The identification kit according to claim 9, wherein The identification kit also includes fluorescent dye, DNA polymerase and dNTP.

Images