A method of incubation of self-assembled organic material crystals based on double emulsion droplets

By using droplet microfluidics to prepare W/O/W type double emulsion droplets and regulating the salt concentration difference to promote the migration of self-assembled organic materials within the double emulsion droplets, the problem of non-uniform DNA crystal size was solved, and high crystal content and controllable drug loading were achieved.

CN119980475BActive Publication Date: 2025-12-05NINGBO INST OF MATERIALS TECH & ENG CHINESE ACAD OF SCI +1

Patent Information

Application Number
CN202510062824.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-15
Publication Date
2025-12-05
Estimated Expiration
2045-01-15

AI Technical Summary

Technical Problem

Existing technologies make it difficult to prepare DNA crystals with controllable quantity and uniform size. The number of DNA crystals prepared by the hanging drop method is uncontrollable, and the crystal size distribution is wide, which makes it difficult to meet the requirements of controllable drug loading and release.

Method used

W/O/W type double emulsion droplets were prepared using droplet microfluidics. By adjusting the salt concentration ratio of the outer aqueous phase to the inner aqueous phase, the migration of self-assembled organic materials within the double emulsion droplets was promoted, resulting in uniformly sized self-assembled organic material crystals.

Benefits of technology

It achieves controllable size of self-assembled organic material crystals, high crystal content in dual emulsion droplets, and a high ratio of single crystals in a single droplet, thereby improving the controllability and concentration of drug loading and release.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119980475B_ABST
    Figure CN119980475B_ABST
Patent Text Reader

Abstract

The application discloses an incubation method of self-assembled organic material crystals based on double emulsion drops, and the method comprises the following steps: preparing W / O / W type double emulsion drops with uniform size through a microfluidic chip; during the preparation of the double emulsion drops, using a self-assembled organic material solution as an inner water phase solution, using a non-water-soluble solution as an intermediate oil phase solution, and using a water phase solution containing a high salt concentration as an outer water phase solution to encapsulate the self-assembled organic material solution, so as to avoid the self-assembled organic material from being free in the outer water phase solution; and incubating the double emulsion drops loaded with the self-assembled organic material solution. By using the concentration difference between the outer water phase solution and the inner water phase solution, under the influence of osmotic pressure, water molecules in the inner water phase solution migrate to the outer water phase, and the concentration of the self-assembled organic material in the double emulsion drops also increases, so as to promote the growth of the self-assembled organic material crystals, and finally, the self-assembled organic material crystals with uniform size are obtained in the double emulsion drops, and each double emulsion drop contains a single self-assembled organic material crystal.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of droplet microfluidics and crystal materials, specifically to an incubation method for self-assembled organic material crystals based on dual emulsion droplets. Background Technology

[0002] Self-assembling organic materials are a class of organic materials with self-assembly capabilities, which can assemble into periodic array structures and then into organic material crystals. DNA, as one of the self-assembling organic materials, can participate in the construction of nanostructures as a programmable self-assembly unit. DNA-based structural DNA nanotechnology has been widely applied in fields such as biology, biosensing, and drug delivery (Huating Kong, et al. Exploring the Potential of Three-Dimensional DNA Crystals in Nanotechnology: Design, Optimization, and Applications. Adv Sci. 2023, 10(24):e2302021. doi:10.1002 / advs.202302021.). Among them, DNA crystal preparation involves periodically arranging and assembling designed DNA molecules to construct three-dimensional DNA crystals. The DNA crystals serve as periodic molecular scaffolds, loading and collecting the required guest molecules through precise arrangement.

[0003] Currently, there are two main methods for preparing DNA crystals: the hanging drop method and the sitting drop method. Chinese patent document CN117384231A discloses a method for preparing engineered DNA crystals using the hanging drop method. However, this method produces DNA crystals with uncontrollable quantity and wide size distribution, making it difficult to obtain DNA crystals with controllable quantity and uniform size. The preparation of DNA crystals with controllable quantity and uniform size will further expand the application of DNA crystals in controlled drug loading and release, as well as in nanostructure engineering. The shortcomings of current methods for preparing self-assembled organic material crystals prompt us to seek a better technical method to prepare self-assembled organic material crystals with controllable and uniform size.

[0004] Droplet microfluidics is a technique that has emerged in recent years to manipulate microdroplets with volumes ranging from tens of picoliters to hundreds of nanoliters through microchannels. The microdroplets prepared using this technique are characterized by their small size, uniformity, independence, stability, controllability, and large specific surface area, making them promising for applications and research in chemistry, biomedicine, and new materials. Research has shown that dual-emulsion droplets prepared using droplet microfluidics can serve as microreaction containers for nanoliter-level chemical and biological microreactions. Therefore, this invention proposes using dual-emulsion droplets produced by droplet microfluidics as incubation containers to prepare self-assembled organic material crystals. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention provides an incubation method for self-assembled organic material crystals based on dual emulsion droplets. By increasing the salt concentration in the aqueous phase outside the dual emulsion droplets, water molecules migrate within the aqueous phase solution, thereby increasing the concentration of self-assembled organic materials in the aqueous phase, promoting the assembly of self-assembled organic materials into crystals, and achieving the goal of controllable crystal size for the self-assembled organic materials.

[0006] An incubation method for self-assembled organic material crystals based on dual emulsion droplets includes the following steps:

[0007] (1) A self-assembled organic material and a soluble salt are prepared into an inner aqueous phase solution, an insoluble substance and an insoluble organic solvent are prepared into an intermediate oil phase solution, and the soluble salt is prepared into an outer aqueous phase solution, wherein...

[0008] (2) The inner aqueous phase solution, the intermediate oil phase solution and the outer aqueous phase solution obtained in step (1) are respectively introduced into the corresponding channels of the microfluidic chip to obtain a double emulsion droplet loaded with self-assembled organic material;

[0009] (3) After water migration, the double emulsion droplets loaded with self-assembled organic materials obtained in step (2) are incubated to obtain self-assembled organic material crystals based on double emulsion droplets.

[0010] In this invention, uniform W / O / W (water-in-oil-in-water) biemulsion droplets are prepared using a microfluidic chip. During the preparation of the biemulsion droplets, a self-assembled organic material solution is used as the inner aqueous phase solution, the intermediate oil phase solution is a non-water-soluble solution, and an outer aqueous phase solution with a high salt concentration is used to encapsulate the self-assembled organic material solution, preventing the self-assembled organic material from being released into the outer aqueous phase solution. The biemulsion droplets containing the self-assembled organic material solution are then incubated.

[0011] By utilizing the concentration difference between the external and internal aqueous solutions, water molecules in the internal aqueous solution migrate to the external aqueous solution under the influence of osmotic pressure. The concentration of self-assembled organic material in the double emulsion droplet gradually increases to the crystallization concentration of the self-assembled organic material. This process promotes the growth of self-assembled organic material crystals. When the volume ratio of the core droplet before and after water migration is the same as the salt concentration ratio of the external and internal aqueous solutions before water migration, the degree of water migration in the double emulsion droplet reaches saturation, which can achieve the maximum degree of crystallization of self-assembled organic material in the double emulsion droplet. Finally, uniformly sized self-assembled organic material crystals are obtained in the double emulsion droplet, and the ratio of single self-assembled organic material crystals in a single double emulsion droplet is high.

[0012] In this invention, the diameter of the core droplet of the double emulsion droplet obtained in step (2) can be controlled, thereby controlling the diameter of the core droplet of the double emulsion droplet after water migration, and thus controlling the size range of the self-assembled organic material crystals obtained, so that the size of the self-assembled organic material crystals is controllable, and the self-assembled organic material crystals of different sizes obtained can be used for controllable drug loading and release and for nanostructure engineering.

[0013] Preferably, the self-assembling organic material is a water-soluble organic material that can be assembled into a periodic structure crystal, such as DNA strands, block copolymers, supramolecular polymers, proteins, etc., which have self-assembly properties or can form a periodic structural arrangement after being synthesized and modified.

[0014] More preferably, the self-assembled organic material is a DNA chain, which is a combination of a central chain (L chain), a side chain (M chain), and a corner chain (S chain).

[0015] In this invention, the DNA strand can be one of three different types: a central L-strand, a side M-strand, and a corner S-strand (the nucleotide sequences of the DNA strands are shown in SEQ ID NO. 1–3 or SEQ ID NO. 6–8). Figure 1 and Figure 9 As shown, three different DNA strands constitute a triangular tensile structural unit. The side strand M extends in three double helix directions, the central strand L with a triple repeat sequence is located in the center of the structural unit, and the corner strand S is located at the end of the double helix of the structural unit and pairs with the side strand M. Based on the above triangular tensile structural unit, the present invention can periodically assemble and arrange the structure to obtain a uniform three-dimensional DNA crystal by complementary pairing of two base vacancies.

[0016] More preferably, the self-assembled organic material is a DNA chain, and the DNA chain is a self-assembled Z-chain.

[0017] In this invention, the DNA strands can also be identical self-assembled Z-strands (nucleotide sequences as shown in SEQ ID NO. 4 or SEQ ID NO. 5), and two identical self-assembled Z-strands pair up to form a structure as shown in the figure. Figure 5 and Figure 7 The structural basic unit shown.

[0018] More preferably, the DNA chain is a central chain L chain with nucleotide sequence SEQ NO.1, a side chain M chain with nucleotide sequence SEQ NO.2, and a corner chain S chain with nucleotide sequence SEQ NO.3.

[0019] In a specific embodiment of the present invention, when the self-assembled organic material is a DNA chain (the central chain L chain with the nucleotide sequence of SEQ NO.1, the side chain M chain with the nucleotide sequence of SEQ NO.2, and the corner chain S chain with the nucleotide sequence of SEQ NO.3), a DNA crystal with controllable size can be obtained by controlling the initial concentration of the self-assembled material and the initial salt concentration ratio of the internal and external phase aqueous solutions, or by adjusting the initial diameter of the core droplet.

[0020] More preferably, the concentration of the central L-chain in the inner aqueous phase solution is 6-12 μM, and the salt concentration ratio of the outer aqueous phase solution to the inner aqueous phase solution is not less than 20:1.

[0021] In a specific embodiment of the present invention, when the ratio of the concentration of the central L-chain in the inner aqueous solution to the salt concentration of the inner and outer aqueous solutions is within the above-mentioned range, their product can exceed the self-assembly crystallization concentration of the DNA chain, thereby obtaining a double emulsion droplet with a high crystal content, which is close to 100%, and the ratio of a single DNA crystal in a single double emulsion droplet is more than 80%, and can reach up to about 98%.

[0022] Preferably, in the inner aqueous phase solution and the outer aqueous phase solution, the soluble salt is one of potassium salt, sodium salt, magnesium salt, and ammonium salt.

[0023] Preferably, both the inner aqueous phase solution and the outer aqueous phase solution further include a buffer solution and a surfactant.

[0024] In the aforementioned internal aqueous phase solution and external aqueous phase solution,

[0025] More preferably, the buffer solution is a TAE buffer solution.

[0026] In this invention, the TAE buffer is a buffer solution composed of tris-hydroxymethylaminomethane (Tris base), acetic acid, and ethylenediaminetetraacetic acid (EDTA).

[0027] More preferably, the surfactant is polyvinyl alcohol, sodium dodecyl sulfate, or Tween 80.

[0028] Preferably, the non-water-soluble substance is at least one of silicone oil, mineral oil, and liposomes.

[0029] Preferably, the microfluidic chip is made of glass, polydimethylsiloxane, or plastic.

[0030] The microfluidic chip used in this invention includes an input channel for a three-phase solution and an output channel, and can be used to prepare W / O / W type double emulsion droplets loaded with self-assembled organic materials.

[0031] Preferably, the size of the self-assembled organic material crystal based on dual emulsion droplets is 15–60 μm.

[0032] In this invention, the size of the self-assembled organic crystal is controlled by the initial concentration of the self-assembly material, the initial salt concentration ratio of the internal and external aqueous solutions, or by adjusting the diameter of the initial core droplet, thereby obtaining self-assembled organic material crystals with controllable size.

[0033] Preferably, the crystal content of the incubated double emulsion droplets is ≥95%.

[0034] In this invention, when the internal aqueous phase solution in step (1) When the value is much greater than the crystallization concentration of the self-assembled organic material, the crystal content of the incubated double emulsion droplets is ≥95%, and can even reach 100%.

[0035] Preferably, in the incubated double emulsion droplets, the ratio of a single self-assembled organic material crystal within a single double emulsion droplet is ≥80%.

[0036] In this invention, the ratio of a single self-assembled organic material crystal within a single double emulsion droplet after incubation is high, which can improve single crystal manipulation and utilization, making the crystal more controllable and concentrated when used for drug loading and release.

[0037] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0038] This invention utilizes a dual-emulsion droplet as an incubation container to prepare self-assembled organic material crystals. By controlling the concentration of the encapsulated self-assembled organic material, the salt concentration in the outer and inner aqueous solutions, and the size of the core droplet of the initial dual-emulsion droplet, self-assembled organic material crystals of different sizes can be prepared. The dual-emulsion droplets prepared by this incubation method have a high crystal content, with a single crystal ratio of ≥80% in a single droplet. This can improve single crystal manipulation and utilization, making the crystals more controllable and concentrated when used for drug loading and release. Attached Figure Description

[0039] Figure 1 This is a schematic diagram of the triangular tensile structural unit of the DNA crystal in Example 1.

[0040] Figure 2 Image of a double emulsion droplet loaded with self-assembled organic material.

[0041] Figure 3 Image of DNA crystal based on double emulsion droplets prepared in Example 1.

[0042] Figure 4 An image of a single DNA crystal contained in a single double emulsion droplet prepared in Example 1.

[0043] Figure 5 This is a schematic diagram of the structural building blocks of the DNA crystal in Example 11.

[0044] Figure 6 Image of DNA crystal based on double emulsion droplets prepared in Example 11.

[0045] Figure 7 This is a schematic diagram of the structural building blocks of the DNA crystal in Example 12.

[0046] Figure 8 Image of DNA crystal based on double emulsion droplets prepared in Example 12.

[0047] Figure 9 This is a schematic diagram of the triangular tensile structural unit of the DNA crystal in Example 13.

[0048] Figure 10 Image of DNA crystal based on double emulsion droplets prepared in Example 13.

[0049] Figure 11 Image of DNA crystal prepared using the hanging drop method for Comparative Example 1.

[0050] Figure 12 Images of DNA crystal incubation based on double emulsion droplets in Examples 1-4 and Comparative Example 2 are shown. In the images, i-v are DNA crystal images prepared in Comparative Example 2 and Examples 1-4, respectively, and vi is a statistical graph of DNA crystal size, droplet crystal content, and the ratio of single crystals in a single droplet in Examples 1-4.

[0051] Figure 13 Images of DNA crystal incubation based on double emulsion droplets in Examples 1, 5-8 are shown, where i-v are images of DNA crystals prepared in Examples 1, 5-8 respectively, and vi is a statistical graph of DNA crystal size, droplet crystal content, and the percentage of single crystals in a single droplet in Examples 1, 5-8.

[0052] Figure 14 Images of DNA crystal incubation based on double emulsion droplets in Examples 1, 9 and 10, and Comparative Examples 3 and 4 are shown. In the images, i to v are DNA crystal images prepared in Comparative Examples 3 and 4, and Examples 9, 1 and 10, respectively. Vi is a statistical graph of DNA crystal size, droplet crystal content, and the percentage of single crystals in a single droplet in Examples 1, 9 and 10.

[0053] Figure 15 The figures for Examples 11-13 show the DNA crystal size, crystal content of the droplets, and the percentage of single crystals in a single droplet based on dual emulsion droplets. Detailed Implementation

[0054] The present invention will be further described in detail below with reference to the embodiments, but the implementation of the present invention is not limited to the following embodiments.

[0055] All raw materials used in this invention are commercially available.

[0056] In specific embodiments of the present invention, DNA strands are used as self-assembling organic materials, and all DNA strands are synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0057] Preparation of TAE buffer stock solution (50×TAE buffer): Add 242g (2mol) of Tris and 37.2g (0.1mol) of disodium Na2EDTA to 800mL of deionized water and stir until fully dissolved. Add 57.1mL of acetic acid, and then add deionized water to a final volume of 1L.

[0058] Example 1

[0059] Central chain L-chain: ACACCGTACACCGTACACCGT (SEQ ID NO.1);

[0060] Edge chain M chain: GAGCAGCCTGTACGGACATCA (SEQ ID NO.2);

[0061] Angular chain S chain: TCTGATGTGGCTGC (SEQ ID NO.3).

[0062] In this embodiment, the aforementioned central chain L chain, side chain M chain, and corner chain S chain can be formed as follows: Figure 1 The triangular tensioned structural unit shown has a self-assembly crystallization concentration of approximately 120 μM in water at 20 °C.

[0063] (1) Mix the three DNA strands (central strand L, side strand M, and corner strand S) in a 1:3:3 ratio to ensure the concentration of the central strand L (i.e., the concentration of the triangular tensile structure motif, such as...) Figure 1 The concentration was 8 μM, and 1×TAE buffer and 25 mM magnesium acetate (i.e., 1×TAE / Mg) were added. 2+ A DNA solution was obtained by dissolving a 0.2% polyvinyl alcohol (PVA) solution in 0.2% polyvinyl alcohol (PVA). The DNA solution was then transferred into a PCR apparatus and cooled from 95°C to 20°C at a rate of 0.6°C / min to obtain the inner aqueous phase solution. An intermediate oil phase solution was obtained by mixing 50 cSt dimethyl silicone oil and polydimethylsiloxane (PDMS) at an 8:2 ratio. The outer aqueous phase solution contained 20×TAE buffer and 0.5M magnesium acetate (i.e., 20×TAE / Mg). 2+ ) 2.5% PVA aqueous solution.

[0064] (2) The inner aqueous phase solution, intermediate oil phase solution, and outer aqueous phase solution obtained in step (1) are respectively introduced into the corresponding channels of the glass capillary microfluidic chip to encapsulate the self-assembled organic material into a W / O / W type double emulsion droplet, thus obtaining a double emulsion droplet loaded with DNA solution. The diameter of the core droplet of the double emulsion droplet is 160 μm. Figure 2 As shown, the double emulsion droplet has a core-shell structure, where the core is the inner aqueous phase solution, the shell is the intermediate oil phase solution, and the external liquid phase environment of the double emulsion droplet is the outer aqueous phase.

[0065] (3) The DNA solution-loaded double emulsion droplets obtained in step (2) were placed in a 20°C incubator for water migration. The core droplet diameter of the double emulsion droplets after water migration was 60 μm. The volume ratio of the core droplets before and after water migration was the same as the salt concentration ratio of the outer aqueous phase solution and the inner aqueous phase solution, i.e., the water migration ratio was 20:1. Subsequently, the mixture was incubated at 20°C for 72 h to obtain DNA crystals based on the double emulsion droplets. Figure 3 ), in which a single double emulsion droplet contains a single DNA crystal ( Figure 4 ).

[0066] Example 2

[0067] The preparation method is the same as in Example 1, except that the concentration of the triangular tension structure unit is 6 μM.

[0068] Example 3

[0069] The preparation method is the same as in Example 1, except that the concentration of the triangular tension structure unit is 10 μM.

[0070] Example 4

[0071] The preparation method is the same as in Example 1, except that the concentration of the triangular tension structure unit is 12 μM.

[0072] Example 5

[0073] The preparation method is the same as in Example 1, except that the core droplet diameter of the water-migrated double emulsion droplet is 100 μm and the water migration ratio is 20:1.

[0074] Example 6

[0075] The preparation method is the same as in Example 1, except that the core droplet diameter of the water-migrated double emulsion droplet is 110 μm and the water migration ratio is 20:1.

[0076] Example 7

[0077] The preparation method is the same as in Example 1, except that the core droplet diameter of the water-migrated double emulsion droplet is 130 μm and the water migration ratio is 20:1.

[0078] Example 8

[0079] The preparation method is the same as in Example 1, except that the core droplet diameter of the water-migrated double emulsion droplet is 150 μm and the water migration ratio is 20:1.

[0080] Example 9

[0081] The preparation method is the same as in Example 1, except that the concentrations of TAE and magnesium acetate in the external aqueous solution are 15 × TAE / Mg. 2+ .

[0082] Example 10

[0083] The preparation method is the same as in Example 1, except that the concentrations of TAE and magnesium acetate in the external aqueous solution are 25 × TAE / Mg. 2+ .

[0084] Example 11

[0085] Self-assembled chain Z-chain: CGACGCGTGGCGCCGC (SEQ ID NO.4)

[0086] The preparation method is the same as in Example 1, except that the added DNA strand is a self-assembled Z-strand, and the concentration of the self-assembled Z-strand is kept at 10 μM (two self-assembled Z-strands form a structure through base pairing, as shown in Example 1). Figure 5 The structural unit shown is at a concentration of 5 μM.

[0087] DNA crystals based on dual emulsion droplets were prepared. Figure 6 ), in which a single double emulsion droplet contains a single DNA crystal.

[0088] Example 12

[0089] Self-assembled chain Z-chain: GGACAGCTGGGAG (SEQ ID NO.5)

[0090] The preparation method is the same as in Example 1, except that the added DNA strand is a self-assembled Z-strand, and the concentration of the self-assembled Z-strand is kept at 50 μM (two self-assembled Z-strands form a structure through base pairing, as shown in Example 1). Figure 7 The structural unit shown is at a concentration of 25 μM.

[0091] DNA crystals based on dual emulsion droplets were prepared. Figure 8 ), in which a single double emulsion droplet contains a single DNA crystal.

[0092] Example 13

[0093] Central Chain L-Chain:

[0094] CGGTATTCACCACGATGCGGTATTCACCACGATGCGGTATTCACC ACGATG (SEQ ID NO. 6);

[0095] Edge chain M chain:

[0096] GAAAAACACTGCCTGAATACCGCATCGTGGACTGACTCAAAA(SEQ ID NO.7);

[0097] Angular chain S chain: TCTTTTGAGTCAGTGGCAGTGTTTT (SEQ ID NO.8).

[0098] The preparation method is the same as in Example 1, except that the added DNA strand is the DNA strand of SEQ ID NO. 6-8, ensuring the concentration of the central L strand (i.e., the concentration of the triangular tensile structure motif, such as...). Figure 9 The value shown is 2 μM.

[0099] DNA crystals based on dual emulsion droplets were prepared. Figure 10 ), in which a single double emulsion droplet contains a single DNA crystal.

[0100] Comparative Example 1: Preparation of DNA crystals using the hanging drop method

[0101] DNA crystals were prepared using the conventional hanging drop method, with the same DNA strands as in Example 1. A 10 μL hanging drop was prepared, containing a 12 μM concentration of the central L strand, 1×TAE buffer, and 25 mM magnesium acetate. The 10 μL hanging drop was then subjected to the same annealing procedure as in Example 1, adsorbed onto a coverslip, and suspended on a 24-well plate. A 0.6 mL solution of 1.7 M ammonium sulfate was placed below the plate, and the plate was incubated at 20°C for 72 hours. The DNA crystals in the hanging drop were as follows... Figure 11 As shown.

[0102] Comparative Example 2

[0103] The preparation method is the same as in Example 1, except that the concentration of the triangular tension structure unit is 4 μM.

[0104] Comparative Example 3

[0105] The preparation method is the same as in Example 1, except that the concentrations of TAE and magnesium acetate in the external aqueous solution are 5 × TAE / Mg. 2+ .

[0106] Comparative Example 4

[0107] The preparation method is the same as in Example 1, except that the concentrations of TAE and magnesium acetate in the external aqueous solution are 10 × TAE / Mg. 2+ .

[0108] Sample Analysis

[0109] The crystal incubation conditions of Examples 1-13 and Comparative Examples 1-4 were observed, and the crystal data (crystal size, droplet crystal content, and ratio of a single crystal in a single droplet) were statistically analyzed. The results are as follows: Figures 12-15 As shown.

[0110] Figure 12 Images of DNA crystal incubation based on dual emulsion droplets from Examples 1-4 and Comparative Example 2 are shown. Figure 6 Images i to v in Comparative Example 2 and Examples 1-4 show the incubation images of DNA crystals prepared in these examples. In Comparative Example 2, the concentration of the triangular tensile structural unit was too low; after multiplying this by the salt concentration ratio of the outer and inner aqueous phase solutions, the concentration did not reach the self-assembly crystallization concentration of the DNA strand. Therefore, no DNA crystals were observed. In Examples 1-4, DNA crystals were observed after 72 hours of incubation. Figure 12 As shown in vi, the size range of the DNA crystals incubated in Examples 1 to 4 is 19.4±0.9μm to 26.4±0.6μm. The crystal content of the double emulsion droplets is high, with the ratio of a single crystal in a single droplet exceeding 80%, and reaching a maximum of 98.6%±0.9%.

[0111] Figure 13 Images of DNA crystal incubation based on dual emulsion droplets from Examples 1, 5-8, are shown below. Figure 13 As shown in i-v, DNA crystals can be observed in Examples 1 and 5-8, as shown in the figures. Figure 13 As shown in vi, the size range of the DNA crystals incubated in Examples 1 to 4 is 21.6±0.6μm to 56.8±2.6μm. The crystal content of the double emulsion droplets can reach 100%, and the ratio of a single crystal in a single droplet is over 90%.

[0112] Figure 14 Images of DNA crystal incubation based on dual emulsion droplets in Examples 1, 9 and 10, and Comparative Examples 3 and 4, are shown. Figure 14 As shown in i-v, the salt concentration ratios of the outer and inner aqueous phase solutions in Comparative Examples 3 and 4 were 5 and 10, respectively. The small difference in salt concentration between the inner and outer aqueous phase solutions in Comparative Examples 3 and 4 meant that the concentration required for self-assembly crystallization of the DNA strand could not be reached after water migration, making it difficult to form DNA crystals. In Example 9, the salt concentration ratio of the outer and inner aqueous phase solutions was 15. After water migration, the concentration was just reached for self-assembly crystallization, and DNA crystals were observed to form in a small number of double emulsion droplets, resulting in a low crystal content. In contrast, the salt concentration ratios of the inner and outer aqueous phases in Examples 1 and 9 were 20 and 25, respectively, and DNA crystals were observed in both cases. Figure 14 As shown in vi, the size range of the DNA crystals incubated in Examples 1 and 9 is 19.3±0.9μm to 56.8±2.6μm. The crystal content of the double emulsion droplets can reach 100%, and the ratio of a single crystal in a single droplet is over 90%.

[0113] Figure 15 The figure shows the statistical graphs of DNA crystal size, crystal content of droplets, and percentage of single crystals in a single droplet for Examples 11-13 based on double emulsion droplets. As shown in the figure, the size range of DNA crystals incubated in Examples 11-13 is 15.81±0.60μm to 20.80±2.01μm. The crystal content of droplets obtained in Example 12 is >30%, and the crystal content of droplets obtained in Examples 11 and 13 can reach 100%. The percentage of single crystals in a single droplet obtained in Examples 11-13 is all over 90%.

[0114] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A method for incubating self-assembled organic material crystals based on dual emulsion droplets, characterized in that, Includes the following steps: (1) A self-assembled organic material and a soluble salt are prepared into an inner aqueous phase solution, an insoluble substance and an insoluble organic solvent are prepared into an intermediate oil phase solution, and the soluble salt is prepared into an outer aqueous phase solution, wherein... The self-assembling organic material is a water-soluble organic material capable of assembling into a periodic crystal structure. (2) The inner aqueous phase solution, the intermediate oil phase solution and the outer aqueous phase solution obtained in step (1) are respectively introduced into the corresponding channels of the microfluidic chip to obtain a double emulsion droplet loaded with self-assembled organic material; (3) After water migration, the double emulsion droplets loaded with self-assembled organic materials obtained in step (2) are incubated to obtain self-assembled organic material crystals based on double emulsion droplets.

2. The incubation method for self-assembled organic material crystals based on dual emulsion droplets according to claim 1, characterized in that, In the aforementioned internal aqueous phase solution and external aqueous phase solution, the soluble salt is one of potassium salt, sodium salt, magnesium salt, and ammonium salt.

3. The incubation method for self-assembled organic material crystals based on dual emulsion droplets according to claim 1, characterized in that, Both the internal aqueous phase solution and the external aqueous phase solution further include buffer solution and surfactant.

4. The incubation method for self-assembled organic material crystals based on dual emulsion droplets according to claim 3, characterized in that, The buffer solution is a TAE buffer solution.

5. The incubation method for self-assembled organic material crystals based on dual emulsion droplets according to claim 3, characterized in that, The surfactant is polyvinyl alcohol, sodium dodecyl sulfate, or Tween 80.

6. The incubation method for self-assembled organic material crystals based on dual emulsion droplets according to claim 1, characterized in that, The non-water-soluble substance is at least one of silicone oil, mineral oil, and liposomes.

7. The incubation method for self-assembled organic material crystals based on dual emulsion droplets according to claim 1, characterized in that, The size of the self-assembled organic material crystal based on dual emulsion droplets is 15–60 μm.

8. The incubation method for self-assembled organic material crystals based on dual emulsion droplets according to claim 1, characterized in that, The crystal content of the incubated double emulsion droplets is ≥95%.

9. The incubation method for self-assembled organic material crystals based on dual emulsion droplets according to claim 1, characterized in that, In the incubated double emulsion droplets, the ratio of a single self-assembled organic material crystal within a single double emulsion droplet is ≥80%.

Citation Information

Patent Citations

  • Method for functionalizing engineered DNA crystal after crystallization and application

    CN117384231A

  • DNA-programmed photonic crystal fabrication processes

    US20240141545A1

Cited By

  • Method for rapidly preparing three-dimensional self-assembled DNA (deoxyribonucleic acid) crystal in closed homogeneous system

    CN122127384A