Mouse gene knockout method and constructed SP1 gene knockout mouse embryo model

Abstract

The invention discloses a mouse gene knockout method and a constructed SP1 gene knockout mouse embryo model, and belongs to the technical field of biogenetics, the model construction method comprises the following steps: preparing a gene editing solution containing Cas9 and sgRNA for targeting a second exon region and a third exon region of a mouse SP1 gene by using a CRISPR / Cas9 gene editing technology; injecting the gene editing injection into a fertilized egg of a mouse; and transplanting two cells obtained by splitting the injected fertilized ova into the uterus of a pseudopregnant female mouse to obtain the SP1 gene knockout mouse embryo model. The SP1 gene in a mouse embryo is cut off by using a gene editing tool CRISPR / Cas9, the influence of the gene on embryo development is observed, the effect of the SP1 gene in embryo formation and abortion is researched, and a theoretical basis is provided for disease treatment.

Description

Technical Field

[0001] The present invention relates to the technical field of biogenetic science, and in particular to a mouse gene knockout method and a constructed SP1 gene knockout mouse embryo model. Background Art

[0002] Embryonic development is a core link in the continuation of mammalian populations, and its smooth progress is crucial. Clinical data show that miscarriage during pregnancy is particularly common during the 5th to 12th week of embryonic development. The risk of miscarriage at this stage is significantly higher than in other periods, while the risk is significantly reduced after 12 weeks. It is worth noting that although there is a lack of detailed clinical data on embryos before 5 weeks of pregnancy due to their small size, the estimated miscarriage rate is as high as 50%, highlighting the fragility of early embryonic development. Although the causes of miscarriage are diverse, including gamete chromosome abnormalities, embryo euploidy abnormalities, uterine structural defects and autoimmune diseases, more than half of clinical cases of recurrent miscarriage cannot determine their specific causes. Abnormal embryonic development is undoubtedly a key factor leading to miscarriage during pregnancy.

[0003] In view of the ethical constraints of human embryo research, the mouse model has become an important alternative tool for exploring the mechanism of embryonic lethality with its highly conserved developmental regulatory mechanism. Especially in the gastrulation period (E7.5) of mouse embryos, which corresponds to the third week of human embryos, it is at the peak of the risk of miscarriage. During this period, the epiblast cells undergo a complex migration and rearrangement process to form ectoderm, mesoderm and endoderm with different developmental potentials, laying a solid cytological foundation for the construction of the embryo's body axis and subsequent organ development. However, the loss of transcription factors will seriously interfere with the normal differentiation of the three germ layers, thereby hindering embryonic development and even leading to embryonic death. For example, SOX17 is a key transcription factor for endoderm development. Its loss will cause the death of mouse embryos from E8.5 to E9.5, which is manifested as the complete lack of endoderm development and the inability to form foregut and midgut structures. Therefore, in-depth exploration of how transcription factors regulate the differentiation of the three germ layers is of far-reaching significance for understanding the risk of miscarriage during pregnancy.

[0004] The transcription factors of the SP / KLF family, especially the specific protein 1 (SP1), are widely expressed in a variety of organisms and participate in the regulation of key biological processes such as cell proliferation, apoptosis and differentiation. In mice, homozygous mutations in the SP1 gene can lead to significant retardation of embryonic development, causing developmental abnormalities such as body axis asymmetry, incomplete flipping and growth outside the yolk sac, and ultimately leading to embryonic death at E11. In addition, SP1 is highly expressed in trophoblast giant cells, nerves and heart tissues at embryonic E8.5, further confirming its importance in embryonic development. Although studies have shown that SP1 is involved in the development of organs such as the heart, whether it ensures the correct initiation of the developmental program by regulating the differentiation of the three germ layers during the foundation stage of the three germ layers remains a core challenge in the current research field. Summary of the invention

[0005] The present invention discloses a mouse gene knockout method and a constructed SP1 gene knockout mouse embryo model. By constructing the SP1 gene knockout mouse embryo model, the invention aims to deeply explore the relationship between SP1 and the development of mouse embryo germ layers, and provide new theoretical support for the prevention and control of early pregnancy abortion in clinical practice.

[0006] The present invention discloses a sgRNA for targeting the mouse SP1 gene, wherein the sgRNA comprises a nucleotide sequence complementary to the second or third exon region of the mouse SP1 gene.

[0007] Preferably, the nucleotide sequence of the sgRNA is shown as SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.4.

[0008] The present invention discloses a method for constructing a mouse embryo model with SP1 gene knockout, and the construction method comprises:

[0009] Using CRISPR / Cas9 gene editing technology, preparing a gene editing solution comprising Cas9 and sgRNA for targeting the second and third exon regions of the mouse SP1 gene;

[0010] Injecting the gene editing injection solution into a fertilized egg of a mouse;

[0011] The two cells obtained by the division of the injected fertilized egg were transplanted into the uterus of a pseudopregnant mouse to obtain a mouse embryo model with SP1 gene knockout.

[0012] Preferably, the sgRNA for targeting the second exon region of the mouse SP1 gene (as shown in SEQ ID NO.1) is selected from the first sgRNA shown in SEQ ID NO.2 and the second sgRNA shown in SEQ ID NO.3, and the sgRNA for targeting the third exon region of the mouse SP1 gene (as shown in SEQ ID NO.1) is selected from the third sgRNA shown in SEQ ID NO.4 and the fourth sgRNA shown in SEQ ID NO.5.

[0013] Preferably, the gene editing solution comprises 5× electroporation buffer, a first sgRNA, a second sgRNA, a third sgRNA, a fourth sgRNA, Cas9 protein, and Opti-MEM culture medium.

[0014] Preferably, the volume ratio of Cas9 protein, Opti-MEM culture medium, 5× electroporation buffer, first gRNA, second gRNA, third gRNA, and fourth gRNA in the gene editing solution is 1 μL: 10 μL: 2 μL: 1.75 μL: 1.75 μL: 1.75 μL: 1.75 μL.

[0015] Preferably, the injection method is electroporation transfection injection.

[0016] The present invention also discloses a mouse embryo model with SP1 gene knockout, which is constructed by the above model construction method.

[0017] Beneficial effects: The present invention designs sgRNA that specifically targets the mouse SP1 gene, and uses Cas9 protein to knock out the second and third exons of the SP1 gene, thereby achieving the purpose of gene knockout in mouse embryos. The present invention uses gene editing technology to construct a mouse embryo model with SP1 gene knockout, which has the advantages of simple operation and short cycle. The mouse embryo model can be used to study the mechanism of transcription factor SP1 regulating the differentiation and development of the three germ layers of early mouse embryos, and provide a new theoretical basis for the clinical treatment of early pregnancy abortion. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Schematic diagram of Sp1 knockout in mouse embryos of the present invention, wherein four sgRNAs are marked in purple, the blue marked region includes the knocked out 2nd and 3rd exons, and red and green indicate the design positions of PCR primers for identifying the genotype of mouse embryos.

[0019] Figure 2 This is the electrophoresis result of the Sp1 gene knockout embryo genotype, where the upper part is the outer primer, the lower part is the inner primer, M is the D2000 Marker, + / - is the heterozygous type; + / + is the wild type; - / - is the homozygous knockout type.

[0020] Figure 3 The figure shows the RNA-seq results of each component of mouse E7.5 embryos. WT is wild-type embryos, KO is homozygous knockout embryos, Ect is ectoderm, Mes is mesoderm, End is endoderm, PS is primitive streak, and ExE is extraembryonic ectoderm.

[0021] Figure 4 This is a picture of a mouse E7.5 embryo. After genotyping, the left side is a wild-type embryo, and the right side is a homozygous knockout embryo.

[0022] Figure 5 Picture of the experimental scene of transplanting fertilized eggs cultured overnight into the fallopian tubes. DETAILED DESCRIPTION

[0023] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0024] Unless otherwise defined, the technical and scientific terms in this specification have the same meaning as those generally understood by those skilled in the art. Although similar or identical methods and materials as described herein may be used in experiments or practical applications, materials and methods are described herein below. In the event of a conflict, the present specification including the definitions therein shall prevail. In addition, materials, methods and examples are provided for illustration only and are not restrictive. The present application is further described below in conjunction with specific embodiments, but is not intended to limit the scope of the present application.

[0025] As used herein, the terms "polynucleotide", "nucleotide", "nucleotide sequence", "nucleic acid" and "oligonucleotide" are used interchangeably. They refer to a polymeric form of nucleotides (deoxyribonucleotides or ribonucleotides) of any length or their analogs. Examples of polynucleotides include, but are not limited to, coding or non-coding regions of genes or gene fragments, exons, introns, messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), short interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, DNA isolated from any sequence, RNA isolated from any sequence, nucleic acid probes and primers. One or more nucleotides in a polynucleotide may be further modified. The sequence of nucleotides may be interrupted by non-nucleotide components. Polynucleotides may also be modified after polymerization, for example by coupling with a labeling agent.

[0026] The term "CRISPR / Cas9" used in this article refers to an adaptive immune defense formed by bacteria and archaea during the long-term evolution process, which can be used to fight invading viruses and foreign DNA. CRISPR / Cas9 gene editing technology is a technology for specific DNA modification of targeted genes. CRISPR / Cas9-based gene editing technology has shown great application prospects in a series of gene therapy application fields, such as blood diseases, tumors and other genetic diseases. This technological achievement has been applied to the precise modification of the genomes of human cells, zebrafish, mice and bacteria.

[0027] As used herein, the terms "gRNA", "guide RNA" and "CRISPR guide sequence" are used interchangeably throughout and refer to nucleic acids containing sequences that determine the specificity of the Cas binding protein of the CRISPR / Cas system. The gRNA hybridizes (partially or fully complementary) to a target nucleic acid sequence in the genome of a host cell. The length of the gRNA or portion thereof that hybridizes to the target nucleic acid may be between 15-25 nucleotides, 18-22 nucleotides, or 19-21 nucleotides. In some embodiments, the length of the gRNA sequence that hybridizes to the target nucleic acid may be 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides. In some embodiments, the length of the gRNA sequence that hybridizes to the target nucleic acid is between 10-30 or 15-25 nucleotides.

[0028] The term "sgRNA" used in this article generally refers to a single-molecule guide RNA or a single-stranded guide RNA in an artificial CRISPR / Cas9 system, which refers to an RNA that guides the Cas protein to specifically bind to a target DNA sequence, and is an important component of the CRISPR gene knockout / knock-in system. The sgRNA of the present application comprises a guide sequence that targets a target sequence. In a preferred embodiment, the sgRNA of the present application further comprises a tracr sequence and a tracr partner sequence.

[0029] The "guide sequence" in this application refers to a sequence of about 17-20 bp that specifies a targeting site, and can be used interchangeably with a "guide sequence" or a "spacer". In the context of forming a CRISPR complex, a "target sequence" is a sequence with which a guide sequence is designed to be complementary, wherein hybridization between the target sequence and the guide sequence promotes the formation of a CRISPR complex, and the hybridization requires that the "target sequence" and the "guide sequence" or "guide sequence" have sufficient complementarity to cause hybridization and promote the formation of a CRISPR complex, and complete complementarity is not required.

[0030] "Complementary" means that the "guide sequence" or "guide sequence" and the target nucleotide sequence (for the present application, the target nucleotide sequence of the second exon region of the LMNA gene of the mouse fertilized egg) can hybridize through the nucleotide pairing principle discovered by Watson and Crick. It can be understood by those skilled in the art that as long as there is sufficient complementarity, the "guide sequence" can hybridize with the target nucleotide sequence without requiring 100% complete complementarity between them. In some embodiments, when optimally aligned using an appropriate alignment algorithm, the degree of complementarity between the guide sequence and its corresponding target sequence may be about or greater than about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more. Optimal alignment can be determined using any appropriate algorithm for aligning sequences, including the Smith-Waterman algorithm, the Needleman-Wimsch algorithm, an algorithm based on the Burrows-Wheeler Transform, and the like.

[0031] Typically, in the context of an endogenous CRISPR system, formation of a CRISPR complex (including hybridization of a guide sequence to a target sequence and complexing with one or more Cas proteins) results in cleavage of one or both strands in or near the target sequence (e.g., within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50 or more base pairs from the target sequence). Without wishing to be bound by theory, a tracr sequence can comprise all or a portion of a wild-type tracr sequence, e.g., about or greater than about 20, 23, 26, 29, 32, 35, 38, 41, 44, 47, 50, 53, 56, 59, 62, 65, 70, 75, 80, 85 or more nucleotides of a wild-type tracr sequence, or consisting of the above, can also form part of a CRISPR complex, e.g., by hybridization along at least a portion of the tracr sequence to all or a portion of a tracr partner sequence operably linked to a guide sequence.

[0032] In some embodiments, the tracr sequence has sufficient complementarity with the tracr partner sequence to hybridize and participate in the formation of the CRISPR complex. Similar to the hybridization of the "target sequence" and the "guide sequence" or "guide sequence", complete complementarity is not required, as long as it is sufficient to perform its function. In some embodiments, in the case of optimal alignment,

[0033] The tracr sequence has at least 50%, 60%, 70%, 80%, 90%, 95% or 99% complementarity along the length of the tracr partner sequence.

[0034] The term "gene knockout" or "knockout" used in this article refers to editing the gene in the cell (for example, inserting, replacing, and / or deleting the gene) so that the gene loses its original function (for example, it cannot express a functional protein). Various known molecular biology techniques (for example, using zinc finger nuclease-based gene editing technology, TALEN gene editing technology, and CRISPR / Cas (such as CRISPR / Cas9) gene editing technology) can be used to edit the gene in the cell genome. Gene knockout is not limited to the complete deletion or removal of the entire gene, as long as the gene loses its original function. For example, by inserting an exogenous DNA fragment in the gene, the gene cannot express a functional protein, or by inserting or deleting one or more bases in the gene, the gene undergoes a frameshift mutation to achieve the knockout of the gene. For example, CRISPR / Cas9 gene editing technology can be used in the gene knockout of the present application.

[0035] The term "vector" as used herein refers to a nucleic acid carrier into which a polynucleotide can be inserted. When a vector can express the protein encoded by the inserted polynucleotide, the vector is called an expression vector. The vector can be introduced into a host cell by transformation, transduction or transfection so that the genetic material elements it carries are expressed in the host cell. Vectors are well known to those skilled in the art, and include but are not limited to: plasmids; phagemids; artificial chromosomes, such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC) or artificial chromosomes (PAC) derived from P1; bacteriophages such as lambda phage or M13 phage and animal viruses, etc. Animal viruses that can be used as vectors include but are not limited to retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpes viruses (such as herpes simplex viruses), poxviruses, baculoviruses, papillomaviruses, papillomaviruses (such as SV40). A vector can contain a variety of elements that control expression, including but not limited to promoter sequences, transcription initiation sequences, enhancer sequences, selection elements and reporter genes. In addition, the vector may also contain a replication initiation site.

[0036] The term "microinjection" as used herein refers to the injection of a substance into an organ, tissue, cell or intracellular organelle of an organism. The substance may include a chemical substance, a polynucleotide or a polypeptide.

[0037] The present invention provides the nucleotide sequence of SEQ ID No.1:

[0038]

[0039] Example 1

[0040] gRNA design

[0041] At the second exon and the third exon of the mouse SP1 gene (SEQ ID No. 1), four sgRNAs for knockout were designed, namely the first sgRNA, the second sgRNA, the third sgRNA, and the fourth sgRNA;

[0042] Among them, the sequence of the second exon is: accaagatcactccatggatgaagtgacagctgtggtgaagattgaaaaagatgttggtggcaataatg ggggtagcggcaatggtggcggtgccgccttttctcagactcgaagcagcagcacaggcagtagcagca gcagtggtggcggaggagggcag;

[0043]

[0044] The sequence of the first sgRNA is: CCTAGAACTGGTGAACCACC (SEQ ID No. 2);

[0045] The sequence of the second sgRNA is: AGCTTAATGGTGCCCAAGAC (SEQ ID No. 3);

[0046] The sequence of the third sgRN is: GTTGTGGTACCAAGACACT (SEQ ID No. 4);

[0047] The sequence of the fourth sgRNA is: CTGACCCCTTGGTTTGCAAT (SEQ ID No. 5).

[0048] like Figure 1 As shown, the second exon and the third exon are the planned excision areas, and sgRNA1 is the first sgRNA, sgRNA2 is the second sgRNA, sgRNA3 is the third sgRNA, and sgRNA4 is the fourth sgRNA;

[0049] The first sgRNA and the second sgRNA are used to identify and excise the second exon;

[0050] The third and fourth sgRNAs are used to identify and excise the third exon.

[0051] Example 2

[0052] PCR amplification and product gel electrophoresis identification

[0053] Using NCBI Primer-BLAST, two pairs of primers were designed for PCR amplification, wherein the upstream sequence of the outer primer was CCAAACCTGGGTTCTAATCCCT (SEQ ID No. 6), and the downstream sequence was TTTCTCATATGGTGCTGAACATGG (SEQ ID No. 7), and the upstream sequence of the inner primer was CCAAACCTGGGTTCTAATCCCT (SEQ ID No. 8) and the downstream sequence was CGCTACCCCCATTATTGCCA (SEQ ID No. 9).

[0054] The amplified product was tested by 1.5% agarose gel electrophoresis. Figure 1Wherein, M is D2000 Marker, the bands are 200bp, 500bp, 800bp, 1000bp, 1500bp, 2000bp, 4000bp, and the electrophoresis detection results show that the outer primer band of SP1 knockout embryos is 900-1300bp, and the inner primer has no band.

[0055] Example 3

[0056] Preparation of gene editing fluid

[0057] Add 2 μL of 5× electroporation buffer, 1.75 μL of the first sgRNA, 1.75 μL of the second sgRNA, 1.75 μL of the third sgRNA, 1.75 μL of the fourth sgRNA, and 1 μL of Cas9 protein into the tube, mix and place in a PCR instrument, react at 37°C for 15 minutes, and add 10 μL of Opti-MEM culture medium to prepare the gene editing solution.

[0058] Example 4

[0059] Gene editing solution is transfected into fertilized eggs through electroporation.

[0060] For superovulation of female mice: prepare 100 IU / mL of PMSG and 100 IU / mL of HCG, inject 10 IU PMSG intraperitoneally into 6-week-old C57BL / 6N female mice, and then inject 10 IU HCG intraperitoneally 48 hours later. Then, immediately put them in the cage with male mice in a 1:1 ratio.

[0061] Prepare embryo culture droplets: 5-6 hours before gene editing, make several 20 μL KSOM culture droplets in a culture dish, cover with mineral oil, and place in a 37°C 5% CO2 incubator for 5-6 hours.

[0062] Electroporation of fertilized eggs: Check the vaginal plug the next morning after cage closure, take out the superovulated female mice with plugs, and kill them by dislocating the neck after anesthesia. Spray alcohol on the abdomen, cut open the abdomen, and take out the oviduct containing the enlarged part (such as Figure 5 As shown), the fertilized eggs were placed in hyaluronidase at 37°C for two minutes for digestion, and then the fertilized eggs were transferred to M2 culture medium for washing three times, and then the fertilized eggs were transferred to gene editing solution for electroporation transfection ( Figure 1 Schematic diagram of mouse embryo Sp1 knockout of the present invention, wherein 4 sgRNAs are marked in purple, the blue marked area contains the knocked out 2nd and 3rd exons, and red and green indicate the design positions of PCR primers for identifying mouse genotypes). After completion, the fertilized eggs were washed three times with M2 culture medium, and then transferred to KSOM culture medium droplets, cultured in a 5% CO2 incubator at 37°C overnight, and transplanted into the oviduct of a surrogate female mouse the next day. The mouse embryos were taken out on the sixth day of development (ie, E7.5) for sampling and genotype identification.

[0063] Example 5

[0064] Genotyping of SP1 knockout embryos

[0065] Take some tissues from mouse embryos (such as Figure 4 As shown, the left side is a wild-type embryo, and the right side is a homozygous knockout embryo). DNA lysis buffer was added to obtain DNA, and PCR amplification was performed using embryonic DNA as a template. The reaction system was: 5 μL PCR enzyme, 3 μL H 2 O, 1 μL DNA template, 0.5 μL upstream primer, 0.5 μL downstream primer. Reaction conditions: 98°C for 30 seconds; (98°C for 15 seconds, 62°C for 15 seconds, 72°C for 45 seconds) × 32 cycles; 72°C for 5 minutes.

[0066] RNA-seq sequencing identification: Collect samples and add 0.2% Triton X-100 to extract mRNA, enrich mRNA with poly-A tail by oligo (dT) magnetic beads, and then reverse transcribe to synthesize cDNA. Then, construct the library according to the instructions of Vazyme kit TD502; use Qubit4 fluorescence quantification instrument to determine DNA concentration. Send the constructed DNA library to the company for sequencing. The sequencing results are as follows Figure 3 As shown, the second and third exons of the SP1 gene of the wild-type embryo still have signal peaks, while the second and third exons of the SP1 gene of the homozygous knockout embryo have no signal peaks.

[0067] The above results show that the mouse embryo model of SP1 gene knockout was successfully constructed, and RNA-seq sequencing analysis confirmed that the target knockout region had been successfully knocked out, providing good materials for further exploring the potential mechanism of transcription factor SP1 regulating germ layer differentiation and development of early mouse embryos.

[0068] Although the embodiments of the present invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that all equivalent changes and improvements made within the scope of the present invention should still fall within the scope of the patent coverage of the present invention.

Claims

1. A method for constructing a mouse embryo model with SP1 gene knockout, characterized in that: The construction method comprises: Using CRISPR / Cas9 gene editing technology, preparing a gene editing solution comprising Cas9 and sgRNA for targeting the second and third exon regions of the mouse SP1 gene; Injecting the gene editing injection solution into a fertilized egg of a mouse; The two cells obtained by the division of the injected fertilized egg were transplanted into the uterus of a pseudopregnant mouse to obtain a mouse embryo model with SP1 gene knockout.

2. The construction method according to claim 1, characterized in that: The sgRNA for targeting the second exon region of the mouse SP1 gene (as shown in SEQ ID NO.1) is selected from the first sgRNA shown in SEQ ID NO.2 and the second sgRNA shown in SEQ ID NO.3, and the sgRNA for targeting the third exon region of the mouse SP1 gene (as shown in SEQ ID NO.1) is selected from the third sgRNA shown in SEQ ID NO.4 and the fourth sgRNA shown in SEQ ID NO.

5.

3. The construction method according to claim 1, characterized in that: The gene editing solution comprises 5× electroporation buffer, a first sgRNA, a second sgRNA, a third sgRNA, a fourth sgRNA, a Cas9 protein, and an Opti-MEM culture medium.

4. The construction method according to claim 1, characterized in that: The volume ratio of Cas9 protein, Opti-MEM culture medium, 5× electroporation buffer, first gRNA, second gRNA, third gRNA, and fourth gRNA in the gene editing solution is 1 μL: 10 μL: 2 μL: 1.75 μL: 1.75 μL: 1.75 μL: 1.75 μL.

5. The construction method according to claim 1, characterized in that: The injection method is electroporation transfection injection.

Images