Gene therapy treatment

Abstract

The present disclosure relates to a transcription cassette comprising a nucleic acid molecule, wherein the nucleic acid molecule comprises a nucleotide sequence encoding an AP-4 subunit; a vector comprising the transcription cassette; a pharmaceutical composition comprising the carrier; and a vector or composition for use in the treatment of AP-4-hereditary spasmodic paraplegia.

Description

Technical Field

[0001] The present disclosure relates to a transcription cassette comprising a nucleic acid molecule, wherein the nucleic acid molecule comprises a nucleotide sequence encoding at least one subunit of heterotetrameric adaptor protein complex 4 (AP-4); a vector comprising the transcription cassette; a pharmaceutical composition comprising the vector; and a vector or composition for treating AP-4 hereditary spastic paraplegia. Background Art

[0002] Hereditary spastic paraplegia (HSP) is a rare, inherited, progressive, lower limb spasticity disorder with an overall incidence of 0.5-5.5 per 100,000 people. HSP in young patients is usually characterized by weakness and spasticity (rigidity) of the legs and may lead to further complications later in life, requiring the use of crutches, walkers, or wheelchairs. There are several different types of inheritance of HSP, such as autosomal dominant, autosomal recessive, X-linked, and maternally inherited (mitochondrial) forms, of which the autosomal dominant form is the most common, affecting 75-80% of HSP patients. CN1958605 discloses a variety of different diagnostic methods for identifying gene mutations that cause different forms of HSP, such as autosomal recessive HSP (AR-HSP) caused by mutations in the genes KIAA1840 (US10519503) or ZFYVE26 (US2017152562), or autosomal dominant HSP caused by mutations in SPG3A.

[0003] AP-4-related hereditary spastic paraplegia (AP-4-HSP), sometimes referred to as AP-4 deficiency syndrome or adaptor protein complex 4 (AP-4) deficiency, is caused by loss-of-function mutations in any of the four genes encoding protein subunits of the AP-4 adaptor complex

[10] . AP-4-HSP is inherited in an autosomal recessive manner. AP-4-HSP caused by mutations in the AP4B1 gene, sometimes referred to as spastic paraplegia type 47 (SPG47) or hereditary spastic paraplegia 47 (HSP47), results in a significant decrease in AP4B1 protein levels [2]. AP-4-HSP can also be caused by mutations in the other three AP-4 subunits: mutations in AP4M1 result in AP-4-HSP, sometimes referred to as SPG50 or HSP50, mutations in AP4E1 result in AP-4-HSP, sometimes referred to as SPG51 or HSP51, and mutations in AP4S1 result in AP-4-HSP, sometimes referred to as SPG52 or HSP51. Regardless of the gene in which the pathogenic mutation occurs, the features of AP-4-HSP are very similar. AP-4-HSP typically presents in early childhood and causes spasticity, moderate to severe intellectual disability, speech impairment or aphasia, cerebellar malformations, epilepsy, shyness, and, in severe cases, quadriplegia

[11] . To date, 199 children have been diagnosed with AP-4-HSP worldwide[1], however, cases are likely underreported. AP-4-HSP is progressive and no disease-modifying treatments are currently available. Therefore, new treatments need to be developed to improve outcomes for subjects with AP-4-HSP.

[0004] AP4B1 is a component of the AP-4 heterotetramer ( Figure 1 A). The complete AP-4 complex consists of two large adaptor proteins (ε-type subunit AP4E1 and β-type subunit AP4B1), one medium adaptor protein (μ-type subunit AP4M1), and one small adaptor protein (σ-type AP4S1). The AP-4 complex forms a non-clathrin-associated coating on vesicles exiting the trans-Golgi network (TGN) and may be involved in targeting proteins from the TGN to the endosomal-lysosomal system ( Figure 1 B). It is also involved in the sorting of proteins to the basolateral membrane in epithelial cells and in the correct asymmetric localization of proteins in neurons. AP-4-positive TGN-derived vesicles are essential for the correct spatial formation of autophagosomes, and thus loss of the AP-4 complex impairs autophagosome formation in distal axons. Therefore, the AP-4 complex is essential for the normal function of the brain.

[0005] Adeno-associated virus (AAV) vectors are known in the art and have several advantages over retroviral or lentiviral vectors, such as their mild immune response, ability to infect a variety of cells, and the fact that the desired DNA is not integrated into the genome, leading to potential disruption and knockout of other genes, but is stored extrachromosomally in the cell. AAV contains a single-stranded DNA genome of approximately 4.8 kilobases (kb) containing three genes, whose coding sequences are flanked by inverted repeats, which are required for genome replication and packaging. The uses of AAV and modified AAV vectors are known in the art and are disclosed in WO2019 / 032898, WO2020041498, or WO2019 / 028306. AAV vectors have completed multiple Phase I and Phase II clinical trials for gene delivery for the treatment of cystic fibrosis and congestive heart failure, and are approved for use as a therapy for the treatment of spinal muscular atrophy.

[0006] In our co-pending application WO2021 / 205028, the contents of which are incorporated herein in their entirety, we disclosed a transcription cassette comprising a nucleic acid molecule encoding an AP-4 polypeptide.

[0007] Disclosed herein are optimized expression vectors comprising an AP-4 nucleic acid molecule operably linked to expression control sequences suitable for expression in mammalian neurons (e.g., motor neurons), and the use of modified expression vectors to deliver and functionally replace dysfunctional AP-4 proteins in the prevention or treatment of symptoms associated with HSP. The present disclosure relates to the development of modified vectors, such as AAV vectors, enhanced AAV vectors, comprising nucleic acid molecules encoding proteins of the AP-4 complex. Summary of the invention

[0008] According to one aspect of the present invention, there is provided an isolated nucleic acid molecule comprising: a transcription cassette comprising, between a first and a second inverted repeat sequence, in the 5' to 3' direction:

[0009] i) a promoter suitable for expression in mammalian neurons, wherein the promoter is associated with an enhancer nucleotide motif;

[0010] ii) intronic nucleotide sequences; and

[0011] iii) a polyadenylation signal nucleotide sequence; wherein

[0012] The cassette also comprises a nucleic acid molecule comprising a nucleotide sequence encoding at least one protein of the AP-4 complex.

[0013] In a preferred embodiment of the present invention, the enhancer motif is the CMV enhancer.

[0014] In a preferred embodiment of the present invention, the CMV enhancer motif comprises the nucleotide sequence in SEQ ID NO: 1 or a polymorphic nucleotide sequence variant thereof, or consists of the nucleotide sequence in SEQ ID NO: 1 or a polymorphic nucleotide sequence variant thereof.

[0015] Preferably, the hybrid intron comprises the nucleotide sequence in SEQ ID NO: 2 or a polymorphic sequence variant thereof, or consists of the nucleotide sequence in SEQ ID NO: 2 or a polymorphic sequence variant thereof.

[0016] In a preferred embodiment of the present invention, the polyadenylation signal is the growth hormone (GH) polyadenylation signal.

[0017] Preferably, the GH polyadenylation signal comprises or consists of the nucleotide sequence in SEQ ID NO: 4 or a polymorphic sequence variant thereof.

[0018] In a preferred embodiment of the present invention, the promoter is the chicken beta actin promoter.

[0019] Preferably, the chicken β-actin promoter comprises the nucleotide sequence in SEQ ID NO:3, or consists of the nucleotide sequence in SEQ ID NO:3.

[0020] Preferably, the chicken β-actin promoter comprises the nucleotide sequence in SEQ ID NO:28, or consists of the nucleotide sequence in SEQ ID NO:28.

[0021] In a preferred embodiment of the present invention, the transcription cassette comprises the nucleotide sequence in SEQ ID NO:9, or consists of the nucleotide sequence in SEQ ID NO:9.

[0022] A polymorphic sequence variant is a sequence that differs from a reference sequence by one or more nucleotide bases (eg, 2, 3, 4, 5 or more bases).

[0023] In a preferred embodiment of the present invention, the expression cassette comprises a nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of:

[0024] i) the nucleotide sequence or polymorphic sequence variant as shown in SEQ ID NO: 15 (AP4B1);

[0025] ii) a nucleotide sequence, wherein said sequence is degenerate to the nucleotide sequence defined in (i) due to the genetic code;

[0026] iii) a nucleic acid molecule whose complementary strand hybridizes with SEQ ID NO: 15 (AP4B1) under stringent hybridization conditions

[0027] hybridizes with a sequence in, wherein the nucleic acid molecule encodes a polypeptide that forms a complex with a polypeptide comprising an AP-4 complex;

[0028] iv) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 16 (AP4B1);

[0029] v) a nucleotide sequence encoding a polypeptide comprising an amino acid sequence, wherein the amino acid sequence is modified by addition, deletion or substitution of at least one amino acid residue as indicated in iv), wherein the polypeptide forms a complex with a polypeptide comprising the AP-4 complex.

[0030] Hybridization of nucleic acid molecules occurs when two complementary nucleic acid molecules bind to each other by a certain amount of hydrogen bonding. The stringency of hybridization can vary depending on the environmental conditions surrounding the nucleic acid, the nature of the hybridization method, and the composition and length of the nucleic acid molecules used. Calculations of hybridization conditions required to achieve a particular stringency are discussed in Sambrook et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2001); and Tijssen, Laboratory Techniques in Biochemistry and Molecular Biology—Hybridization with Nucleic Acid Probes Part I, Chapter 2 (Elsevier, New York, 1993). m It is the temperature at which 50% of a given strand of a nucleic acid molecule is hybridized to its complementary strand. The following is an exemplary set of hybridization conditions, but is not limiting:

[0031] Very high stringency (allowing sequences with at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to hybridize)

[0032] Hybridization: 5x SSC, 65°C, 16 hours

[0033] Wash twice: 2x SSC, room temperature (RT), 15 min each

[0034] Wash twice: 0.5x SSC, 65°C, 20 min each

[0035] High stringency (allowing sequences with at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or 89% identity to hybridize)

[0036] Hybridization: 5x-6x SSC, 65℃-70℃, 16-20 hours

[0037] Wash twice: 2x SSC, room temperature, 5-20 minutes each

[0038] Wash twice: 1x SSC, 55°C-70°C, 30 min each

[0039] Low stringency (allowing hybridization of sequences with at least 50%, 55%, 60%, 65%, 70% or 75% identity)

[0040] Hybridization: 6x SSC, room temperature to 55°C, 16-20 hours

[0041] Wash at least twice: 2x-3x SSC, room temperature to 55°C, 20-30 min each.

[0042] In a preferred embodiment of the present invention, the expression cassette comprises a nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of:

[0043] i) the nucleotide sequence or polymorphic sequence variant as shown in SEQ ID NO: 17 (AP4E1);

[0044] ii) a nucleotide sequence, wherein said sequence is degenerate to the nucleotide sequence defined in (i) due to the genetic code;

[0045] iii) a nucleic acid molecule, the complementary strand of which hybridizes to the sequence in SEQ ID NO: 17 (AP4E1) under stringent hybridization conditions, wherein the nucleic acid molecule encodes a polypeptide that forms a complex with a polypeptide comprising the AP-4 complex;

[0046] iv) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 18 (AP4E1);

[0047] v) a nucleotide sequence encoding a polypeptide comprising an amino acid sequence, wherein the amino acid sequence is modified by addition, deletion or substitution of at least one amino acid residue as indicated in iv), wherein the polypeptide forms a complex with a polypeptide comprising the AP-4 complex.

[0048] In a preferred embodiment of the present invention, the expression cassette comprises a nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of:

[0049] i) the nucleotide sequence or polymorphic sequence variant as shown in SEQ ID NO: 19 (AP4M1);

[0050] ii) a nucleotide sequence, wherein said sequence is degenerate to the nucleotide sequence defined in (i) due to the genetic code;

[0051] iii) a nucleic acid molecule, the complementary strand of which hybridizes to the sequence in SEQ ID NO: 19 (AP4M1) under stringent hybridization conditions, wherein the nucleic acid molecule encodes a polypeptide that forms a complex with a polypeptide comprising the AP-4 complex;

[0052] iv) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 20 (AP4M1);

[0053] v) a nucleotide sequence encoding a polypeptide comprising an amino acid sequence, wherein the amino acid sequence is modified by addition, deletion or substitution of at least one amino acid residue as indicated in iv), wherein the polypeptide forms a complex with a polypeptide comprising the AP-4 complex.

[0054] In a preferred embodiment of the present invention, the expression cassette comprises a nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of:

[0055] i) the nucleotide sequence or polymorphic sequence variant as shown in SEQ ID NO: 21 (AP4S1);

[0056] ii) a nucleotide sequence, wherein said sequence is degenerate to the nucleotide sequence defined in (i) due to the genetic code;

[0057] iii) a nucleic acid molecule, the complementary strand of which hybridizes to the sequence in SEQ ID NO: 21 (AP4S1) under stringent hybridization conditions, wherein the nucleic acid molecule encodes a polypeptide that forms a complex with a polypeptide comprising the AP-4 complex;

[0058] iv) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 22 (AP4S1); a nucleotide sequence encoding a polypeptide comprising an amino acid sequence, wherein the amino acid sequence is modified by adding, deleting or substituting at least one amino acid residue as shown in iv), wherein the polypeptide forms a complex with a polypeptide comprising an AP-4 complex.

[0059] In a preferred embodiment of the invention, the cassette is suitable for expression in motor neurons.

[0060] In a preferred embodiment of the present invention, the nucleic acid molecule comprises the nucleotide sequence shown in SEQ ID NO: 15 or a polymorphic sequence variant thereof, or consists of the nucleotide sequence shown in SEQ ID NO: 15 or a polymorphic sequence variant thereof.

[0061] In a preferred embodiment of the present invention, a nucleotide sequence or a polymorphic sequence variant thereof is provided, which encodes a polypeptide comprising the amino acid sequence shown in SEQ ID NO:16.

[0062] In a preferred embodiment of the present invention, the nucleic acid molecule comprises the nucleotide sequence shown in SEQ ID NO: 17 or a polymorphic sequence variant thereof, or consists of the nucleotide sequence shown in SEQ ID NO: 17 or a polymorphic sequence variant thereof.

[0063] In a preferred embodiment of the present invention, a nucleotide sequence or a polymorphic sequence variant thereof is provided, which encodes a polypeptide comprising the amino acid sequence shown in SEQ ID NO:18.

[0064] In a preferred embodiment of the present invention, the nucleic acid molecule comprises the nucleotide sequence shown in SEQ ID NO: 19 or a polymorphic sequence variant thereof, or consists of the nucleotide sequence shown in SEQ ID NO: 19 or a polymorphic sequence variant thereof.

[0065] In a preferred embodiment of the present invention, a nucleotide sequence or a polymorphic sequence variant thereof is provided, which encodes a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 20.

[0066] In a preferred embodiment of the present invention, the nucleic acid molecule comprises the nucleotide sequence shown in SEQ ID NO: 21 or a polymorphic sequence variant thereof, or consists of the nucleotide sequence shown in SEQ ID NO: 21 or a polymorphic sequence variant thereof.

[0067] In a preferred embodiment of the present invention, a nucleotide sequence or a polymorphic sequence variant thereof is provided, which encodes a polypeptide comprising the amino acid sequence shown in SEQ ID NO:22.

[0068] The amino acid sequences of the polypeptides disclosed herein may differ by one or more substitutions, additions, deletions, truncations, which may be present in any combination. Preferred variants include those that differ from the reference polypeptide by conservative amino acid substitutions. Such substitutions are substitutions of a given amino acid with another amino acid having similar characteristics. The following non-limiting list of amino acids is considered conservative substitutions (similar): a) alanine, serine and threonine; b) glutamic acid and aspartic acid; c) asparagine and glutamine; d) arginine and lysine; e) isoleucine, leucine, methionine and valine; f) phenylalanine, tyrosine and tryptophan. Most preferred are variants that retain or enhance the same biological function and activity as the reference polypeptide (the variant is changed from the reference polypeptide). In one embodiment, the polypeptide has at least 70% identity with the full-length amino acid sequence or nucleotide sequence shown herein, even more preferably at least 75% identity, more preferably at least 80%, 85%, 90%, 95% identity and at least 99% identity.

[0069] In an alternative preferred embodiment of the present invention, the promoter is a constitutive promoter.

[0070] In another alternative embodiment of the present invention, the promoter is a regulatable promoter, such as an inducible promoter or a cell-specific promoter.

[0071] In a preferred embodiment of the present invention, the promoter is selected from the group consisting of chicken β-actin (CBA) promoter, chicken β-actin hybrid (CBh) promoter, CAG promoter, JeT promoter, neuron and glial specific promoters (including synapsin 1, Hb9, MeP229 and GFAP promoter sequences), and AP-4 subunit specific promoter regions (including AP4B1, AP4E1, AP4M1 and AP4S1).

[0072] In a preferred embodiment of the present invention, the promoter is the chicken beta actin hybrid (CBh) promoter as shown in SEQ ID NO:9.

[0073] In an alternative preferred embodiment of the present invention, the promoter is the chicken beta actin hybrid (CBh) promoter as shown in SEQ ID NO:28.

[0074] In an alternative preferred embodiment of the present invention, the promoter is a JeT promoter comprising or consisting of the nucleotide sequence in SEQ ID NO:5.

[0075] In an alternative preferred embodiment of the present invention, the promoter is the hSyn promoter comprising or consisting of the nucleotide sequence in SEQ ID NO:6.

[0076] In an alternative preferred embodiment of the present invention, the promoter is the MeP229 promoter comprising or consisting of the nucleotide sequence in SEQ ID NO:7.

[0077] In an alternative preferred embodiment of the present invention, the promoter is an AP4B1 promoter comprising or consisting of the nucleotide sequence in SEQ ID NO:8.

[0078] "Promoter" or "transcription promoter" is recognized in the art and includes the following features for clarity, which are provided as examples only and are not restrictive. Enhancer elements are cis-acting nucleic acid sequences, usually located at the 5' end of the gene transcription start site (enhancers can also be located at the 3' end of the gene sequence, or even in the intron sequence). The role of enhancers (such as CMV enhancers) is to increase the transcription rate (rate) of the gene to which the enhancer is connected. Enhancer activity is responsive to trans-acting transcription factors (polypeptides) that have been shown to specifically bind to enhancer elements. The binding / activity of transcription factors (see Eukaryotic Transcription Factors, by David S Latchman, Academic Press Ltd, San Diego) is responsive to a variety of physiological / environmental signals, which can be constitutive or regulatable, or cell / tissue specific. Promoter elements also include so-called TATA boxes and RNA polymerase initiation selection (RIS) sequences, whose function is to select transcription start sites. These sequences also bind polypeptides, and their functions include promoting the transcription start selection of RNA polymerase.

[0079] As used herein, a first nucleic acid comprising a promoter sequence and a second nucleotide sequence encoding a polypeptide are said to be "operably" linked when they are covalently linked so that the expression or transcription of the second nucleic acid molecule is under the control of the first nucleic acid molecule comprising a regulatory sequence. If it is desired that the coding sequence be translated into a functional protein, then if induction of the promoter in the 5' regulatory sequence results in transcription of the coding sequence and production of mRNA, the two DNA sequences are said to be operably linked. Thus, if the promoter region is able to affect the transcription of the DNA sequence so that the resulting transcript is translated into the desired protein or polypeptide, then the promoter region will be operably linked to the coding sequence.

[0080] According to another aspect of the present invention, there is provided an expression vector comprising the transcription cassette according to the present invention.

[0081] Viruses are commonly used as carriers for exogenous gene delivery. Commonly used carriers include recombinantly modified enveloped or non-enveloped DNA and RNA viruses, such as baculoviridae, parvoviridae, picornoviridiae, herpesveridiae, poxviridae, adenoviridae, picornnaviridiae or retroviridae, such as lentivirus. Chimeric vectors can also be used, which utilize the favorable elements of each parent vector characteristic (see, for example, Feng, et al (1997) Nature Biotechnology 15: 866-870). Such viral vectors can be wild-type, or they can be modified to replication-defective, conditional replication or replication-competent types by recombinant DNA technology. Conditional replication viral vectors are used to achieve selective expression in specific cell types while avoiding poor broad-spectrum infection. Examples of conditionally replicating vectors are described in Pennisi, E. (1996) Science 274:342-343; Russell, and SJ (1994) Eur. J. of Cancer 30A(8):1165-1171.

[0082] Preferred vectors are derived from adenoviral, adeno-associated viral or retroviral genomes.

[0083] In a preferred embodiment of the present invention, the expression vector is a virus-based expression vector.

[0084] In a preferred embodiment of the present invention, the viral-based vector is adeno-associated virus [AAV].

[0085] In a preferred embodiment, the viral-based vector is selected from the group consisting of: AAV2, AAV3, AAV6, AAV13; AAV1, AAV4, AAV5, AAV6, AAV9 and rhAAV10.

[0086] In a preferred embodiment of the present invention, the viral-based vector is AAV9.

[0087] In a preferred embodiment of the present invention, the viral-based vector is an enhanced AAV9 vector, such as a PHP-b vector.

[0088] In a preferred embodiment of the present invention, the AAV vector is based on a single-stranded AAV virus.

[0089] In an alternative embodiment of the invention, the AAV vector is based on a self-complementary AAV virus.

[0090] Naturally occurring AAV serotypes typically contain a single-stranded genome that is replicated during natural infection to form a double-stranded AAV viral genome. This is the rate-limiting step for AAV replication and expression. A recombinant form of AAV containing positive and antisense genomic strands suitable for immediate expression and replication is called self-complementary AAV. Virus-based vectors can contain genes encoding kanamycin resistance, or can lack genes encoding kanamycin resistance for treatment.

[0091] In a preferred embodiment of the present invention, the virus-based vector comprises the nucleotide sequence shown in SEQ ID NO:10.

[0092] In a preferred embodiment of the present invention, the virus-based vector comprises the nucleotide sequence shown in SEQ ID NO:11.

[0093] In a preferred embodiment of the present invention, the virus-based vector comprises the nucleotide sequence shown in SEQ ID NO:12.

[0094] In a preferred embodiment of the present invention, the virus-based vector comprises the nucleotide sequence shown in SEQ ID NO:13.

[0095] In a preferred embodiment of the present invention, the virus-based vector comprises the nucleotide sequence shown in SEQ ID NO:14.

[0096] In a preferred embodiment of the present invention, the virus-based vector comprises the nucleotide sequence shown in SEQ ID NO:23.

[0097] In a preferred embodiment of the present invention, the virus-based vector comprises the nucleotide sequence shown in SEQ ID NO:24.

[0098] In a preferred embodiment of the present invention, the virus-based vector comprises the nucleotide sequence shown in SEQ ID NO:25.

[0099] In a preferred embodiment of the present invention, the virus-based vector comprises the nucleotide sequence shown in SEQ ID NO:26.

[0100] In a preferred embodiment of the present invention, the virus-based vector comprises the nucleotide sequence shown in SEQ ID NO:27.

[0101] Preferably, the viral-based vector sequence selected from the group consisting of SEQ ID NOs 10-14 and 23-27 lacks a kanamycin resistance gene and is flanked by 5' and 3' reverse terminal repeat (ITR) sequences. As known in the prior art, only the sequences between the ITRs are packaged into clinical viral vectors and delivered to patients. The transgene encoded within the recombinant AAV (flanked by ITRs) is then present as an episome in the nucleus of the transduced cell (e.g., non-dividing neuronal cell) and provides long-term expression.

[0102] In an alternative preferred embodiment of the present invention, the viral-based vector is a lentiviral vector.

[0103] According to another aspect of the present invention, a pharmaceutical composition is provided, which comprises the expression vector according to the present invention and an excipient or carrier.

[0104] The expression vector composition of the present invention is administered in the form of a pharmaceutically acceptable preparation. Such preparations may generally contain pharmaceutically acceptable concentrations of salts, buffers, preservatives, compatible carriers, and adjuvant therapeutic agents. The expression vector composition of the present invention may be administered by any conventional route, including injection or gradual infusion over time.

[0105] The expression vector compositions of the present invention are administered in an effective amount. An "effective amount" refers to the amount of the expression vector that produces the desired response alone or in combination with other doses. In the case of treating a disease, the desired response is to inhibit the progression of the disease. This may only involve temporarily slowing the progression of the disease, but more preferably, it involves permanently stopping the progression of the disease. This can be monitored by conventional methods. Of course, these amounts will depend on the specific condition being treated, the severity of the condition, individual patient parameters (including age, physical condition, body shape and weight), duration of treatment, nature of concurrent treatment (if any), specific routes of administration, and similar factors within the knowledge and expertise of the medical practitioner. These factors are well known to those of ordinary skill in the art and can be resolved by routine experimentation. It is generally preferred to use the maximum dose of a single component or a combination thereof, i.e., the highest safe dose based on reasonable medical judgment. However, it should be understood by those of ordinary skill in the art that patients may insist on lower doses or tolerable doses for medical reasons, psychological reasons, or almost any other reason.

[0106] The expression vector composition used in the above method is preferably sterile and contains an effective amount of the expression vector according to the present invention to produce the desired response in a weight or volume unit suitable for application to the patient. The vector dosage applied to the subject can be selected according to different parameters, particularly according to the mode of administration used and the state of the subject. Other factors include the desired treatment period. If the subject does not respond adequately at the initial dose applied, a higher dose (or a higher dose actually achieved by a different, more localized delivery route) can be used within the range allowed by the patient's tolerance. Those of ordinary skill in the art will know other schemes for applying the vector composition, wherein the dosage, injection schedule, injection site, mode of administration, etc. are different from the aforementioned schemes. The composition is applied to mammals other than humans (for example, for testing purposes or veterinary treatment purposes) under substantially the same conditions as described above. The subject used herein is a mammal, preferably a human being, and includes non-human primates, cattle, horses, pigs, sheep, goats, dogs, cats or rodents.

[0107] The expression vector composition of the present invention is administered in a pharmaceutically acceptable amount and a pharmaceutically acceptable composition. The term "pharmaceutically acceptable" refers to a non-toxic substance that does not interfere with the effectiveness of the biological activity of the active agent. Such preparations may generally contain salts, buffers, preservatives, compatible carriers, and optional other therapeutic agents (e.g., those commonly used to treat specific disease indications). When used in medicine, the salt should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts can be conveniently used to prepare pharmaceutically acceptable salts thereof, and are not excluded from the scope of the present invention. Such pharmacologically and pharmaceutically acceptable salts include, but are not limited to, salts prepared from the following acids: hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, formic acid, malonic acid, succinic acid, etc. In addition, pharmaceutically acceptable salts can be prepared as alkali metal or alkaline earth salts, such as sodium salts, potassium salts, or calcium salts.

[0108] The pharmaceutical composition containing the expression vector according to the present invention may contain a suitable buffer, including acetic acid in salt, citric acid in salt, boric acid in salt and phosphoric acid in salt. The pharmaceutical composition may also optionally contain a suitable preservative, for example: benzalkonium chloride, chlorobutanol, p-hydroxybenzoate and thimerosal.

[0109] The expression vector composition can be conveniently present in unit dosage form and can be prepared by any method well known in the pharmaceutical field. All methods include the step of combining the active agent with a carrier constituting one or more auxiliary components. The preparation can be prepared using a suitable dispersant or wetting agent and a suspending agent according to known methods. The sterile injection preparation can also be a sterile injection solution or suspension in a non-toxic parenterally acceptable diluent or solvent, for example, as a solution in 1,3-butanediol. Acceptable solvents that can be used include water, Ringer's solution, and isotonic sodium chloride solution. In addition, sterile fixed oils are generally used as solvents or suspension media. For this purpose, any mild fixed oil can be used, including synthetic monoglycerides or diglycerides. In addition, fatty acids such as oleic acid can be used to prepare injections. Carrier formulations suitable for oral, subcutaneous, intravenous, intramuscular, etc. administration methods can be found in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA.

[0110] According to another aspect of the present invention, there is provided an expression vector according to the present invention for use as a medicament.

[0111] According to another aspect of the present invention, there is provided an expression vector according to the present invention for use in treating AP-4 hereditary spastic paraplegia in a subject.

[0112] Preferably, the subject is a pediatric subject.

[0113] Pediatric subjects include newborns (0-28 days), infants (1-24 months), toddlers (2-6 years), and preadolescents (7-14 years).

[0114] In a preferred embodiment of the present invention, the AP-4-HSP is SPG47

[0115] In a preferred embodiment of the present invention, the AP-4-HSP is SPG50.

[0116] In a preferred embodiment of the present invention, the AP-4-HSP is SPG51.

[0117] In a preferred embodiment of the present invention, the AP-4-HSP is SPG52.

[0118] Spastic Paraplegia (SPG) is used interchangeably with hereditary spastic paraplegia (HSP), thus SPG47 is HSP47, SPG50 is HSP50, SPG51 is HSP51, and SPG52 is HSP52.

[0119] According to another aspect of the present invention, there is provided a cell transfected with an expression vector according to the present invention.

[0120] In a preferred embodiment of the invention, the cells are neurons.

[0121] In a preferred embodiment of the invention, said neuron is a motor neuron.

[0122] According to another aspect of the present invention, there is provided a method for treating or preventing AP-4 hereditary spastic paraplegia, comprising administering a therapeutically effective amount of the expression vector according to the present invention to prevent and / or treat hereditary spastic paraplegia.

[0123] In a preferred method of the invention, the AP-4-HSP is spastic paraplegia type 47 (SPG47).

[0124] In a preferred method of the invention, the AP-4 HSP is spastic paraplegia type 50 (SPG50).

[0125] In a preferred method of the invention, the AP-4 HSP is spastic paraplegia type 51 (SPG51).

[0126] In a preferred method of the invention, the AP-4 HSP is spastic paraplegia type 52 (SPG52).

[0127] According to another aspect of the present invention, there is provided a method for measuring the efficacy of treating hereditary spastic paraplegia in a subject, wherein the subject is treated with the expression vector or pharmaceutical composition of the present invention, the method comprising:

[0128] a) measuring the level of neurofilament L (NFL) in a biological sample obtained from a subject suffering from hereditary spastic paraplegia before administering the expression vector according to the invention or the pharmaceutical composition according to the invention, and

[0129] b) comparing said level with the level of NFL in a biological sample obtained from a subject suffering from hereditary spastic paraplegia after administration of an expression vector or a pharmaceutical composition according to the present invention, wherein

[0130] i) if the NFL level is lower than the level obtained in step a), suspending treatment with the expression vector or composition, or

[0131] ii) If the level is substantially the same as in step a), continuing treatment with the expression vector or composition according to the invention.

[0132] In a preferred method of the present invention, the expression vector is selected from the group consisting of SEQ ID NO 10, 11, 12, 13, 14, 23, 24, 25, 26 and 27.

[0133] In a preferred method of the invention said sample in b) is obtained between 1, 2, 3, 4, 5 or 6 days or 1, 2, 3 or 4 weeks after administration.

[0134] According to another aspect of the present invention, there is provided a method for measuring the effect of a treatment of hereditary spastic paraplegia in a subject suffering from hereditary spastic paraplegia, wherein the subject is treated with an expression vector or a pharmaceutical composition according to the present invention, the method comprising:

[0135] a) measuring the level of neurofilament L (NFL) in a biological sample obtained from a subject suffering from hereditary spastic paraplegia and treated with the expression vector or composition, and

[0136] b) comparing the levels to those in control subjects.

[0137] In a preferred method according to the present invention, the expression vector is selected from the group consisting of SEQ ID NO 10, 11, 12, 13, 14, 23, 24, 25, 26 and 27.

[0138] In a preferred method of the present invention, the sample in a) is obtained between 1, 2, 3, 4, 5 or 6 days or 1, 2, 3 or 4 weeks after treatment with the expression vector or pharmaceutical composition according to the present invention.

[0139] In a preferred method of the present invention, the method further comprises step c), wherein the treatment is effective and is suspended when the level in the biological sample obtained from the subject with hereditary spastic paraplegia is the same as or lower than the NFL level in the biological sample obtained from the control subject.

[0140] In a preferred method of the present invention, the method further comprises step c), wherein when the level in the biological sample obtained from the subject with hereditary spastic paraplegia is higher than the NFL level in the biological sample obtained from the control subject, the treatment is ineffective and the treatment is continued using the expression vector or pharmaceutical composition according to the present invention.

[0141] Throughout the description of the specification and claims of this application, the words "comprise" and "contain" and their variations (such as "comprising" and "comprises") mean "including but not limited to", and are not intended to (and will not) exclude other parts, additives, components, elements (integers) or steps. "Essentially composed of..." means having the basic elements but including elements that do not have a substantial effect on the functions of the basic elements.

[0142] Throughout the description of the specification and claims of this application, unless the context requires otherwise, the singular includes the plural. Where the indefinite article is used, the specification is to be understood as contemplating both plural and singularity unless the context requires otherwise.

[0143] Features, elements, characteristics, compounds, chemical moieties or groups described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein unless there is an incompatibility.

[0144] Embodiments of the present invention will now be described, by way of example only, with reference to the following drawings:

[0145] Figure 1–AP4 complex and function: (A) Schematic diagram of the AP4 heterotetrameric complex, which is composed of large β-type and ε-type adaptor proteins (β4 and ε4, called AP4B1 and AP4E1), medium μ-type adaptor protein (APμ4, called AP4M1) and small σ-type adaptor protein (APσ4, called AP4S1). (B) Schematic diagram of AP4 complex function: 1) AP4 heterotetramers are recruited to the trans-Golgi network (TGN), which in turn recruits its cargo proteins, including ATG9. 2) Clatherin negative vesicles bud from the TGN. 3) AP4 complexes shed from vesicles and recycle back to the TGN for further vesicle formation. 4) The remaining vesicles bind to kinesin motor proteins and are transported along microtubules in the anterograde direction to the cell periphery or distal neuronal compartments. 5) ATG9 vesicles assemble to promote autophagosome formation;

[0146] Figure 2 – Design and validation of gene therapy vectors for AP4B1 gene replacement. (A) Schematic representation of the designed and positioned AAV and LV. (B) Representative Western blots of control (WT) or AP4B1 knockout (KO) HeLa cell lysates transfected with plasmids expressing GFP (+GFP) or hAP4B1 (+AAV-hAP4B1). Expression of hAP4B1 in the KO cell line restored the missing AP4B1 protein expression. Restoration of AP4B1 expression also restored the expression of AP4E1 subunit protein levels to WT levels. (C) Validation of AAV expressing V5-tagged AP4B1 in AP4B1- / - HeLa cells. (D) Non-transgenic rat cortical neurons stained with primary antibodies to the cortical neuron markers MAP2 (red channel) and V5 (green channel) after 10 days of treatment with 300,000 vg / cell AAV9-V5_hAP4B1. (E) Representative Western blots of non-disease control fibroblasts (Ctrl) and SPG47 patient fibroblasts (untreated (UT) and treated with increasing amounts of LV-V5_hAP4B1), showing restoration of hAP4B1 expression in the patient mutant cell line (left of the dashed line). Representative Western blots of cortical neurons of non-transgenic rats treated with 400,000 vg / cell AAV9 viral vectors: AAV9-V5_SPG47(hAP4B1); AAV9-SPG47(hAP4B1); AAV9-GFP; untransduced cells;

[0147] Figure 3– The effect of AB4B1 gene replacement was assessed using ATG9A as a readout. (A) Demonstrates aberrant localization of ATG9A to the TGN trans-Golgi network (TGN) in a CRISPR-generated Hela knockout cell model. In AP4B1- / - Hela cells, aberrant ATG9A localization was restored after transfection with an AAV9 construct encoding AP4B1 (B). Representative Western blots of LV-transduced patient cells show restored hAP4B1 expression and detection of V5 markers (C), quantified in (D). Transduced patient cells also show restored ATG9A expression (E), quantified in (F). Data are presented as mean + / - standard error of the mean (SEM), n = 3. Data were analyzed by one-way analysis of variance (ANOVA) followed by post hoc Dunnett's multiple comparison test relative to Ctrl. Asterisks indicate p ≤ 0.05 (*); p < 0.0001 (****); ns = not significant. (G) Lentiviral vector (LV)-mediated correction of abnormal ATG9A localization in primary fibroblasts of SPG47 patients. After treatment with LV-V5_hAP4B1, SPG47 patient cells marked with white asterisks showed that abnormal ATG9A localization was restored;

[0148] Figure 4 – Proof-of-concept study 1: biochemical and anatomical evaluation. The objective was to evaluate the effects of AAV9-CBh-AP4B1 gene replacement on key biochemical and anatomical defects found in Ap4b1- / -. (A) Study design. P1 mice were injected with AAV9 according to the two main paradigms of gene therapy delivery: intracerebrospinal fluid (intra-CSF) delivery via the intra-cisterna magna (ICM) or intravenous (IV) delivery via the facial vein. (B) Sample amounts used in the study. (C) Intra-cisterna magna delivery of AAV9-V5 alone and delivery of AAV9-V5-hAP4B1 outperformed IV delivery in transducing all regions of the CNS. Viral biodistribution in the brain, spinal cord, and cerebellum was determined by qPCR. N = 3 per tissue, results are shown as mean ± SEM.

[0149] Figure 5 – Intracisternal delivery of AAV9-V5-hAP4B1 was superior to intravenous delivery in inducing hAP4B1 mRNA expression in all regions of the CNS. RT-qPCR of hAP4B1 cDNA in brain, spinal cord, and cerebellum. N = 3 per tissue, results are shown as mean ± SEM.

[0150] Figure 6- AAV9-CBh-hAP4B1 gene therapy mediates restoration of brain weight deficit in the Ap4b1- / - mouse model. Mice were treated with AAV9 empty control (V5) or AAV9 expressing V5-tagged hAP4B1 virus. Hom = Ap4b1- / -.

[0151] Figure 7 .ICM delivery of AAV9-V5-hAP4B1 restores AP4E1 protein levels in the mouse CNS and is superior to intravenous delivery. Western blotting of protein extracts shows that AP4E1 levels in the mouse brain (A) and spinal cord (B) were restored in mice treated with ICM injection of AAV9-V5-hAP4B1. Intravenous delivery induced detectable AP4E1 restoration only in the spinal cord. N=3 per tissue, quantitative data are shown as mean±SEM.

[0152] Figure 8 .Mislocalised ATG9A, enlarged lateral ventricles and reduced corpus callosum thickness in the brain of Ap4b1(- / -) mice. Immunostaining of ATG9A in cerebellar sections showed aberrant localisation and increased expression in the Purkinje cell layer and deep cerebellar nuclei in Ap4b1(- / -) mice (A). The lateral ventricles are highlighted by dashed lines in NeuN-stained coronal brain sections of Ap4b1(- / -) mice. The graph shows quantification of the fold change in lateral ventricle area compared to WT animals. N=3, analysed by Kolmogorov-Smirnov test. ***p≤0.001 (B). Coronal sections stained with hematoxylin and eosin (H&E) showed reduced corpus callosum thickness in Ap4b1(- / -) mice. Graphs show quantification of corpus callosum thickness (normalized to slice thickness) as fold change compared to WT animals. Data are shown as mean ± SEM, n = 3, analyzed by Kolmogorov-Smirnov test. *p < 0.05 (C). Scale bars: 150 μm (A); 500 μm (C). Mo = molecular layer, Pc = Purkinje cell layer, Gr = granule cell layer, DCN = deep cerebellar nucleus, H&E = hematoxylin and eosin, ATG9A = autophagy-related protein 9A, CC = corpus callosum.

[0153] Fig. 9 AAV9-mediated AP4B1 gene replacement restores (A) corpus callosum thickness and (B) lateral ventricle enlargement in the Ap4b1- / - mouse model.

[0154] Fig.10Gene replacement of AP4B1 by AAV9 in the SPG47 mouse model restores normal localization of ATG9A in the cerebellum and brainstem.

[0155] Fig.11 Ap4b1(- / -) mice exhibit hindlimb clasp. Representative non-clasping (WT) and clasping (Ap4b1(- / -)) images are shown (A). Percentage of WT and Ap4b1(- / -) mice exhibiting hindlimb clasp at 3 months of age (B). AAV9-CBh-AP4B1 treatment reduces the clasping phenotype in Ap4b1- / -.

[0156] Fig.12 .Preliminary safety study in wild-type mice. Mice treated with AAV9-CBh-AP4B1 delivered via ICM showed no signs of adverse effects for up to 6 months. mRNA transgene expression (A) and viral genome distribution (B) were assessed in the brain, spinal cord, and peripheral organs. AAV gene therapy had no adverse effects on body weight and functional motor coordination in mice, as measured by rotarod at 4 weeks (B) and 6 months (C) after treatment. n = 5

[0157] Fig.13 The AP4B1 endogenous promoter sequence is shown;

[0158] Fig.14 GFP expression in HeLa cells under the control of MeP229, AP4 and hSyn promoters. The term "mock" indicates a control without GFP expression. As shown, expression was detected under all three promoters. The experiment was performed using three replicas for each sample. Data are presented as mean + SD.

[0159] Fig.15 : AAV9-CBh-hAP4B1 treated mice gain weight with age up to 180 days. Treatment at ~p60. (Females only to 165 days).

[0160] Fig.16 : Hindlimb clasping in treated mice. A. Shows the progression of clasping severity over time in untreated and V5-only treated SPG47 mice (ap4b1- / -). Wild-type mice showed no progression of hindlimb clasping during this period. All 3 treatment groups showed a reduction in the severity of hindlimb clasping. B and C are clasping data extracted from a time point at 120 days of age or 135 days of age, respectively. Both graphs clearly show a reduction in hindlimb clasping severity after all treatments.

[0161] Fig.17: Rotarod latency to fall 4 months after treatment (~p180).

[0162] Fig.18 : Brain weight after brain extraction. Females 2 months after injection (~P120). Males 4 months after injection (~P180).

[0163] Fig.19 : Preliminary corpus callosum thinning analysis 4 months after injection (males only). Panel A shows the corpus callosum (CC) in a relatively coronal position. Every other slice between position 1 and position 8 was sampled for CC analysis. B shows the change in CC width across the brain. The SPG47 V5 only (V5_only) group showed a reduction in CC thickness compared to wild-type CC thickness, and this data suggests that this phenotype can be restored by high-dose treatment. The CC width measurements here have been normalized for each brain section. C and D are data extracted from a single location, showing the same results.

[0164] Fig. 20 Effects of AAV9-AP4B1 gene replacement on neurofilament L (NFL) levels in cerebrospinal fluid (CSF) and plasma. Ap4b1- / - mice were treated with AAV9-hAP4B1 vector via the cisterna magna at P1. WT: wild type, UT: untreated Ap4b1- / -, V5: Ap4b1- / - treated with control empty vector, CBH: Ap4b1- / - treated with AAV9-CBh-AP4B1, SYN: Ap4b1- / - treated with AAV9-Synapsin 1-AP4B1.

[0165] SEQ ID NO Summary Table

[0166]

[0167]

[0168]

[0169]

[0170]

[0171]

[0172]

[0173]

[0174]

[0175]

[0176]

[0177]

[0178]

[0179]

[0180]

[0181]

[0182]

[0183]

[0184] Materials and methods

[0185] Ethics statement

[0186] All in vivo animal experiments were approved by the University of Sheffield Ethical Review Sub-Committee, UK Animal Procedures Committee, London, UK, and performed under project license 40 / 3739 in accordance with the Animal (Scientific Procedures) Act 1986. em5Lutzy / J mice and non-transgenic C57BL / 6J mice were housed in a controlled facility with a 12-h dark / 12-h light cycle (7 AM on / 7 PM off) and had free access to food and water. This study was reported in accordance with ARRIVE guidelines.

[0187] Viral vector construction

[0188] The main clinical vector pAAV-CBh-hAP4B1-Kan (SEQ ID NO 11) was synthesized by Genewiz. Briefly, the CBh promoter (SEQ ID NO 9), the gene of interest (hAP4B1 SEQ ID 15), and the human growth hormone (hGH) poly(A) signal (SEQ ID NO 4) were cloned between two AAV2 inverted terminal repeats (ITRs) in the Genewiz plasmid backbone. The CBh promoter was originally designed and described by Grey SJ, et al. 2011 as a novel, enhanced hybrid form of the chicken beta actin (CBA) promoter. CBh is able to provide high-level, ubiquitous neuronal expression, including motor neurons (Gray et al 2011). The CBh promoter is composed of three parts: CMV enhancer (SEQ ID NO 1), chicken β-actin promoter (SEQ ID NO 3) and hybrid intron formed by CBA intron 1 and minute virus of mice (MVM) VP intron (SEQ ID NO 2). Compared with the standard CMV enhancer, the CMV enhancer detailed in SEQ ID NO 1 contains an 18 bp deletion. There are short linker sequences between the 5'ITR and the CBh promoter, the CBh promoter and hAP4B1, the hAP4B1 and the hGH poly (A) signal, and the hGH poly (A) signal and the 3'ITR. The plasmid backbone also contains the f1 phage replication origin downstream of the 3'ITR, the kanamycin resistance gene downstream thereof, and the high copy number (pUC) replication origin immediately upstream of the 5'ITR. The complete plasmid consists of 6443 bp, of which the region packaged into AAV9 contains 3895 bp.

[0189] Preliminary safety study - cisterna magna delivery of viral gene therapy constructs in P1 mice.

[0190] Wild-type C57Bl / 6J mice were anesthetized with isoflurane on postnatal day 1 (P1). Induction occurred in 5% isoflurane, 3LO 2 During the injection, 1-2% isoflurane, 0.3 LO 2 / min Anesthesia was maintained for approximately 5 minutes. The cisterna magna was located using the Wee-Sight transilluminator vein finder (Phillips). The viral vector was injected directly into the cisterna magna of P1 mice (n=15 per group) using a stereotaxic apparatus containing a 33-gauge Hamilton syringe and an automatic perfusion pump. The solution was administered at a flow rate of 1 μL per minute; the maximum volume of solution administered to each animal was 5 μL. The maximum dose received by each animal was 5×10 10 Total vector genomes. The experimental schedule is as follows:

[0191] Day 1 – Postnatal day 0 (P0) – Foot pad tattoo for identification purposes

[0192] Day 2 - Postnatal day 1 (P1) - Up to 5 μL of viral vector or vehicle solution was injected into the cisterna magna under isoflurane anesthesia.

[0193] On day 29 (or day 170) – postnatal day 28 (P28) or P168 (6 months after injection) – animals were perfused under terminal anesthesia, and tissue samples were collected for analysis.

[0194] Delivery of viral gene therapy constructs via the cisterna magna in P1 mice as proof-of-concept.

[0195] A subsequent study was performed to evaluate the efficacy of our therapeutic viral vector in transgenic mice lacking endogenous Ap4b1 (KO C57BL / 6J-Ap4b1 em5Lutzy / J) of the central nervous system (CNS). Mice were injected through the cisterna magna as described previously for safety studies. Two viral vectors were used: an AAV9 expressing a full-length copy of the human AP4B1 (SPG47) gene and an AAV9 expressing the V5 marker without additional coding sequences as a viral control. Mice receiving the AAV9-hAP4B1 viral vector were injected with two different doses (2×10 10 The low dose of vector genomes and 4×10 10 The mice that received AAV9-V5 were injected with only a high dose (4 × 10 10 Two additional groups were included in the study: untreated KO C57BL / 6J-Ap4b1 em5Lutzy / J and untreated WT C57BL / 6J-Ap4b1 em5Lutzy / J. The restoration of the phenotype of treated mice was assessed by improvements in behavioral parameters compared to untreated mice, which will be described in detail below.

[0196] Genotyping and population maintenance

[0197] C57BL / 6J-Ap4b1 em5Lutzy / J mice were constructed by Jackson Laboratory using CRISPR-Cas9-mediated deletion of a 76 bp region within exon 1 of the mouse Ap4b1 gene. Deletion of this region results in a frameshift mutation and truncated mRNA transcripts. WT sequence (deletion indicated in lowercase letters): TTGGCGACGATGCCATAccttggctctgaggacgtggtgaaggaactgaagaaggctctgtgtaaccctcatattcaggctgataggctgcgcTACCGGAATGTCATCCAGCGAGTTATTAGGTATCACCAACCTACCATAGAA.

[0198] Mouse genotyping was performed according to the optimized protocol of Charles River Laboratories. Genomic DNA extracted from tail tip or ear tissue was added with 20 μl of QuickExtract TM DNA extraction solution (Lucigen) and incubated in a thermal cycler at 65°C for 15 minutes, followed by 98°C for 2 minutes for mouse genotyping. Genotyping PCR was performed in a 20 μl volume reaction as separate reactions for WT and KO alleles. The reaction consisted of: 5 μl 5x Ready-to-use premixed reaction solution ( Master Mix Ready to Load) (contains 7.5mM MgCl 2 , SolisBiodyne), 500 nM of each genotyping primer – P1+P2 for WT allele amplification, P1+P3 for KO allele amplification – (P1: 5′-TCGCCCGAGGACCCAAGAA-3′ (SEQ ID NO 29); P2: 5′-CCTATCAGCCTGAATATGAGGGTTACA-3′ (SEQ ID NO 30); P3: 5′-GCTGGATGACATTCCGGTATATG–3′ (SEQ ID NO 31)) and 1 μl from QuickExtract TMThe genomic DNA of the scheme was obtained. Touchdown PCR was performed according to the thermal curve shown in Table 1. After PCR and agarose gel electrophoresis (2% agarose gel in Tris-acetate-EDTA buffer), the WT and KO allele PCR products were visible at about 254 bp and about 203 bp, respectively.

[0199] Heterozygous mice were bred together to generate homozygous WT (Ap4b1+ / +), homozygous KO (Ap4b1- / -), and heterozygous (Ap4b1+ / -) littermates.

[0200] Table 1 –C57BL / 6J-Ap4b1 em5Lutzy Touchdown PCR conditions for / J genotyping PCR conditions

[0201]

[0202] RT-qPCR was used for expression analysis of human and mouse AP4B1.

[0203] RT-qPCR was performed as follows: 2 μl of total RNA (diluted to a concentration of 10 ng / μl in nuclease-free water), 5 μl of 2x QuantiFast SYBR Green RT-PCR Master Mix hAP4B1 (forward: 5'-CTGGTGAACGATGAGAATGT-3' (SEQ ID No 32); reverse: 5'-GACCCAGCAACTCTGTTAAA-3' (SEQ ID No 33), mAp4b1 (forward: 5'-CTGTGCTAGGCTCCCACATC-3' (SEQ ID NO 34); reverse: 5'-TGGCACTGGCCTTTACCATT-3' (SEQ ID NO 35) and 18S (forward: 5'GTAACCCGTTGAACCCCAT 3' (SEQ ID NO 36); reverse: 5'CCATCCAATCGGTAGTAGCG 3' (SEQ ID NO 37) primers (all at 1 μM), 0.1 μl QuantiFast RT mix and H 2 O to a final volume of 10 μl. After an initial reverse transcription step at 50°C for 10 min and a denaturation step at 95°C for 5 min, cDNA was amplified by 39 cycles of 95°C for 10 s each followed by a combined annealing / extension step at 60°C for 10 s. This was followed by one cycle at 65°C for 31 s, followed by melting curve analysis. All RT-qPCR was performed on a Bio-Rad C1000 Touch TMThe signal intensity was analyzed using Bio-Rad CFXManager software, and the ΔΔCt method was used to determine relative gene expression values, using 18S rRNA as the reference gene.

[0204] Open field

[0205] Open field analysis was performed on mice at 6, 9, and 12 months of age. Following Herranz-Martin et al. 8 The established protocol was performed. Mice were placed in a translucent box with dimensions of 60 cm × 40 cm × 25 cm. A 5 × 3 square grid was marked on the bottom of the box with permanent ink. Activity was measured as the number of grid lines crossed by each mouse in 10 minutes. To record a grid line crossing, the animal was required to cross a grid line with all four paws. The assessment was performed under minimum light conditions, and the apparatus was cleaned with 70% ethanol between each animal. One bout was recorded for each animal at each time point.

[0206] Rotarod

[0207] Motor function was measured using an Ugo Basile 7650 accelerating rotarod (set to accelerate from 3 rpm to 37 rpm in 300 s). Rotarod training was performed twice a day for 3 consecutive days. Subsequently, this test was performed once every two weeks (characterization study) or once a month (proof-of-concept study) in the late morning. At each assessment, mice were tested twice with at least 5 minutes of rest between each test. The best performance measured as latency to fall (in seconds) was used for analysis. The minimum threshold for recording rotarod activity was 3 seconds.

[0208] Gait analysis

[0209] Using CatWalk TM Gait analysis system version 7.1 evaluates gait parameters of Ap4b1-KO and WT mice. Mice of 3, 6, 9 and 12 months of age were tested. The mice were placed on a completely dark instrument and their gait patterns were recorded. Six non-forced runs were recorded for each mouse, and three were selected for analysis. The runs to be analyzed were selected based on the absence of behavioral abnormalities (e.g., sniffing, exploring, and standing (rearing)) and the coherent movement of the mice without obvious acceleration, deceleration or deviation from a straight line. Gait data were processed using Noldus software. Limbs were manually determined and gait parameters were automatically calculated. Parameter values ​​were transferred to GraphPad Prism for statistical analysis.

[0210] Antibody

[0211] The primary antibodies used in this study were mouse anti-α-tubulin (1:5000; Sigma), mouse anti-GAPDH (1:10000; Millipore), rabbit anti-V5 (1:1000; Abcam), rabbit anti-β4 (in-house non-commercial antibody provided by J. Hirst) (1:400), rabbit anti-ATG9A (1:1000; Abcam), goat anti-TGN46 (Bio-Rad), and anti-MAP2.

[0212] Protein extraction and western blot analysis for protein expression analysis.

[0213] Tissues were collected from mice under terminal anesthesia and snap-frozen in liquid nitrogen. Tissues were homogenized using a dounce homogeniser in ice-cold RIPA buffer (50 mM Tris-HCL pH 7.4; 1% v / v NP-40; 0.5% w / v sodium deoxycholate; 0.1% v / v SDS; 150 mM NaCl; 2 mM EDTA) containing 1x protease inhibitor cocktail (Sigma-Aldrich). BCA assay (Thermo Scientific Pierce TM ) to determine the protein concentration of the lysate. 40 μg of protein lysate was denatured by heating to 100°C for 5 minutes in the presence of 4x loading buffer (10 ml buffer containing: 240 mM Tris-HCL pH 6.8; 8% w / v SDS; 40% glycerol; 0.01% bromophenol blue; 10% β-mercaptoethanol). The lysate prepared for quantification of ATG9A protein levels was heated to 50°C, as boiling would cause ATG9A aggregation and loss of signal. The lysate was then loaded onto a 4-20% gradient mini- TGX TMPrecast polyacrylamide gel (Bio-Rad). The gel was run at 180V in running buffer (25mM Tris, 192mM glycine, 0.1% SDS, pH 8.3) for about 50 minutes, or until the dye front reached the bottom of the gel. The separated proteins were transferred by electrophoresis to an Immobilon-P PVDF membrane (Millipore) that had been pre-soaked in methanol. Protein transfer was performed at 250mA for 1.5 hours or at 40mA overnight in transfer buffer (25mM Tris, 192mM glycine, 5% v / v methanol). The membrane was blocked in 5% milk / TBS-T for 1 hour. The primary antibody was diluted in 5% milk / TBS-T or 5% BSA / TBS-T and incubated with the membrane overnight at 4°C. After primary antibody incubation, the membrane was washed 3 times in TBS-T buffer for 15 minutes each time. The secondary antibodies anti-mouse HRP (1:3000) and anti-rabbit HRP (1:3000) were diluted in 5% milk / TBS-T and incubated with the membrane for 2 hours at room temperature. After the secondary antibody incubation, the membrane was washed 3 times in TBS-T buffer for 15 minutes each time, and then washed for a final time in PBS for 15 minutes. The protein bands were visualized using ECL Prime Western Blotting Detection Reagent (Amersham) and G-Box imaging system (Syngene). The protein bands were analyzed by densitometry using Image J software.

[0214] Western blot analysis was performed using the following protocol: Cell lysates were extracted as described above. 40 μg of protein was loaded per lane on a 10-well 4-12% Bis-Tris precast gel. The gel was run in 2-(N-morpholino)ethanesulfonic acid (MES) buffer and wet-transferred to a nitrocellulose membrane (100 mA constant current overnight). The membrane was blocked in 5% milk / TBS-T for 1 hour. Primary antibody was added for 2 hours at room temperature (anti-AP4B1 1:400 in 5% BSA) followed by 4 washes in PBS-T for 15 minutes each. Secondary antibody was added in 5% milk-TBS-T for 30 minutes at room temperature. The membrane was washed 5 times in PBS-T for 5 minutes each and then washed in PBS for 30 minutes. The membrane was developed using ECL Prime Western Blot Detection Reagent (Amersham).

[0215] Cell culture

[0216] Human embryonic kidney (HEK) 293T cells, HeLa-M / HeLa-AP4B1 - / - Cells (gift from Dr. J. Hirst) and human fibroblast cell lines were cultured at 37°C, 5% CO 2The cells were cultured in growth medium consisting of Dulbecco's Modified Eagle's Medium (DMEM, Sigma) supplemented with 10% v / v fetal bovine serum (FBS, Sigma, MI, US) and 1% v / v penicillin (100 U / ml) and streptomycin (100 U / ml) (Lonza, Basel, Switzerland).

[0217] For primary cortical neuron culture, wild-type and C57BL / 6J-Ap4b1 em5Lutzy E18 non-transgenic rat embryos and E16 mouse embryos were harvested from 14 / 18 pregnant mice. Briefly, the cortex was dissected and digested in 0.25% trypsin in HBSS (GIBCO) without calcium or magnesium at 37°C for 15 minutes and manually dissociated in a triturating medium using three flamed Pasteur pipettes with a continuously decreasing orifice. The dissociated cortical neurons were then seeded on poly-D-lysine (SIGMA) coated plates and maintained in Neurobasal medium (Life Technologies) supplemented with 2% B27 (Life Technologies), 0.5 mM GlutaMax (Life Technologies), 100 U / ml penicillin, and 100 μg / ml streptomycin (Lonza).

[0218] AP4B1 knockout HeLa cells (HeLa-AP4B1 - / - ) was provided by Dr. J. Hirst and its generation process is described in the literature 9 middle.

[0219] AP4B1-deficient human fibroblasts from SPG47 patients, heterozygous family members, and age-matched homozygous wild-type controls were gifts from Dr. Henry Houlden and Dr. Ivy Pin-Fang Chen.

[0220] Production of plasmid and viral constructs

[0221] The AAV2-ITR transgene transfer plasmid created as described above was amplified in NEB Stable E. coli cells (New England Biolabs) and purified using the Qiagen Plasmid Plus Kit. Adenoviral helper genes (pHelper) and Rep-Cap genes (pAAV2 / 9) were provided in trans and commercially available through Plasmid Factory. Pseudotyped AAV9 viral vectors were prepared according to the literature. 6 The protocols described in this article were produced in-house.

[0222] Example 1

[0223] The size of the human AP4B1 cDNA open reading frame (2,800 bp) means that simple gene replacement options are technically feasible and amenable to typical viral delivery methods, such as using a single-stranded adeno-associated virus (AAV) with an insert limit of approximately 4,000 bp. We designed AAV vectors to achieve therapeutic levels of transgene expression ( Figure 2 A): 1) An expression cassette was developed involving a 0.8kb CBh promoter and a 130bp SV40 poly A to drive expression of human AP4B1. The CBh promoter has been reported to mediate efficient transgene expression in rodents and non-human primates; 2) A vector expressing human AP4B1 cDNA tagged with an N-terminal V5 viral epitope allows for in vitro and in vivo testing of AP4B1 recovery in the absence of appropriate anti-AP4B1 antibodies; 3) V5-tagged AP4B1 constructs expressed by lentiviral vectors can be validated for in vitro efficacy in cell types that AAV9 cannot efficiently transduce (e.g., fibroblasts). All constructs have been shown to be expressed in HeLa cells ( Figure 2 B, C), primary rat cortical neurons ( Figure 2 D) and human fibroblasts ( Figure 2 E) can effectively express the viral vector after transfection or transduction. The viral construct can effectively restore the expression of AP4B1 protein in CRISPR-generated AP4B1 knockout HeLa cell lines and SPG47 patient fibroblasts lacking endogenous AP4B1 ( Figure 2 B, C, E). Expression of V5-tagged AP4B1 in fibroblasts from SPG47 patients can also restore the overexpression and abnormal localization of ATG9A ( Figure 3 ).

[0224] Example 2

[0225] In order to select AAV9-CBh-hAP4B1 therapy in AP4B1 - / -To determine the appropriate delivery route for optimal efficacy in mouse models, we designed in vivo experiments to test two major delivery modes for gene therapy for central nervous system (CNS) diseases: Figure 4 ): Intra-CNS delivery vs. intravenous delivery. Indeed, AAV9 has been shown to cross the blood-brain barrier (BBB), especially when administered in neonates, and has been delivered intravenously in successful preclinical (Valori et al., 2010) and clinical (Mendell et al., 2017) CNS disease studies, deriving strong therapeutic potential from this minimally invasive delivery route. However, intra-cerebrospinal fluid (CSF) delivery allows immediate access to the CNS, thus increasing the chances of reaching disease target cells, and therefore it has also been used to deliver gene therapy in preclinical (Iannitti et al., 2018) and clinical (Miller et al., 2020; Mueller et al., 2020) studies attempting to treat neurodegenerative diseases.

[0226] Based on this, we set out to evaluate the efficacy of AAV9-hAP4B1 delivered to the SCF via injection into the cisterna magna (intracisternal, ICM) or intravenously via injection into the facial vein (intravenous, IV) in AP4B1. - / - As a viral control, we injected only AAV9-V5 (lacking the hAP4B1 transgene but containing the same CBh promoter, V5 marker, and poly-A signal) using the same delivery route, and we also kept wild-type (WT) and untreated homozygous animals. - / - In-house characterization of the mouse model determined that male homozygotes had a more robust disease phenotype, and we decided to focus resources on performing this experiment only in males. The following viral vectors used in this experiment were either produced in-house or outsourced to a CRO (VectorBuilder): AAV9-V5 only; AAV9-V5-hAP4B1; and AAV9-untagged hAP4B1. Figure 4 B summarizes the number of pups recruited and sacrificed in this experiment.

[0227] After perfusion with PBS, tissues were processed for biochemical or histological analysis.

[0228] For biochemical testing, CNS tissue was separated into the cerebrum, cerebellum, and spinal cord to better understand the potential for treatment in unique and well-defined regions.

[0229] We first followed the biodistribution of the virus in the CNS of treated mice by qPCR on genomic DNA extracted from tissues using primers that bind to the poly-A sequence, and the results are summarized in Figure 4 C. Despite the fact that injections were performed in neonates and that AAV9 is able to cross the BBB, cisterna magna delivery of AAV9-V5only and AAV9-V5-hAP4B1 was far superior to intravenous delivery in transducing all CNS regions studied, as determined by qPCR.

[0230] Following biodistribution, we performed RT-qPCR on RNA extracted from tissues using primers that bind to the hAP4B1 transgene to assess the mRNA expression of the hAP4B1 transgene in the studied tissues, and the results are summarized in Figure 5 Consistent with the results obtained from the viral genome biodistribution, cisterna magna injection of AAV9-CBh-hAP4B1 was significantly superior in inducing hAP4B1 mRNA expression in all CNS regions analyzed.

[0231] The SPG47 loss-of-function hypothesis has considerable support, as mutations in all three other subunits of the AP4 complex (AP4M1, AP4S1, and AP4E1) disrupt the normal function of the tetrameric protein and result in clinical manifestations very similar to those of SPG47. Therefore, the loss of any of its subunits appears to result in AP4 deficiency, the main features of which are early-onset progressive spastic paraplegia and intellectual disability. To investigate whether ICM or IV delivery restored the function of the AP-4 complex, we extracted proteins from CNS tissues and performed Western blotting to measure the protein expression levels of another AP-4 subunit, AP4E1. The results are summarized in Figure 7 In AP4B1 - / - AP4E1 expression was lost in homozygous untreated mice and animals treated with AAV9-V5 only, but ICM administration of AAV9-V5-hAP4B1 successfully restored AP4E1 protein levels in all CNS regions analyzed, with an efficiency of approximately 25% (brain), approximately 16% (cerebellum), and approximately 36% (spinal cord) of WT levels. Intravenous delivery of AAV9-V5-hAP4B1 did not induce detectable restoration of AP4E1 expression in the cerebrum and cerebellum, and induced less restoration in the spinal cord than ICM injections.

[0232] After collecting extensive data from biochemical analyses of tissues, we proceeded to histological analyses to examine the effects of AAV9-hAP4B1 on AP4B1 - / - The thickness of the corpus callosum and the enlargement of the lateral ventricles in coronal brain sections, another important marker of SPG47 ( Figure 8 ). Fig. 9 The results summarized in clearly demonstrate that AP4B1 gene replacement leads to restoration of corpus callosum thickness and lateral ventricle enlargement.

[0233] We then went on to investigate whether AAV9-hAP4B1 would correct the aberrant localization of ATG9A, a well-established molecular hallmark of AP-4 neurodegeneration. Brain sections were immunofluorescently labeled with anti-ATG9A, and the results are summarized in Fig.10 As expected, homozygous mice showed aberrant localization of ATG9A in all analyzed CNS regions compared to WT littermates. ICM delivery of AAV9-hAP4B1 successfully corrected this phenotype in the cerebellum and brainstem ( Fig.10 ). The gene replacement approach was tested using the CBh and Synapsin promoters.

[0234] Interestingly, our gene therapy approach corrected the clasping phenotype observed in the Ap4b1- / - mouse model. The data are summarized in Fig.11 middle.

[0235] Example 3

[0236] To investigate the dose-response study of AAV9_CBh_hAP4B1 gene therapy in the SPG47 mouse model.

[0237] SPG47 KO mice (ap4b1- / -) were treated with AAV9_CBh_hAP4B1 or AAV9_CBh_V5_empty vectors delivered via the cisterna magna at around P60. Three different doses of AAV9_CBh_hAP4B1 were delivered—low (6×10E10 vg), medium (8×10E10 vg), and high (1×10E11 vg). Mice were sacrificed at 2 and 4 months of age. Mice were assessed weekly for body weight and clasping phenotype, and tissues were harvested for biochemical analysis at 2 months, and brains were fixed at 4 months for anatomical analysis (corpus callosum and lateral vertical size) and ATG9A accumulation analysis (Table 1).

[0238] Table 1

[0239]

[0240] Weight and Hold

[0241] The treated mice had no adverse effects on weight gain (see Fig.15). The clasping data showed that untreated SPG47 mice and mice treated with V5 alone (control) showed an increase in hindlimb clasping severity over time. Wild-type mice did not develop the clasping phenotype with age. All 3 doses of treatment showed a reduction in the progression of hindlimb clasping severity over time (see Fig.16 The low-dose treatment resulted in 86% recovery of hindlimb clasping severity at the 120-day time point. The medium-dose treatment resulted in 76% recovery, and the high-dose treatment resulted in 55% recovery.

[0242] Rotarod drop delay time

[0243] Rotarod performance data at 6 months of age (4 months after injection). This data shows that both medium and high dose treatments have the potential to revert this phenotype. Fig.17 .

[0244] Brain weight

[0245] Here we measured brain weight immediately after the mice were sacrificed and dissected. Two months after treatment, in females, brain weight was significantly reduced in treated mice (V5 only) compared to wild type. This data suggests that this brain weight phenotype is restored when treated with all 3 doses (see Fig.18 A); recovery was 98% for the low dose, 85% for the medium dose, and 96% for the high dose. Brain weights of male mice measured 4 months after injection showed a similar pattern of data. (See Fig.18 B).

[0246] Analysis of corpus callosum thinning

[0247] The corpus callosum was measured at eight fixed locations in the brains of treated mice. Corpus callosum thickness varied across these locations. SPG47 control treated mice (V5 only) had reduced corpus callosum thickness (orange dataset) compared to wild type (blue dataset). AAV9_Cbh_hAP4B1 high dose treated mice had corpus callosum thickness restored to wild type levels (see Fig.19 ).

[0248] Embodiment 4:

[0249] Effects of AAV9-AP4B1 gene replacement on neurofilament L (NFL) levels in cerebrospinal fluid (CSF) and plasma. Fig.19As shown, the levels of NFL in Ap4b1- / - mice treated with AAV9-CBh-AP4B1 and AAV9-Synapsin 1-AP4B1 vectors were reduced to levels similar to wild-type, both in CSF and plasma. Levels in untreated mice were increased compared to wild-type. This suggests that the vector can effectively reduce neurofilament levels in patients lacking AP4B1.

[0250] References

[0251] 1.Harvard SPG47 registry,managed by Dr Darius Ebrahimi-Fakhari,accessed October 2020.2Bauer,P.et al.Mutation in the AP4B1 Gene CauseHereditary Spastic Paraplegia Type47(SPG47).Neurogenetics 13, 73-76, doi:10.1007 / s10048-012-0314-0. (2012).

[0252] 3. Laughlin, CA, Tratschin, JD, Coon, H. & Carter, BJ Cloning ofinfectious adeno-associated virus genomes in bacterial plasmids. Gene 23, 65–73 (1983).

[0253] 4.Gray,SJet al.Optimizing Promoters for Recombinant Adeno-Associated Virus-Mediated Gene Expression in the Peripheral and CentralNervous System Using Self-Complementary Vectors.Hum.Gene Ther.22,1143–1153(2011).

[0254] 5.Davies,A.K.et al.AP-4vesicles contribute to spatial control ofautophagy via RUSC-dependent peripheral delivery of ATG9A.Nat.Commun.9,(2018).

[0255] 6.Lukashchuk,V.,Lewis,K.E.,Coldicott,I.,Grierson,A.J.&Azzouz,M.AAV9-mediated central nervous system–targeted gene delivery via cisterna magnaroute in mice.Mol.Ther.-Methods Clin.Dev.3,15055(2016).

[0256] 7.Kim,S.,Yu,N.K.&Kaang,B.K.CTCF as a multifunctional protein ingenome regulation and gene expression.Exp.Mol.Med.47,e166(2015).

[0257] 8.Herranz-Martin,S.et al.Viral delivery of C9orf72 hexanucleotiderepeat expansions in mice leads to repeat-length-dependent neuropathology andbehavioural deficits.Dis.Model.Mech.10,859–868(2017).

[0258] 9.Frazier,M.N.et al.Molecular basis for the interaction betweenAdaptor Protein Complex 4(AP4)β4and its accessory protein,tepsin.Traffic 17,400–415(2016).

[0259] 10.Behne R,Teinert J,Wimmer M,D′Amore A,Davies AK,Scarrott JM,Eberhardt K,Brechmann B,Chen IP,Buttermore ED,Barrett L,Dwyer S,Chen T,HirstJ,Wiesener A,Segal D,Martinuzzi A,Bourinette JT,Bourinet ST,Brechmann B,Chen IP T,HouldenH,Roubertie A,Santorelli FM,Robinson M,Azzouz M,Lipton JO,Borner GHH,Sahin M,Ebrahimi-Fakhari D.Adaptor protein complex 4deficiency:a paradigm ofchildhood-onset hereditary spastic paraplegia caused by protein defective Mol. Jan 15;29(2):320-334.doi:10.1093 / hmg / ddz310.PMID:31915823;PMCID:PMC7001721.

[0260] 11.Ebrahimi-Fakhari D,Teinert J,Behne R,Wimmer M,D′Amore A,EberhardtK,Brechmann B,Ziegler M,Jensen DM,Nagabhyrava P,Geisel G,Carmody E,ShamshadU,Dies KA,Yuskaitis CJ,SalussohiliaFEbrami-CL. D,Pearson TS,Saffari A,Siegler A, S,Volkmann J,Wiesener A,Bearden DR,Lakhani S,Segal D,Udwadia-Hegde A,Martinuzzi A,Hirst J,Perlman S,Takiyama Y,Xiromerisiou G,Vill K,Walker WO,Shukla A,Dubey Gupta R,Dahl N,Helgastoy A,Helgado MR,Kremlikova Pourova R,Sadek AA,Elkhateeb NM,Blumkin L,Brea-Fernández AJ,Dacruz- D,Small T,Ghoumid J,Miguel D,Heine C,Schlump JU,Langen H,BaetsJ,Bulk S,Darvish H,Bakhtiari S,Cruer MC,Lim-Melia E,Aydinli N,Alanay Y,El-Rashidy O,Nampoothiri S,Patel C,Beetz,Google,Go,Go,Go,Miller SP,Bourinaris T,Houlden H,Robelin L,Anheim M,Alamri AS,Mahmoud AAH,Inaloo S,Habibzadeh P,Faghihi MA,Jansen AC,Brock S,Roubertie A,Darras BT,Agrawal PB,Santorelli FM,Gleeson J,Zakheiki SIMS,Shinet JT,Sahinett M.Defining theclinical,molecular and imaging spectrum of adapter protein complex 4-associated hereditary spastic paraplegia.Brain.2020 Oct 1;143(10):2929-2944.doi:10.1093 / brain / awz307.PMID:32979048;PMCID:PMC7780481..

[0261] 12.Orsini,C.A.and B.Setlow,Sex differences in animal models ofdecision making.J Neurosci Res,2017.95(1-2):p.260-269.

[0262] 13.Feng,H.,et al.,Mouse models of GNAO1-associated movement disorder:Allele-and sex-specific differences in phenotypes.PLoS One,2019.14(1):p.e0211066.

[0263] 14.McCombe,P.A.and R.D.Henderson,Effects of gender in amyotrophiclateral sclerosis.Gend Med,2010.7(6):p.557-70.

[0264] 15.Watkins,J.,et al.,Female sex mitigates motor and behaviouralphenotypes in TDP-43(Q331K)knock-in mice.Sci Rep,2020.10(1):p.19220.

[0265] 16.Sala Frigerio,C.,et al.,The Major Risk Factors for Alzheimer'sDisease:Age,Sex,and Genes Modulate the Microglia Response to AβPlaques.CellRep,2019.27(4):p.1293-1306.e6.

[0266] 17.Gray SJ,Foti SB,Schwartz JW,Bachaboina L,Taylor-Blake B,Coleman J,Ehlers MD,Zylka MJ,McCown TJ,Samulski RJ.Optimizing promoters for recombinantadeno-associated virus-mediated gene expression in the peripheral and centralnervous system using self-complementary vectors.Hum Gene Ther.2011 Sep;22(9):1143-53.doi:10.1089 / hum.2010.245.Epub 2011 Jun 1.PMID:21476867

Claims

1. An isolated nucleic acid molecule comprising: a transcription cassette comprising, between a first and a second inverted repeat sequence, in the 5' to 3' direction: i) a promoter suitable for expression in mammalian neurons, wherein the promoter is associated with an enhancer nucleotide motif; ii) intronic nucleotide sequences; and iii) a polyadenylation signal nucleotide sequence; wherein The cassette also comprises a nucleic acid molecule comprising a nucleotide sequence encoding at least one protein of the AP-4 complex.

2. The isolated nucleic acid molecule of claim 1, wherein the enhancer motif is a CMV enhancer.

3. The isolated nucleic acid molecule of claim 2, wherein the CMV enhancer motif comprises or consists of the nucleotide sequence in SEQ ID NO: 1 or a polymorphic nucleotide sequence variant thereof.

4. The isolated nucleic acid molecule according to any one of claims 1 to 3, wherein the polyadenylation signal is a growth hormone (GH) polyadenylation signal.

5. The isolated nucleic acid molecule of claim 4, wherein the GH polyadenylation signal comprises or consists of the nucleotide sequence in SEQ ID NO: 4 or a polymorphic sequence variant thereof.

6. The isolated nucleic acid molecule according to any one of claims 1 to 5, wherein the promoter is a chicken beta actin promoter, a JeT promoter, a hSyn promoter, a MeP229 promoter or an AP4B1 promoter.

7. The isolated nucleic acid molecule according to claim 6, wherein the chicken beta actin promoter comprises or consists of the nucleotide sequence in SEQ ID NO:

3.

8. The isolated nucleic acid molecule of claim 6, wherein the chicken beta actin promoter comprises or consists of the nucleotide sequence in SEQ ID NO:

28.

9. The isolated nucleic acid molecule according to any one of claims 1 to 7, wherein the transcription cassette comprises or consists of the nucleotide sequence in SEQ ID NO:

9.

10. The isolated nucleic acid molecule according to any one of claims 1 to 9, wherein the expression cassette comprises a nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of: i) the nucleotide sequence or polymorphic sequence variant as shown in SEQ ID NO: 15 (AP4B1); ii) a nucleotide sequence, wherein said sequence is degenerate to the nucleotide sequence defined in (i) due to the genetic code; iii) a nucleic acid molecule, the complementary strand of which hybridizes to the sequence in SEQ ID NO: 15 (AP4B1) under stringent hybridization conditions, wherein the nucleic acid molecule encodes a polypeptide that forms a complex with a polypeptide comprising the AP-4 complex; iv) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 16 (AP4B1); v) a nucleotide sequence encoding a polypeptide comprising an amino acid sequence, wherein the amino acid sequence is modified by addition, deletion or substitution of at least one amino acid residue as indicated in iv), wherein the polypeptide forms a complex with a polypeptide comprising the AP-4 complex.

11. The isolated nucleic acid molecule according to any one of claims 1 to 9, wherein the expression cassette comprises a nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of: i) the nucleotide sequence or polymorphic sequence variant as shown in SEQ ID NO: 17 (AP4E1); ii) a nucleotide sequence, wherein said sequence is degenerate to the nucleotide sequence defined in (i) due to the genetic code; iii) a nucleic acid molecule, the complementary strand of which hybridizes to the sequence in SEQ ID NO: 17 (AP4E1) under stringent hybridization conditions, wherein the nucleic acid molecule encodes a polypeptide that forms a complex with a polypeptide comprising the AP-4 complex; iv) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 18 (AP4E1); v) a nucleotide sequence encoding a polypeptide comprising an amino acid sequence, wherein the amino acid sequence is modified by addition, deletion or substitution of at least one amino acid residue as indicated in iv), wherein the polypeptide forms a complex with a polypeptide comprising the AP-4 complex.

12. The isolated nucleic acid molecule according to any one of claims 1 to 9, wherein the expression cassette claimed comprises a nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of: i) the nucleotide sequence or polymorphic sequence variant as shown in SEQ ID NO: 19 (AP4M1); ii) a nucleotide sequence, wherein said sequence is degenerate to the nucleotide sequence defined in (i) due to the genetic code; iii) a nucleic acid molecule, the complementary strand of which hybridizes to the sequence in SEQ ID NO: 19 (AP4M1) under stringent hybridization conditions, wherein the nucleic acid molecule encodes a polypeptide that forms a complex with a polypeptide comprising the AP-4 complex; iv) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 20 (AP4M1); v) a nucleotide sequence encoding a polypeptide comprising an amino acid sequence, wherein the amino acid sequence is modified by addition, deletion or substitution of at least one amino acid residue as indicated in iv), wherein the polypeptide forms a complex with a polypeptide comprising the AP-4 complex.

13. The isolated nucleic acid molecule according to any one of claims 1 to 9, wherein the expression cassette comprises a nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of: i) the nucleotide sequence or polymorphic sequence variant as shown in SEQ ID NO: 21 (AP4S1); ii) a nucleotide sequence, wherein said sequence is degenerate to the nucleotide sequence defined in (i) due to the genetic code; iii) a nucleic acid molecule, the complementary strand of which hybridizes to the sequence in SEQ ID NO: 21 (AP4S1) under stringent hybridization conditions, wherein the nucleic acid molecule encodes a polypeptide that forms a complex with a polypeptide comprising the AP-4 complex; iv) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 22 (AP4S1); A nucleotide sequence encoding a polypeptide comprising an amino acid sequence, wherein the amino acid sequence is modified by adding, deleting or substituting at least one amino acid residue as shown in iv), wherein the polypeptide forms a complex with a polypeptide comprising an AP-4 complex.

14. An expression vector comprising the transcription cassette according to any one of claims 1 to 13.

15. The expression vector of claim 14, wherein the expression vector is a virus-based expression vector.

16. The expression vector of claim 15, wherein the viral-based vector is adeno-associated virus [AAV].

17. The expression vector of claim 16, wherein the viral-based vector is AAV9 or AAV10.

18. The expression vector of claim 16, wherein the viral-based vector is an enhanced AAV9 vector, such as a PHP-b vector.

19. The expression vector according to any one of claims 16 to 18, wherein the AAV vector is based on a single-stranded AAV virus.

20. The expression vector of claim 19, wherein the AAV vector is based on a self-complementary AAV virus.

21. The expression vector of claim 15, wherein the viral-based vector comprises the nucleotide sequence shown in SEQ ID NO:

10.

22. The expression vector of claim 15, wherein the viral-based vector comprises the nucleotide sequence shown in SEQ ID NO:

11.

23. The expression vector of claim 15, wherein the viral-based vector comprises the nucleotide sequence shown in SEQ ID NO:

12.

24. The expression vector of claim 15, wherein the viral-based vector comprises the nucleotide sequence shown in SEQ ID NO:

13.

25. The expression vector of claim 15, wherein the viral-based vector comprises the nucleotide sequence shown in SEQ ID NO:

14.

26. The expression vector of claim 15, wherein the viral-based vector comprises the nucleotide sequence shown in SEQ ID NO:

23.

27. The expression vector of claim 15, wherein the viral-based vector comprises the nucleotide sequence shown in SEQ ID NO:

24.

28. The expression vector of claim 15, wherein the viral-based vector comprises the nucleotide sequence shown in SEQ ID NO:

25.

29. The expression vector of claim 15, wherein the viral-based vector comprises the nucleotide sequence shown in SEQ ID NO:

26.

30. The expression vector of claim 15, wherein the viral-based vector comprises the nucleotide sequence shown in SEQ ID NO:

27.

31. A pharmaceutical composition comprising the expression vector according to any one of claims 14 to 30 and an excipient or carrier.

32. The expression vector according to any one of claims 14 to 30 or the composition according to claim 31 for use as a medicament in a subject.

33. The expression vector of any one of claims 14 to 30 or the composition of claim 31 for use in treating AP-4 hereditary spastic paraplegia in a subject.

34. The expression vector of claim 32 or 33, wherein the subject is a pediatric subject.

35. A method for measuring the therapeutic efficacy of hereditary spastic paraplegia in a subject, wherein the subject is treated with the expression vector according to claim 14-30 or the pharmaceutical composition according to claim 31, the method include: a) measuring the level of neurofilament L (NFL) in a biological sample obtained from a subject suffering from hereditary spastic paraplegia before administering the expression vector according to claims 14-30 or the pharmaceutical composition according to claim 31, and b) comparing said level with the level of NFL in a biological sample obtained from a subject with hereditary spastic paraplegia after administration of an expression vector according to claims 14-30 or a pharmaceutical composition according to claim 31, and wherein i) if the NFL level is lower compared to the level obtained in step a), suspending the treatment with the expression vector or the composition, or ii) if the level is the same as in step a), continuing the treatment with the expression vector according to claims 14-30 or the composition according to claim 31.

36. The method of claim 35, wherein the expression vector is selected from the group consisting of SEQ ID NOs 10, 11, 12, 13, 14, 23, 24, 25, 26 and 27.

37. The method of claim 35 or 36, wherein the sample in b) is obtained between 1-6 days or 1-4 weeks.

38. A method for measuring the therapeutic effect of a hereditary spastic paraplegia treatment in a subject suffering from hereditary spastic paraplegia, wherein the subject is treated with an expression vector according to claims 14-30 or a pharmaceutical composition according to claim 31, said method include: a) measuring the level of neurofilament L (NFL) in a biological sample obtained from a subject suffering from hereditary spastic paraplegia and treated with the expression vector or composition, and b) comparing the levels to those in control subjects.

39. The method of claim 38, wherein the expression vector is selected from the group consisting of SEQ ID NOs 10, 11, 12, 13, 14, 23, 24, 25, 26 and 27.

40. The method according to any one of claims 38-39, further comprising step c), wherein the treatment is effective and is suspended when the level in the biological sample obtained from the subject with hereditary spastic paraplegia is the same as or lower than the level of NFL in the biological sample obtained from the control subject.

41. The method according to any one of claims 38-49, further comprising step c), wherein when the level in the biological sample obtained from the subject with hereditary spastic paraplegia is higher than the NFL level in the biological sample obtained from the control subject, treatment is ineffective and treatment with the expression vector according to claims 14-30 or the pharmaceutical composition according to claim 31 is continued.

Images