Preparation method and application of swertiamarin

The purification of swertiamarin by ultrasound-assisted extraction and column chromatography solved the problems of complex purification methods and low purity, and achieved the preparation of high-purity swertiamarin and significant inhibitory activity against TRPV1, which has important prospects for pharmaceutical and cosmetic applications.

CN120058819BActive Publication Date: 2026-01-06SHENZHEN BOTON FLAVORS & FRAGRANCES CO LTD
View PDF 7 Cites 0 Cited by

Patent Information

Application Number
CN202510191115.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-20
Publication Date
2026-01-06
Estimated Expiration
2045-02-20

AI Technical Summary

Technical Problem

Existing purification methods for swertiamarin have low purity, are complex and time-consuming, and have not reported its inhibitory activity against TRPV1.

Method used

A method for enriching and purifying swertiamarin with high purity was developed by using ultrasound-assisted extraction combined with normal/reverse phase column chromatography and macroporous resin and silica gel chromatography to separate and purify swertiamarin.

Benefits of technology

The preparation of high-purity (greater than 95.6%) swertiamarin was achieved, the purification steps were simplified, and it is suitable for large-scale production. It was also found that swertiamarin has significant inhibitory and anti-inflammatory activity against the TRPV1 ion channel.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120058819B_ABST
    Figure CN120058819B_ABST
Patent Text Reader

Abstract

The application discloses a preparation method and application of jujuboside. The application develops an enrichment and purification preparation method of jujuboside with high purity and suitable for mass production, and the jujuboside prepared by using the method has the advantages of high product purity, short purification steps, easy scale-up production, less time consumption and the like. The application firstly finds that the jujuboside has significant inhibitory activity on a TRPV1 ion channel, can be used as a TRPV1 ion channel inhibitor, and has anti-inflammatory activity, and the jujuboside has important application prospects for developing drugs for treating chronic pain, inflammation and hyperlipidemia and the like. The jujuboside is used as an active ingredient to prepare cosmetics with anti-inflammatory, analgesic and soothing effects, and also has important application value in cosmetic development.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of pharmaceutical and cosmetic technology, specifically relating to the preparation method and application of swertiamarin. Background Technology

[0002] Chronic pain is a major clinical challenge that urgently needs to be addressed. However, there are very few analgesics that target only the peripheral and / or spinal cord levels with good efficacy. Transient receptor potential vanilloid 1 (TRPV1) is a ligand-gated ion channel mainly distributed in sensory neurons of the peripheral nervous system. It can be activated by physical and chemical stimuli such as high temperature (>43°C), low pH (<5.9), as well as endogenous lipid molecules and exogenous ligands. It participates in various physiological and pathological processes such as pain perception, temperature regulation, and inflammatory responses, and has been proven to be a therapeutic target in various preclinical models of chronic pain. TRPV1 belongs to the TRPV subfamily of the transient receptor potential (TRP) family. Activation of TRPV1 in the nervous system leads to cation influx, which in turn depolarizes the afferent neurons of heat and pain sensation and generates action potentials. Capsaicin, the active ingredient in chili peppers, can activate TRPV1; therefore, TRPV1 is also known as the capsaicin receptor. TRPV1 is primarily distributed in sensory neurons of the peripheral nervous system. It is also expressed in the central nervous system, as well as in non-neuronal tissues and cells such as the cardiovascular system, liver, skin epidermis, gastrointestinal epithelial cells, bladder urothelial cells, and smooth muscle cells. It participates in many physiological processes, such as thermoregulation, circadian rhythms, energy intake, and lipid metabolism. Activation of TRPV1 in the endoplasmic reticulum leads to endoplasmic reticulum stress and activates pro-apoptotic pathways. Simultaneously, TRPV1 activation in mitochondria participates in mitochondrial calcium metabolism. 2 TRPV1 uptake leads to mitochondrial depolarization and contributes to cell migration. The presence of TRPV1 in the Golgi apparatus suggests its involvement in protein transport in the secretory pathway. Therefore, TRPV1 has been extensively studied as a potential target for the treatment of pain, inflammation, and hyperlipidemia.

[0003] Swertia glycosides are the main and characteristic components of plants in the genus *Swertia*, and are widely sourced from plants such as *Swertia bimaculata*, *Swertia spp.*, *Swertia spp.*, and *Swertia bimaculata* var. *spp.*. *Swertia bimaculata* is an annual herb belonging to the family Gentianaceae and the genus *Swertia*. The whole plant is used medicinally and contains chemical components such as swertia glycosides, isovitexin, vitexin, isovitexin, safflower lactone, and oleanolic acid, mainly iridoids, sine, triterpenes, and alkaloids. *Swertia bimaculata* extract has the effects of clearing heat and detoxifying, promoting diuresis, and soothing the liver and gallbladder. It is often used to treat heatstroke, diarrhea, and diseases caused by damp heat, such as acute and chronic hepatitis, cholecystitis, colds with fever, sore throat, gingivitis, urinary tract infections, gastroenteritis, dysentery, conjunctivitis, and infantile malnutrition. Modern pharmacological studies have shown that Swertia japonica extract has cardiotonic, hypoglycemic, blood circulation promoting, testosterone 5α-reductase inhibiting, anti-inflammatory, and analgesic effects. Existing patents mainly focus on the anti-wrinkle (preparations for treating fine lines and wrinkles and their uses, CN118765193A; an anti-aging and anti-wrinkle composition and its application, CN109602668A), anti-inflammatory (a Tibetan medicine composition for treating jaundice-type hepatitis and its preparation method, CN113599441A; an active substance and its preparation and anti-inflammatory application, CN112870246A; a Mongolian medicine composition and its method for treating chronic cholecystitis and biliary colic, CN1954859A) and the purification method of swertiamarin (a method for extracting effective components from the Sichuan swertiamarin plant, CN102503996A). The purity of swertiamarin (2.32%) is not high. Moreover, there are currently no patents on the purification method of high-purity swertiamarin or reports on the inhibitory activity of swertiamarin on TRPV1. Summary of the Invention

[0004] To address the problems of existing technologies, mainly the drawbacks of swertiamarin purification methods, such as low purity, complex steps, and time and labor costs, this invention develops a method for enriching and purifying high-purity swertiamarin. First, a crude extract is obtained from Swertia japonica or Gentiana scabra using ultrasound-assisted extraction technology. The crude extract is then separated and purified using normal-phase / reversed-phase column chromatography to obtain high-purity swertiamarin. Furthermore, it was discovered for the first time that swertiamarin has significant inhibitory activity against the TRPV1 ion channel and anti-inflammatory activity.

[0005] The first objective of this invention is to provide a method for preparing swertiamarin, comprising the following steps:

[0006] S1. Take dried plant material containing swertiamarin, crush it to obtain powder of the material to be extracted;

[0007] S2. Add the powder of the material to be extracted to a 30% (v / v) ethanol aqueous solution, extract fully in an ultrasonic extraction tank, filter, recover the extract, concentrate, and obtain the crude extract;

[0008] S3. Add the crude extract to the macroporous resin and mix. After evaporating to remove the solvent, pack the column and elute with a 20% (v / v) ethanol aqueous solution. Collect the eluent, concentrate and remove the solvent to obtain sample 1-1.

[0009] S4. Dissolve sample 1-1 in a 95% ethanol aqueous solution, mix with 100-200 mesh silica gel, pack into a column, and elute with a solvent of dichloromethane:ethanol at a volume ratio of 25:1 to remove impurities. Then, change to a solvent of dichloromethane:methanol at a volume ratio of 15:1 to elute. Collect the eluent, concentrate and remove the solvent to obtain sample 1-2.

[0010] S5. Dissolve samples 1-2 in a 95% (v / v) aqueous ethanol solution, mix with 200-300 mesh silica gel, pack into a column, and elute with a solvent of ethyl acetate:ethanol at a volume ratio of 20:1 to remove impurities. Then, change the solvent to ethyl acetate:ethanol at a volume ratio of 10:1 and collect the eluent. Concentrate the eluent to remove the solvent and obtain swertiamarin.

[0011] A second objective of this invention is to provide another method for preparing swertiamarin, comprising the following steps:

[0012] S1. Take dried plant material containing swertiamarin, crush it to obtain powder of the material to be extracted;

[0013] S2. Add the powder of the material to be extracted to a 30% (v / v) ethanol aqueous solution, extract fully in an ultrasonic extraction tank, filter, recover the extract, concentrate, and obtain the crude extract;

[0014] S3. Mix the crude extract with 100-200 mesh silica gel, pack it into a column, and elute with a solvent of dichloromethane:ethanol at a volume ratio of 25:1 to remove impurities. Then, change the solvent to dichloromethane:methanol at a volume ratio of 15:1 and collect the eluent. Concentrate the eluent to remove the solvent and obtain sample 2-1.

[0015] S4. Mix sample 2-1 with macroporous resin, evaporate to remove solvent, pack into column, elute with 20% (v / v) ethanol aqueous solution, collect the eluent, concentrate to remove solvent to obtain sample 2-2.

[0016] S5. After evaporating and concentrating sample 2-2 to remove moisture, mix it with 200-300 mesh silica gel, pack it into a column, and elute with a solvent of ethyl acetate:ethanol at a volume ratio of 20:1 to remove impurities. Then, change the solvent to ethyl acetate:ethanol at a volume ratio of 10:1 and collect the eluent. Concentrate the eluent to remove the solvent and obtain swertiamarin.

[0017] Preferably, step S2 is as follows: 1 part by mass of the powder of the material to be extracted is added to 8 parts by mass of 30% ethanol aqueous solution, and the mixture is extracted in an ultrasonic extraction tank at 25°C for 24 hours. The extract is then filtered and the extract is recovered. The residue is extracted again, filtered, and the extract is recovered. The two extracts are combined and concentrated to obtain the crude extract.

[0018] The macroporous resin mentioned is the D101 macroporous resin from Aimeco Biopharmaceutical (China) Co., Ltd., and the 100-200 mesh silica gel and 200-300 mesh silica gel are 100-200 mesh silica gel and 200-300 mesh silica gel produced by Qingdao Ocean Chemical Co., Ltd.

[0019] Preferably, the plant material containing swertiamarin is a swertiamarin-containing plant material of the genus Swertia.

[0020] Preferably, the *Swertia* species are *Swertia*, *Swertia zebrina*, *Swertia szebrina* var. *s ... var. *szebrina*, and *Swertia purpurea*.

[0021] Swertiatoside is widely available and is a major and characteristic component of plants in the genus *Swertia*. The preparation of swertiatoside can also be achieved by adjusting the plant source to other species containing swertiatoside. Among the plants containing swertiatoside are *Swertia spp.*, *Gentiana scabra*, *Swertia szechuanensis*, *Swertia szechuanensis*, and *Swertia purpurea*.

[0022] A third objective of this invention is to provide the use of swertiamarin (or extracts containing swertiamarin) in the preparation of TRPV1 ion channel inhibitor drugs.

[0023] Preferably, the TRPV1 ion channel inhibitor drug is a drug that inhibits the mRNA expression of TRPV1.

[0024] A fourth object of the present invention is to provide the use of swertiamarin (or extracts containing swertiamarin) in the preparation of medicaments for the treatment or prevention of chronic pain, inflammation or hyperlipidemia.

[0025] The medicament may be a composition containing swertiamarin, and may be in any suitable form, such as solid, semi-solid, liquid, or aerosol. Generally, the medicament contains swertiamarin or an extract containing swertiamarin prepared according to the present invention as the active ingredient, mixed with an organic or inorganic carrier or excipient suitable for external, enteral, or parenteral administration. The active ingredient may be compound, for example, formulated with conventional non-toxic pharmaceutically acceptable carriers and / or excipients into tablets, pills, capsules, and other suitable forms of use. Pharmaceutically acceptable carriers used in the composition include, for example, water, glucose, lactose, gum arabic, and other carriers suitable for use in the preparation of formulations in solid, semi-solid, liquid, or aerosol forms. The composition may additionally contain stabilizers, thickeners, and / or colorants and flavorings.

[0026] Swertiacriticin and its pharmaceutically acceptable salts and glycosides can be administered orally, dermally, or non-orally. Dosage varies depending on the specific drug, but 1100 mg daily is generally suitable for adults. For oral administration, swertiamarin is first mixed with conventional pharmaceutical excipients such as excipients, dissolving agents, binders, lubricants, antioxidants, coating agents, colorants, fragrances, and surfactants to form granules, capsules, tablets, etc. For dermal administration, swertiamarin is first mixed with conventional pharmaceutical excipients such as excipients, dissolving agents, binders, lubricants, antioxidants, coating agents, colorants, fragrances, and surfactants to form gels, solutions, tinctures, lotions, emulsions, oils, creams, ointments, plasters, etc. Non-oral administration can be achieved through injections, infusions, or suppositories. Conventional pharmaceutical techniques can be used to prepare these formulations.

[0027] The fifth object of the present invention is to provide the application of swertiamarin (or extracts containing swertiamarin) in the preparation of cosmetics with anti-inflammatory, analgesic and soothing effects.

[0028] If swertiamarin (or extracts containing swertiamarin) is added to cosmetics at a concentration of 1% by mass, cosmetics with anti-inflammatory, analgesic, and soothing effects can be obtained.

[0029] The sixth object of the present invention is to provide a cosmetic containing swertiamarin (or an extract containing swertiamarin) as an active ingredient with anti-inflammatory, analgesic and soothing effects.

[0030] The present invention has the following advantages:

[0031] This invention develops a high-purity (greater than 95.6%) enrichment and purification method for swertiamarin, suitable for large-scale production. This method offers advantages such as high product purity, short purification steps, ease of scale-up, and low processing time. The overall process is simple and suitable for large-scale production; approximately 1.3 kg of swertiamarin can be extracted from 20 kg of raw materials such as *Swertia spp.* and *Gentiana scabra* in a single batch, which can be used for the large-scale preparation of swertiamarin.

[0032] This invention marks the first discovery that swertiamarin possesses significant inhibitory activity against the TRPV1 ion channel, making it a potential TRPV1 ion channel inhibitor. Furthermore, swertiamarin exhibits anti-inflammatory activity, showing significant potential for drug development in the treatment of chronic pain, inflammation, and hyperlipidemia. Using swertiamarin as an active ingredient in the preparation of cosmetics with anti-inflammatory, analgesic, and soothing effects also holds significant application value in cosmetic development. Attached Figure Description

[0033] Figure 1 This is an HPLC chromatogram of the purity of swertiamarin in the product prepared in Example 1.

[0034] Figure 2 This represents the inhibition of TRPV1 mRNA release by swertiamarin; where 1% and 5% of swertiamarin represent sample groups with 1% and 5% concentration of the mother liquor, respectively.

[0035] Figure 3 The results show the inhibition rate of swertiamarin on TRPV1 mRNA release; where swertiamarin 1% and 5% represent sample groups with 1% and 5% concentration of the mother liquor, respectively.

[0036] Figure 4 The results show the inhibition rate of swine glycosides against TNF-α; among them, 0.1%, 1%, and 5% swine glycosides represent sample groups with 0.1%, 1%, and 5% concentration of the mother liquor, respectively, and 0.01% dexamethasone represents the positive control group.

[0037] Figure 5 The results show the inhibition rate of swine glycoside on IL-1β; among them, 0.1%, 1%, and 5% of swine glycoside represent sample groups with 0.1%, 1%, and 5% of the product mother liquor concentration, respectively, and 0.01% dexamethasone represents the positive control group. Detailed Implementation

[0038] The following embodiments are further illustrations of the present invention, but not limitations thereof.

[0039] The above-ground parts of *Swertia zebrina* plants used in the following examples were harvested in Honghe, Yunnan Province, and the above-ground parts of *Gentiana scabra* plants were harvested in Linzhi, Tibet Province. The macroporous resin, model D101, was purchased from Aimeikejian (China) Biopharmaceutical Co., Ltd.; the glass chromatography column (13cm diameter, 120cm height) was purchased from Chongqing Xinweier Glass Co., Ltd.; 100-200 mesh and 200-300 mesh silica gel were purchased from Qingdao Haiyang Chemical Co., Ltd.; and the ultrasonic extraction vessel (TS-NS-50, 50L) was purchased from Shanghai Shunyi Experimental Equipment Co., Ltd.

[0040] Example 1

[0041] (1) Take 1 kg of the above-ground part of the dried Swertia plant, crush it with a pulverizer and pass it through a 20-mesh sieve to obtain Swertia powder.

[0042] (2) Add 1 kg of Swertia powder to 8 kg of 30% ethanol aqueous solution and extract in an ultrasonic extraction tank at 25°C for 24 h. Filter and recover the extract. Repeat the extraction once more (add the filter residue to 8 kg of 30% ethanol aqueous solution and extract in an ultrasonic extraction tank at 25°C for 24 h). Filter and recover the extract. Combine the two extracts and concentrate to 150 g to obtain the crude extract.

[0043] (3) Add the crude extract to 400g of macroporous resin (model D101) and mix. After removing the solvent by rotary evaporation, add the sample to a column pre-packed with macroporous resin (2.8kg of D101 macroporous resin), and weigh it down with degreased cotton. Elute with 3 column volumes of 20% ethanol aqueous solution, collect the eluent, concentrate and remove the solvent to obtain the target sample 1-1, which is mainly rich in swertiamarin.

[0044] Purification was performed using silica gel column chromatography. Sample 1-1 was dissolved in a 95% (v / v) ethanol aqueous solution, and then mixed with 150g of 100-200 mesh silica gel. The column was first packed with 900g of 100-200 mesh silica gel, followed by the mixed silica gel. Elution was initiated with 2kg of dichloromethane:ethanol (v / v). This 2kg solvent elutes other substances and should be discarded. Elution was then performed with 8kg of dichloromethane:methanol (v / v). The eluent was collected, concentrated, and the solvent removed to obtain sample 1-2 with a purity of 66%.

[0045] Dissolve samples 1-2 in a 95% (v / v) ethanol aqueous solution, then mix with 80g of 200-300 mesh silica gel. First, pack a column with 800g of 200-300 mesh silica gel, then add the mixed silica gel. Elute initially with 1kg of ethyl acetate:ethanol (v / v) at a ratio of 20:1. Discard this 1kg solvent as it elutes other substances. Then, switch to 8kg of ethyl acetate:ethanol (v / v) at a ratio of 10:1. Collect the eluent, concentrate it to remove the solvent, and obtain the target samples 1-3, which are the purified products. HPLC analysis... Figure 1 The product weighed 65g, with swertiamarin having a purity of 95.6%. The isolated compound was identified as swertiamarin by NMR data comparison (Table 1).

[0046] Table 1. NMR spectral data of swertiamarin.

[0047] Location <![CDATA[ 13 C NMR]]> <![CDATA[ 1 H NMR]]> 1 96.7 5.52 3 152.4 7.61 4 104.8 5 27.1 3.14 6 24.6 1.69;1.77 7 68.4 4.45;4.34 8 132.0 5.52 9 42.2 2.70 10 119.7 5.25 11 167.0 1’ 98.4 4.70 2’ 73.1 3.20 3’ 76.6 3.31 4’ 70.0 3.28 5’ 76.3 3.37 6’ 61.2 3.66;3.90

[0048] The chemical structure of swertiamarin is shown in Formula I:

[0049]

[0050] Example 2

[0051] (1) Take 1 kg of the above-ground part of the dried *Gynostemma pentaphyllum* plant, crush it with a pulverizer and pass it through a 20-mesh sieve to obtain *Gynostemma pentaphyllum* powder.

[0052] (2) Add 1 kg of Qingyedan ​​powder to 8 kg of 30% ethanol aqueous solution and extract in an ultrasonic extraction tank at 25°C for 24 h. Filter and recover the extract. Repeat the extraction once more (add the filter residue to 8 kg of 30% ethanol aqueous solution and extract in an ultrasonic extraction tank at 25°C for 24 h). Filter and recover the extract. Combine the two extracts and concentrate to 150 g to obtain crude extract.

[0053] (3) Add 400g of 100-200 mesh silica gel to mix the crude extract; first pack the column with 900g of 100-200 mesh silica gel, then add the mixed 100-200 mesh silica gel to pack the column; start elution with a solvent (2kg) of dichloromethane:ethanol volume ratio of 25:1. This 2kg solvent elutes other substances, so discard it; then change to a solvent (8kg) of dichloromethane:methanol volume ratio of 15:1 to elute 3 times the column volume, collect the eluent, concentrate and remove the solvent to obtain the target sample 2-1 rich in swertiamarin.

[0054] Sample 2-1 was mixed with 200g of macroporous resin (model D101), and after the solvent was removed by rotary evaporation, it was added to a column pre-packed with macroporous resin (2.0kg of D101 macroporous resin). Three column volumes of 20% (v / v) ethanol aqueous solution (15kg) were used for elution. The eluent was collected, concentrated, and the solvent removed to obtain target sample 2-2.

[0055] Sample 2-2 was concentrated by rotary evaporation to remove water, and then mixed with 80g of 200-300 mesh silica gel. 800g of 200-300 mesh silica gel was packed into a column, followed by the mixed silica gel. Elution was initiated with 1kg of ethyl acetate:ethanol (volume ratio 20:1). This 1kg solvent elutes other substances and should be discarded. Elution was then switched to 6kg of ethyl acetate:ethanol (volume ratio 10:1). The eluent was collected, concentrated, and the solvent removed to obtain sample 2-3, the purified product. HPLC analysis showed the product mass to be 52g, with a swertiamarin purity of 96.2%.

[0056] Example 3

[0057] 1. TRPV1 activity test

[0058] The effect of samples on TRPV1 expression was detected using quantitative real-time PCR (qRT-PCR).

[0059] 1.1 Cell Plating

[0060] When the HacaT (human keratinocyte) cell confluence density reaches 80%-90%, digest the cells for 5-7 minutes and then seed them into 24-well plates, 8 x 10 cells per well. 4 Cell count, volume 500 μL, cultured for 24 hours.

[0061] 1.2 Sample incubation

[0062] A maintenance solution containing 1% (w / w) penicillin and 1% (w / w) streptomycin was prepared. The blank control group served as the maintenance solution; the negative control group served as the maintenance solution containing 1 μmol / L capsaicin; the positive control group served as the maintenance solution containing 1 μmol / L capsaicin and 3 μmol / L capsaicin; the sample group consisted of maintenance solutions containing 1 μmol / L capsaicin and samples of different concentrations. The samples of different concentrations were prepared as follows: a product stock solution was prepared at a concentration of 1% (w / w) using the product obtained in Example 1 (where the purity of swertiamarin was 95.6%). This stock solution was then added to the maintenance solution used in the sample group to prepare samples at concentrations of 5%, 1%, and 0.1% of the product stock solution. Each treatment was performed in triplicate, and samples were collected after 24 hours. Before collection, residual culture medium was washed away with PBS buffer.

[0063] 1.3 RNA extraction

[0064] Use the ER501 full-gold RNA extraction kit, with a concentration of 30-100 ng / μL and a volume of 30 μL, and follow the kit instructions.

[0065] 1.4 Reverse transcription

[0066] Use the AT311 All Gold Reverse Transcription Kit, 20 μL reverse transcription volume, and follow the kit instructions.

[0067] 1.5qRT-PCR

[0068] The reagent kit is made of all-gold. Green qPCR SuperMix (AQ601) was used with primers TRPV1 and GAPDH. The specific primer sequences were: TRPV1-F: GGCTGTCTTCATCATCCTGCTGCT, TRPV1-R: GTTCTTGCTCTCCTGTGCGATCTTGT; GAPDH-F: TCAGAAGGTGGTGAAGCAGG, GAPDH-R: AGCGTCAAAGGTGGAGGAGTG. The reverse-transcribed cDNA was appropriately diluted before use, and the TRPV1 gene expression level was calculated using the 2-ΔΔCT method.

[0069] Table 2 TRPV1 gene expression levels

[0070]

[0071]

[0072] Results (Table 2) Figure 2 , Figure 3 The results showed that a 5% concentration of the product stock solution (i.e., 0.05% concentration of the product from Example 1) could downregulate TRPV1 mRNA levels, with an inhibition rate of 34.65%, significantly better than the positive control capsaicin (3 μmol / L capsaicin, with an inhibition rate of 28.42%). A 1% concentration of the product stock solution (i.e., 0.01% concentration of the product from Example 1) could downregulate TRPV1 mRNA levels, with an inhibition rate of 21.31%, while a 0.1% concentration of the product stock solution had no significant effect on TRPV1 mRNA levels. This indicates that swertiamarin has significant inhibitory activity against the TRPV1 ion channel.

[0073] 2. Anti-inflammatory activity test

[0074] The effects of swertiamarin on TNF-α and IL-1β inflammatory factors were detected using an ELISA kit.

[0075] Experimental methods: Cell plating: 2 × 10⁶ cells / mL 5 RAW264.7 (mouse mononuclear macrophage leukemia cells) were seeded at a concentration of 100 μL / mL in 96-well plates and cultured for 24 hours. The solution in the wells was discarded, and the cells were washed once with PBS buffer. Three parallel wells were prepared for each concentration, with 100 μL per well. The cells were incubated for 24 hours. The DMEM medium used below was serum-free and contained 1% penicillin and 1% streptomycin. The solutions used for cell incubation were as follows: the blank group was 100 μL of DMEM medium; the negative control group was 100 μL of DMEM medium containing 1 μg / mL LPS (Lipopolysaccharide); the positive control group was 100 μL of DMEM medium containing 0.01% dexamethasone and 1 μg / mL LPS; the sample groups were DMEM medium containing different concentrations of samples and 1 μg / mL LPS. The different concentrations of samples were prepared as follows: the product obtained in Example 1 (where the purity of swertiamarin was 95.6%) was used to prepare a product stock solution at a concentration of 1% by mass. Then, the product stock solution was added to the DMEM medium used as the sample group to prepare samples with product stock solution concentrations of 5%, 1%, and 0.1%, respectively.

[0076] Method for calculating the inhibition rate of inflammatory factors: Inhibition rate = (Expression level of sample group - Expression level of LPS-stimulated group) / Expression level of LPS-stimulated group * 100%; where the expression level of inflammatory factors is in pg / mL, and the expression level of LPS-stimulated group (i.e. negative control group) refers to the expression level calculated by subtracting the absorbance value of the blank group detected by the ELISA reader.

[0077] The results of the inhibitory activity of swertia triterpenoids against TNF-α and IL-1β are shown in Table 3 and... Figure 4 Table 4 and Figure 5 As shown, experiments were conducted at concentrations of 5%, 1%, and 0.1% of the product mother liquor (i.e., 0.05%, 0.01%, and 0.001% of the product from Example 1). First, the 1% and 5% concentrations of the product mother liquor were screened for their inhibitory activity against TNF-α (inhibition rates of 58.93% and 88.82%) and IL-1β (inhibition rates of 89.81% and 99.18%), showing relatively good activity. Subsequently, a secondary screening was performed at the 0.1% concentration of the product mother liquor, which showed moderate inhibitory activity against TNF-α (inhibition rate of 42.30%) and IL-1β (inhibition rate of 45.83%). This indicates that swertiamarin possesses good anti-inflammatory activity.

[0078] Table 3. Inhibition rate of swine glycosides against TNF-α

[0079]

[0080] Table 4. Inhibition rate of swine glycosides against IL-1β

[0081]

Claims

1. A method for preparing jionoside, characterized in that, The method comprises the following steps: S1. taking the above-ground part of the dried Jia- na plant, crushing to obtain a powder of the material to be extracted; S2. adding the powder of the material to be extracted into a 30% ethanol aqueous solution, fully extracting in an ultrasonic extraction tank, filtering, recovering the extraction liquid, concentrating to obtain a crude extract; S3. adding the crude extract into a macroporous resin for sample mixing, evaporating to remove the solvent, then loading the column, eluting with a 20% ethanol aqueous solution, collecting the eluate, and concentrating to remove the solvent to obtain sample 1-1; S4. dissolving sample 1-1 in a 95% ethanol aqueous solution, mixing with 100-200 mesh silica gel, loading the column, eluting with a dichloromethane: ethanol solution with a volume ratio of 25:1 to remove impurities, then changing to a dichloromethane: methanol solution with a volume ratio of 15:1 to elute, collecting the eluate, and concentrating to remove the solvent to obtain sample 1-2; S5. dissolving sample 1-2 in a 95% ethanol aqueous solution, mixing with 200-300 mesh silica gel, loading the column, eluting with an ethyl acetate: ethanol solution with a volume ratio of 20:1 to remove impurities, then changing to an ethyl acetate: ethanol solution with a volume ratio of 10:1 to elute, collecting the eluate, and concentrating to remove the solvent to obtain jia-na bitter glycoside.

2. A method for preparing jatrophorin, characterized by, The method comprises the following steps: S1. taking the above-ground part of the dried Jia- na plant, crushing to obtain a powder of the material to be extracted; S2. adding the powder of the material to be extracted into a 30% ethanol aqueous solution, fully extracting in an ultrasonic extraction tank, filtering, recovering the extraction liquid, concentrating to obtain a crude extract; S3. adding the crude extract into a macroporous resin for sample mixing, evaporating to remove the solvent, then loading the column, eluting with a 20% ethanol aqueous solution, collecting the eluate, and concentrating to remove the solvent to obtain sample 1-1; S4. dissolving sample 1-1 in a 95% ethanol aqueous solution, mixing with 100-200 mesh silica gel, loading the column, eluting with a dichloromethane: ethanol solution with a volume ratio of 25:1 to remove impurities, then changing to a dichloromethane: methanol solution with a volume ratio of 15:1 to elute, collecting the eluate, and concentrating to remove the solvent to obtain sample 1-2; S5. dissolving sample 1-2 in a 95% ethanol aqueous solution, mixing with 200-300 mesh silica gel, loading the column, eluting with an ethyl acetate: ethanol solution with a volume ratio of 20:1 to remove impurities, then changing to an ethyl acetate: ethanol solution with a volume ratio of 10:1 to elute, collecting the eluate, and concentrating to remove the solvent to obtain jia-na bitter glycoside.

3. The method according to claim 1 or 2, characterized in that, The step S2 is: adding 1 part by mass of the powder of the material to be extracted into 8 parts by mass of a 30% ethanol aqueous solution, extracting at 25℃ for 24 h in an ultrasonic extraction tank, filtering, recovering the extraction liquid; the filter residue is extracted again, filtering, recovering the extraction liquid, combining the extraction liquids of the two times, and concentrating to obtain a crude extract.

Citation Information

Patent Citations

  • Method for extracting active constituent from Swertia mussotii plant

    CN102503996A

  • Anti-aging anti-wrinkle composition and applications thereof

    CN109602668A

  • Active substance and preparation and anti-inflammatory application thereof

    CN112870246A

  • Tibetan medicine composition for treating icteric hepatitis and preparation method thereof

    CN113599441A

  • Formulations for treating fine and wrinkles and uses thereof

    CN118765193A