A composite material of trispyridine ruthenium and polyoxometalate, a preparation method, application and sensor
By loading terpyridine ruthenium with polyoxometalates to form the composite material Ru-Co4P2W18, the problem of low luminescence stability of terpyridine ruthenium was solved, and high sensitivity and stability detection of phthalate compounds was achieved.
Patent Information
- Application Number
- CN202510289433.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-12
- Publication Date
- 2025-10-14
- Estimated Expiration
- 2045-03-12
AI Technical Summary
The existing ruthenium terpyridine electrochemiluminescence reagent has the problem of low luminescence stability, which affects the accuracy of the detection results.
Polyoxometalates are used as solid supporting materials to load terpyridine ruthenium through electrostatic interaction to form a composite material Ru-Co4P2W18, thereby improving its electrochemiluminescence performance and stability.
The electrochemiluminescence performance and stability of terpyridine ruthenium were significantly improved, and rapid, sensitive and specific detection of phthalate compounds was achieved, which is suitable for real-time monitoring in water environments.
Smart Images

Figure CN120059730B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of electrochemiluminescent materials, and in particular to a composite material of terpyridine ruthenium and polyoxometalate, a preparation method, an application and a sensor. Background Art
[0002] Phthalate esters (PAEs) are the most widely used plasticizers worldwide. Because PAEs are physically bonded to the plastic matrix rather than chemically, they easily migrate into the environment during production, use, and disposal. Through surface runoff and atmospheric deposition, PAEs eventually enter oceans, rivers, lakes, and other water bodies, causing persistent pollution. DBP, a typical example, exhibits strong migration and bioaccumulation.
[0003] The harms of DBP to ecosystems and human health are multiple and irreversible. Studies have confirmed that DBP in water bodies can be directly enriched by aquatic organisms and transmitted to humans through the food chain, causing systemic toxicity such as immune system damage, metabolic disorders, and endocrine disorders. Its genotoxicity and developmental toxicity may also pose transgenerational genetic risks. It is worth noting that the pollution exposure concentration of DBP is an order of magnitude different from the conventional detection limit (μg / L level), which means that even low concentrations of residues can have significant biological effects, which places strict requirements on the sensitivity and timeliness of detection technology.
[0004] While existing detection technologies, such as gas chromatography, liquid chromatography, and their coupling with mass spectrometry, can achieve accurate detection, they face significant application bottlenecks. Firstly, the large-scale instrumentation is expensive to purchase (a single mass spectrometer can cost millions), requiring specialized personnel for operation and complex maintenance. Secondly, samples require tedious pre-treatment procedures such as solid-phase extraction and derivatization (taking 4-6 hours), making rapid on-site analysis difficult. More critically, current methods fail to meet the real-time, portability, and high-throughput requirements for in-situ monitoring of water environments. These technical limitations result in delayed pollution warnings, directly impacting the effectiveness of environmental risk assessments and remediation decisions, and constituting a technological shortcoming that hinders the prevention and control of DBP pollution.
[0005] Electrochemiluminescence (ECL) is a detection method that generates light signals through electrochemical excitation. Its core principle is to apply a specific voltage to the electrode surface to drive the electroactive substance to undergo a redox reaction to generate an excited state. This technology combines the high controllability of electrochemistry with the high sensitivity of chemiluminescence. It is an ideal combination of electrochemistry and spectroscopy and has been widely used in diagnosis, analysis and environmental testing. Among them, terpyridine ruthenium, as a commonly used electrochemiluminescence reagent, has good electrochemiluminescence properties, but due to its extremely strong water solubility, it is easy to leak from the glassy carbon electrode into the solution, resulting in unstable luminescence and affecting the accuracy of the detection results. Therefore, seeking a luminescent material with stable luminescence to improve its electrochemiluminescence stability is a key issue for its better application. Summary of the Invention
[0006] In view of this, the object of the present invention is to provide a composite material of ruthenium terpyridine and polyoxometalate, a preparation method, an application and a sensor to solve the problem of low luminescence stability of the existing ruthenium terpyridine as an electrochemiluminescent reagent.
[0007] In order to achieve the above object, the technical solution adopted by the present invention is as follows:
[0008] A composite material of terpyridine ruthenium and polyoxometalate comprises polyoxometalate, wherein the polyoxometalate is loaded with terpyridine ruthenium.
[0009] According to the above technical means, polyoxometalate is used as a solid material to load terpyridine ruthenium through electrostatic action to obtain a composite material. 18 ) as an electrochemiluminescent material, significantly improving the electrochemiluminescent performance and stability of terpyridine ruthenium. This effectively addresses the low luminescence stability issue of existing terpyridine ruthenium electrochemiluminescent reagents.
[0010] Preferably, the polyoxometalate loads the terpyridine ruthenium through electrostatic interaction.
[0011] Preferably, the polyoxometalate is selected from Co4P2W 18 .
[0012] Among them, polyoxometalates are a new type of nano-inorganic macromolecules, a group of cluster compounds composed of multiple metal atoms and heteroatoms with a certain structure, bridged by oxygen atoms. Due to their unique electronic properties and diverse structures, polyoxometalates are widely used in various fields such as materials, catalysis and supercapacitors. 18 It is a unique polyoxometalate with unique morphology, stable atomic composition and certain size. 18It has good water solubility and exists in ultrapure water as a large anion with negative charge. It can absorb a large amount of positively charged terpyridine ruthenium, which provides the feasibility for it to become an excellent luminescent solid support material. 18 The molecular formula of polyoxometalate in this application is abbreviated as Co4P2W 18 The full name is K 10 Co4(H2O)2(PW9O 34 )2.
[0013] The present invention also provides a method for preparing a composite material, comprising the following steps:
[0014] Tungstate, cobalt salt, phosphate and hydrochloric acid are added to water, heated to reflux, cooled and filtered to obtain a filtrate;
[0015] Add chloride salt to the filtrate and filter to obtain a precipitate;
[0016] dissolving the precipitate and recrystallizing it to obtain polyoxometalate;
[0017] Dispersing dichlorotris(2,2′-bipyridine)ruthenium(II) hexahydrate (Ru(bpy)3Cl2·6H2O) in water to obtain a dichlorotris(2,2′-bipyridine)ruthenium(II) solution, and dispersing a polyoxometalate in water to obtain a polyoxometalate solution;
[0018] Under heating and stirring conditions, a polyoxometalate solution is added dropwise into a dichlorotris(2,2'-bipyridine)ruthenium(II) solution to obtain a composite material.
[0019] Polyoxometalates are prepared by heating and reflux, which effectively improves the yield and purity of polyoxometalates.
[0020] By adding the polyoxometalate solution dropwise to the dichlorotris(2,2′-bipyridine)ruthenium(II) solution and combining it with heating conditions, not only the reaction rate is effectively improved, but also the uniform loading of terpyridine ruthenium is effectively ensured, thereby ensuring the composite material (Ru-Co4P2W 18 ) as an electrochemiluminescent material.
[0021] After adding the polyoxometalate solution dropwise to the dichlorotris(2,2′-bipyridine)ruthenium(II) solution, the cations (Ru(bpy)3 2- ) and anions (Cl - ) dissociate, the metal cations in the polyoxometalates (K + ) and polyacid anions (Co4(H2O)2(PW9O 34 )210- ) dissociates, making the cation (Ru(bpy)3 2- ) and polyacid anions (Co4(H2O)2(PW9O 34 )2 10- ) combined to form Ru-Co4P2W 18 Composite material, namely [Ru(bpy)3]5[Co4(H2O)2(PW9O 34 )2] Composite materials.
[0022] Preferably, the heating reflux temperature is 110° C. to 130° C., and the time is 10 h to 14 h.
[0023] Preferably, the heating reflux temperature is 120°C.
[0024] Preferably, the recrystallization temperature is 3°C to 8°C.
[0025] Preferably, the heating temperature for slowly adding the polyoxometalate solution is 60° C. to 70° C.
[0026] Preferably, the mass ratio of the tungstate, cobalt salt, phosphate and chloride salt is 10~20:1.8g~3.9:0.48~0.96:10~20.
[0027] Preferably, the mass ratio of dichlorotris(2,2′-bipyridine)ruthenium(II) hexahydrate (Ru(bpy)3Cl2·6H2O) to polyoxometalate is 18.7-37.4:274.1-548.2.
[0028] Preferably, the tungstate is selected from Na2WO4·2H2O and / or Na2WO4.
[0029] Preferably, the cobalt salt is selected from Co(NO3)2 and / or Co(NO3)2·6H2O.
[0030] Preferably, the phosphate is selected from Na2HPO4.
[0031] Preferably, the chloride salt is selected from KCl.
[0032] The present invention also provides an application of the composite material as an electrochemiluminescent material.
[0033] The present invention also provides a sensor comprising the composite material of the present invention.
[0034] Preferably, the sensor is an electrochemiluminescence sensor.
[0035] Preferably, the method for preparing the electrochemiluminescence sensor comprises the following steps:
[0036] S1, polyoxometalate Co4P2W 18 {K 10 Co4(H2O)2(PW9O 34 Preparation of )2·20H2O}:
[0037] 10 g to 20 g of Na2WO4·2H2O, 1.8 g to 3.9 g of Co(NO3)2·6H2O, 0.48 g to 0.96 g of Na2HPO4, and 3.1 mL to 6.2 mL of 6 M aqueous hydrochloric acid were mixed and added to 100 mL of water, immediately producing an insoluble light purple substance and a light red to dark red upper layer to obtain a mixture; the mixture was heated to reflux at 110°C to 130°C for 12 h, and after the mixture was cooled, the insoluble light purple solid was filtered out to obtain a filtrate; an excess of KCl (10 g to 20 g) was added to the filtrate, immediately producing a precipitate; the precipitate was filtered out to obtain a precipitate; the precipitate was dissolved in boiling water to obtain a mixed solution, and the mixed solution was recrystallized at 5°C overnight to obtain blue-purple crystals, namely Co4P2W 18 .
[0038] S2、Ru-Co4P2W 18 Preparation:
[0039] 18.7 mg to 37.4 mg of dichlorotris(2,2′-bipyridyl)ruthenium(II) hexahydrate (Ru(bpy)3Cl2·6H2O) and 274.1 mg to 548.2 mg of blue-purple crystals of Co4P2W 18 Dispersed in 10 mL of deionized water and stirred for 10 min to obtain Ru(bpy)3Cl2 solution and Co4P2W 18 Then, the Ru(bpy)3Cl2 solution was stirred continuously at 65 °C and Co4P2W was slowly added dropwise. 18 The solution was stirred for 3 h, and the mixed solution changed from orange-red to khaki, and the mixed solution became turbid. The mixture was stirred for 3 h, and then the solid product was collected by centrifugal washing with water and ethanol. The solid product was dried overnight at 60 ° C to obtain a solid powder. After grinding the solid powder, Ru-Co4P2W 18 Nanoparticles.
[0040] S3, Fe-MoO v Preparation:
[0041] 0.30 g to 0.60 g of tannic acid (TA), 0.215 g to 0.43 g of sodium molybdate heptahydrate (Na2MoO4·7H2O), and 0.395 g to 0.79 g of ferric chloride (FeCl3) were dissolved in 35 mL of distilled water and stirred for 30 min to obtain a mixed solution. The mixed solution was transferred to a 50 mL Teflon-lined autoclave and reacted at 160 °C for 10 h. The solid product was collected and washed three times with distilled water to obtain Fe-MoO v .
[0042] S4, Fe-MoO v Preparation of encapsulated modified polydopamine (FMP):
[0043] 10 mg~20 mg Fe-MoO v Dispersed in 30 mL deionized water, ultrasonicated for 8 h, and obtained Fe-MoO v Solution; 200 mg~400 mg of 4-amino-2,2,6,6-tetramethylpiperidinyloxy free radical (TEMPO-NH2) was fully dissolved in 80 mL of deionized water and magnetically stirred for 20 min to obtain TEMPO-NH2 solution; 100 mg~200 mg of dopamine hydrochloride was dissolved in 20 mL of deionized water to obtain dopamine hydrochloride solution; the dopamine hydrochloride solution was quickly injected into the TEMPO-NH2 solution, stirred for 4 h, and then the Fe-MoO v The solution was stirred for 5 h, and then the solid product was collected by centrifugal washing in water and ethanol. The solid product was dried at 60 ° C overnight to obtain a solid powder. The solid powder was ground to obtain FMP nanoparticles.
[0044] S5. Preparation of FMPs for aptamer incubation:
[0045] The carboxyl-modified aptamer apta1 (5'-HOOC-CTTTCTGTCCTTCCGTCACATCCCACGCATTCTCCACATCGCTCAGCTC-3') was first activated by amide condensation, which included adding 50 μL of 5 mg / mL 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) and 100 μL of 5 mg / mL N-hydroxysuccinimide (NHS) to MES buffer (pH 6.0, 50 mM). Then, 200 to 400 μL of 2.5 μM aptamer apta1 was added and incubated for 30 min. Subsequently, 500 μL of 1 mg / mL aqueous solution of FMP nanoparticles was added and the mixture was reacted at room temperature for 4 h to obtain a mixed solution. The mixed solution was centrifuged at 8000 rpm for 10 min to remove unbound aptamer apta1 and obtain a precipitate. The precipitate was resuspended in 500 μL of 4% paraformaldehyde. The aptamer-incubated FMP solution was obtained by adding 1 μL of 10 mM PBS phosphate buffer solution (pH 7.4) containing BSA (0.5% w / v) and 0.05% (v / v) Tween-20 and stored at 4 °C.
[0046] S6. Preparation of electrochemiluminescence sensor:
[0047] 1) Polish a 4 mm diameter glassy carbon electrode with 1.0 µm, 0.3 µm, and 0.05 µm alumina polishing powders in sequence and rinse with ultrapure water.
[0048] 2) Ru-Co4P2W 18 Ultrasonication was performed until all particles were evenly dispersed in water to prepare Ru-Co4P2W with a concentration of 3~6 mg / mL. 18 Suspension: add 10 μL of the suspension onto the surface of the glassy carbon electrode washed in step 1) as a sensing substrate, and place it at 37 °C to dry;
[0049] 3) Add 10 μL of 0.4% wt chitosan solution to the surface of the glassy carbon electrode dried in step 2) and place it at 37°C to dry;
[0050] 4) Add 100 μL of DNA1 (5'-HOOC-GAGCTGAGCG-3') to a 1 mg / mL mixture of N-hydroxysuccinimide (NHS) and 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC). Stir thoroughly and then drop 10 μL onto the dried glassy carbon electrode from step 3) and incubate at 37°C to air dry. Then, rinse three times with pH 7.4 PBS buffer to remove unbound DNA1 and residual EDC and NHS, and incubate at 37°C to air dry.
[0051] 5) Add 3 µL of 1-3% bovine serum albumin solution to the surface of the glassy carbon electrode dried in step 4) to block nonspecific active sites on the electrode surface. Rinse the electrode surface with pH 7.4 phosphate buffer solution (PBS) and allow to dry at 4°C.
[0052] 6) Add 5 µL of the 1 mg / mL aptamer-incubated FMP solution to the surface of the glassy carbon electrode dried in step 5), rinse the electrode surface with pH 7.4 phosphate buffer solution (PBS), and place it at 4°C to dry. The construction is complete to obtain an electrochemiluminescent sensor.
[0053] Wherein, the nucleotide sequence of DNA1 is shown as SEQ ID No. 1;
[0054] The sequence of SEQ ID No. 1 is: GAGCTGAGCG;
[0055] The nucleotide sequence of apta1 is shown in SEQ ID No. 2;
[0056] The sequence of SEQ ID No. 2 is:
[0057] CTTTCTGTCCTTCCGTCACATCCCACGCATTCTCCACATCGCTCAGCTC.
[0058] Preferably, the sensor is used to detect phthalate esters (PAEs) in water.
[0059] Preferably, the electrochemiluminescence sensor is used to detect butylene phthalate (DBP) in water, including electrochemiluminescence test and colorimetric analysis test.
[0060] The colorimetric analysis test includes the following steps:
[0061] (1) The constructed electrochemiluminescence sensor is immersed in a soaking solution containing butyl phthalate 2 mL PBS buffer solution (pH 4.0 ~ 3.0) for 10 min; the electrochemiluminescence sensor is washed once with 1 mL of pH 4.0 ~ 3.0 PBS buffer solution, and the washing solution is re-injected into the soaking solution; at this time, the electrochemiluminescence sensor can be tested for electrochemiluminescence;
[0062] (2) 200 μL of 3% hydrogen peroxide solution is added to the soaking solution, and it is left to stand for 5 min, then 100 μL of TMB solution is added, and it is observed that the solution changes from colorless to blue, and the higher the concentration of DBP contained in the soaking solution, the deeper the blue color, and the test is completed.
[0063] The electrochemiluminescence test comprises the following steps:
[0064] (1) The three-electrode system of the electrochemical analyzer is used for testing, the saturated silver / silver chloride electrode is used as the reference electrode, the platinum electrode is used as the auxiliary electrode, and the prepared electrochemiluminescence sensor is used as the working electrode, and the test is carried out in 10 mL, pH 6.0 ~ 8.0 PBS, 50 mM ~ 180 mM potassium persulfate solution;
[0065] (2) The cyclic voltammetry is used for detecting butyl phthalate (DBP), and the voltage range is set to -1.5 V ~ 0V, and the photomultiplier tube voltage is 800 V;
[0066] (3) After the electrode device is completed, the instrument is started, the electrochemiluminescence signal intensity corresponding to different concentrations of DBP is detected, and a working curve is drawn;
[0067] (4) The DBP sample solution to be tested is used to replace the DBP standard solution for detection, and the concentration of DBP in the DBP sample solution to be tested is obtained.
[0068] Preferably, the sensor is used for detecting butyl phthalate (DBP) in water, and the electrochemiluminescence detection linear range of the sensor for butyl phthalate (DBP) is 0.1 pg / mL ~ 100 ng / mL, and the visual colorimetric detection linear range is 0.1 ng / mL ~ 100 ng / mL.
[0069] Preferably, the sensor is used for detecting butyl phthalate (DBP) in the ocean or river.
[0070] The beneficial effects of the present application are:
[0071] The composite material of the present application successfully synthesizes a polyoxometalate K 10 Co4(H2O)2(PW9O 34)2·20H2O as a solid carrier material by electrostatic interaction to load terpyridine ruthenium to obtain a composite material, and the composite material is used as an electrochemiluminescence material in an electrochemiluminescence sensor (Ru-Co4P2W 18 )2·20H2O, the electrochemiluminescence performance and stability of terpyridine ruthenium are significantly improved due to the presence of the polyoxometalate K 10 Co4(H2O)2(PW9O 34 )2·20H2O, the problem of low luminescence stability of the existing terpyridine ruthenium as an electrochemiluminescence reagent is solved. At the same time, due to the unique structure and electronic properties of the polyoxometalate, the luminescence signal is further improved.
[0072] The sensor of the present application uses the composite material (Ru-Co4P2W 18 ) as an electrochemiluminescence material in an electrochemiluminescence sensor for detection of butyl phthalate (DBP) in water, has the advantages of short response time, wide linear range, low detection limit, good stability and reproducibility, and can realize simple, fast, high-sensitivity and specific detection. Through experimental determination, the electrochemiluminescence sensor of the present application has a linear range of 0.1 pg / mL ~ 100 ng / mL for electrochemiluminescence detection of DBP. The visual colorimetric detection linear range is 0.1 ng / mL ~ 100 ng / mL, which significantly improves the sensitivity and accuracy of detection, and has great popularization and application value in the field of electrochemiluminescence materials technology. BRIEF DESCRIPTION OF DRAWINGS
[0073] Figure 1 SEM image of Ru-Co4P2W 18 nanoparticles prepared in Example 1;
[0074] Figure 2 TEM image of Ru-Co4P2W 18 nanoparticles prepared in Example 1;
[0075] Figure 3 EDS image of Ru-Co4P2W 18 nanoparticles prepared in Example 1;
[0076] Figure 4 EDS spectrum surface scanning analysis result image of Ru-Co4P2W 18 nanoparticles prepared in Example 1;
[0077] Figure 5 Infrared spectrum of Co4P2W 18 prepared in S4 in Example 1;
[0078] Figure 6is the electrochemiluminescence working curve;
[0079] Figure 7 The Ru-Co4P2W prepared in Example 1 18 Electrochemiluminescence stability test results of nanoparticles. DETAILED DESCRIPTION
[0080] The following will describe the embodiments of the present invention with reference to preferred embodiments. Those skilled in the art will readily appreciate the other advantages and benefits of the present invention from the disclosure herein. The present invention may also be implemented or applied through various other specific embodiments, and the details in this specification may be modified or altered based on different viewpoints and applications without departing from the spirit of the present invention. It should be understood that the preferred embodiments are intended only to illustrate the present invention and are not intended to limit the scope of protection of the present invention.
[0081] Example 1
[0082] A method for preparing a composite material of ruthenium terpyridine and polyoxometalate comprises the following steps:
[0083] S1. Add 20 g of Na2WO4·2H2O, 3.9 g of Co(NO3)2·6H2O, 0.96 g of Na2HPO4, and 6.2 mL of 6 M aqueous hydrochloric acid to 100 mL of water to obtain a mixture;
[0084] S2, heating the mixture obtained in S1 under reflux at 120° C. for 12 h, cooling, and filtering to obtain a filtrate;
[0085] S3. Add excess KCl (20 g) to the filtrate obtained in S2 to obtain a precipitate;
[0086] S4. Dissolve the precipitate obtained in S3 in boiling water and recrystallize it. Recrystallize it at 5 °C overnight to obtain blue-purple crystals, namely Co4P2W 18 ;
[0087] S5, 37.4 mg dichlorotris(2,2′-bipyridyl)ruthenium(II) hexahydrate (Ru(bpy)3Cl2·6H2O) and 548.2 mg Co4P2W 18 Dispersed in 10 mL of deionized water and stirred for 10 min to obtain Ru(bpy)3Cl2 solution and Co4P2W 18 solution;
[0088] S6. Stir the Ru(bpy)3Cl2 solution at 65°C and slowly add Co4P2W 18The solution was stirred for 3 h, and the solid product was collected by centrifugal washing with water and ethanol. The solid product was dried at 60 ° C overnight to obtain a solid powder. The solid powder was ground to obtain Ru-Co4P2W 18 Nanoparticles.
[0089] Example 2
[0090] A method for preparing a composite material of ruthenium terpyridine and polyoxometalate comprises the following steps:
[0091] S1. Add 10 g of Na2WO4·2H2O, 1.8 g of Co(NO3)2·6H2O, 0.48 g of Na2HPO4, and 3.1 mL of 6 M aqueous hydrochloric acid to 100 mL of water to obtain a mixture;
[0092] S2, heating the mixture obtained in S1 under reflux at 110° C. for 12 h, cooling, and filtering to obtain a filtrate;
[0093] S3. Add excess KCl (20 g) to the filtrate obtained in S2 to obtain a precipitate;
[0094] S4. Dissolve the precipitate obtained in S3 in boiling water and recrystallize it. Recrystallize it at 5 °C overnight to obtain blue-purple crystals, namely Co4P2W 18 ;
[0095] S5, 18.7 mg dichlorotris(2,2′-bipyridyl)ruthenium(II) hexahydrate (Ru(bpy)3Cl2·6H2O) and 274.1 mg Co4P2W 18 Dispersed in 10 mL of deionized water and stirred for 10 min to obtain Ru(bpy)3Cl2 solution and Co4P2W 18 solution;
[0096] S6. Stir the Ru(bpy)3Cl2 solution at 65°C and slowly add Co4P2W 18 The solution was stirred for 3 h, and the solid product was collected by centrifugal washing in water and ethanol. The solid product was dried overnight at 60 ° C to obtain a solid powder. The solid powder was ground to obtain Ru-Co4P2W 18 Nanoparticles.
[0097] Example 3
[0098] A method for preparing a composite material of ruthenium terpyridine and polyoxometalate comprises the following steps:
[0099] S1, 15 g Na2W04-2H20, 2.7 g Co(N03)2-6H20, 0.72 g Na2HP04and 4.65 mL 6 M aqueous hydrochloric acid were added to 100 mL water to obtain a mixture;
[0100] S2, the mixture obtained in S1 was heated to reflux at a temperature of 120 °C for 12 h, cooled, and filtered to obtain a filtrate;
[0101] S3, an excess of KCl (15 g) was added to the filtrate obtained in S2 to obtain a precipitate;
[0102] S4, the precipitate obtained in S3 was dissolved with boiling water and recrystallized at a temperature of 5 °C overnight to obtain blue-violet crystals, namely Co4P2W 18 ;
[0103] S5, 28.05 mg of dichlorotris(2,2'-bipyridine)ruthenium(II) hexahydrate (Ru(bpy)3Cl2-6H20) and 411.15 mg of Co4P2W 18 were separately dispersed in 10 mL of deionized water and stirred for 10 min to obtain a Ru(bpy)3Cl2solution and a Co4P2W 18 solution;
[0104] S6, the Ru(bpy)3Cl2solution was continuously stirred at a temperature of 65 °C, and the Co4P2W 18 solution was slowly added dropwise, and stirring was continued for 3 h. The solid product was collected by centrifugal washing with water and ethanol, and the solid product was dried at a temperature of 60 °C overnight to obtain a solid powder, which was ground to obtain Ru-Co4P2W 18 nanoparticles.
[0105] Example 4
[0106] A method for preparing an electrochemiluminescence sensor, comprising the following steps:
[0107] Step (1) preparation of FMP for aptamer incubation:
[0108] S1, 0.60 g of tannic acid (TA), 0.43 g of sodium molybdate heptahydrate (Na2Mo04-7H20) and 0.79 g of ferric chloride (FeCl3) were dissolved in 35 mL of distilled water, stirred for 30 min to obtain a mixed solution; the mixed solution was transferred to a 50 mL Teflon-lined autoclave and reacted at a temperature of 160 °C for 10 h. The solid product was collected and washed with distilled water three times to obtain Fe-MoO v ;
[0109] S2, 20 mg of Fe-MoO obtained in S1 v Dispersed in 30 mL deionized water, ultrasonicated for 8 h, and obtained Fe-MoO v Solution; 400 mg of 4-amino-2,2,6,6-tetramethylpiperidinyloxy free radical (TEMPO-NH2) was fully dissolved in 80 mL of deionized water and magnetically stirred for 20 min to obtain TEMPO-NH2 solution; 200 mg of dopamine hydrochloride was dissolved in 20 mL of deionized water to obtain dopamine hydrochloride solution; the dopamine hydrochloride solution was quickly injected into the TEMPO-NH2 solution, stirred for 4 h, and then the Fe-MoO v The solution was stirred for 5 h, and the solid product was collected by centrifugation in water and ethanol. The solid product was dried at 60 ° C overnight to obtain a solid powder. The solid powder was ground to obtain FMP nanoparticles.
[0110] S3. The carboxyl-modified aptamer apta1 was first activated by amide condensation, specifically including: adding 50 μL of 5 mg / mL 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) and 100 μL of 5 mg / mL N-hydroxysuccinimide (NHS) to MES buffer solution (pH 6.0, 50 mM), then adding 400 μL of aptamer apta1 (2.5 μM), incubating for 30 min, and then adding 500 μL of 1 mg / mL aqueous solution of FMP nanoparticles in S2, reacting at room temperature for 4 h to obtain a mixed solution; the mixed solution was centrifuged at 8000 rpm for 10 min to remove unbound aptamer apta1, and a precipitate was obtained, which was the aptamer-incubated FMP; the precipitate was resuspended in 500 μL of BSA (0.5% w / v) and 0.05 The aptamer-incubated FMP solution was prepared in 10 mM PBS phosphate buffer solution (pH 7.4) containing 5% (v / v) Tween-20 and stored at 4 °C.
[0111] The nucleotide sequence of the aptamer apta1 is shown in SEQ ID No. 2;
[0112] The sequence of SEQ ID No. 2 is:
[0113] CTTTCTGTCCTTCCGTCACATCCCACGCATTCTCCACATCGCTCAGCTC.
[0114] The carboxyl-modified aptamer apta1 is 5′-HOOC-CTTTCTGTCCTTCCGTCACATCCCACGCATTCTCCACATCGCTCAGCTC-3′.
[0115] Step (2) Preparation of electrochemiluminescence sensor:
[0116] S1. Polish a 4 mm diameter glassy carbon electrode with 1.0 µm, 0.3 µm, and 0.05 µm alumina polishing powders in sequence and rinse with ultrapure water.
[0117] S2, the Ru-Co4P2W prepared in Example 1 18 Ultrasonication was performed until all particles were uniformly dispersed in water to obtain Ru-Co4P2W with a concentration of 6 mg / mL. 18 Suspension, add 10 μL of suspension to the surface of the glassy carbon electrode washed in S1 as the sensing substrate, and place it at 37 °C to dry;
[0118] S3, add 10 μL of 0.4%wt chitosan solution to the surface of the dried glassy carbon electrode in S2 and place it at 37°C to dry;
[0119] S4. Add 100 μL of DNA1 (5'-HOOC-GAGCTGAGCG-3') to a mixture of 1 mg / mL N-hydroxysuccinimide (NHS) and 1 mg / mL 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC). Stir thoroughly and drip 10 μL onto the dried glassy carbon electrode in S3. Allow to air dry at 37°C. Rinse three times with pH 7.4 PBS buffer to remove unbound DNA1 and residual EDC and NHS, and allow to air dry at 37°C.
[0120] S5. Add 3 μL of 1-3% bovine serum albumin solution to the surface of the glassy carbon electrode dried in step S4 to block nonspecific active sites on the electrode surface. Rinse the electrode surface with pH 7.4 phosphate buffer solution (PBS) and place it at 4°C to dry.
[0121] S6. Add 5 μL of the FMP solution incubated with the aptamer prepared in step (1) at a concentration of 1 mg / mL to the surface of the glassy carbon electrode dried in step S5, rinse the electrode surface with a pH 7.4 phosphate buffer solution (PBS), and place it at 4°C to dry. The construction is completed to obtain an electrochemiluminescence sensor.
[0122] Example 5
[0123] A method for preparing an electrochemiluminescence sensor comprises the following steps:
[0124] Step (1) Preparation of FMP for aptamer incubation:
[0125] S1, 0.30 g of tannic acid (TA), 0.215 g of sodium molybdate heptahydrate (Na2MoO4·7H2O) and 0.395 g of ferric chloride (FeCl3) were dissolved in 35 mL of distilled water, stirred for 30 min to obtain a mixed solution; the mixed solution was transferred to a 50 mL Teflon-lined autoclave, and reacted at a temperature of 160 °C for 10 h, and the solid product was collected and washed with distilled water three times to obtain Fe-MoO4; S2, 10 mg of Fe-MoO4obtained in S1 was dispersed in 30 mL of deionized water, and ultrasonic treatment was performed for 8 h to obtain a Fe-MoO4solution; 200 mg of 4-amino-2,2,6,6-tetramethylpiperidine oxyl free radical (TEMPO-NH2) was fully dissolved in 80 mL of deionized water, and magnetic stirring was performed for 20 min to obtain a TEMPO-NH2solution; 100 mg of dopamine hydrochloride was dissolved in 20 mL of deionized water to obtain a dopamine hydrochloride solution; the dopamine hydrochloride solution was quickly injected into the TEMPO-NH2solution, and after stirring for 4 h, the Fe-MoO4solution was quickly injected, and after stirring for 5 h, the solid product was collected by centrifugal washing in water and ethanol, and the solid product was dried at a temperature of 60 °C overnight to obtain a solid powder, and after grinding, FMP nanoparticles were obtained. v ;
[0126] S2, 10 mg of Fe-MoO4obtained in S1 was dispersed in 30 mL of deionized water, and ultrasonic treatment was performed for 8 h to obtain a Fe-MoO4solution; 200 mg of 4-amino-2,2,6,6-tetramethylpiperidine oxyl free radical (TEMPO-NH2) was fully dissolved in 80 mL of deionized water, and magnetic stirring was performed for 20 min to obtain a TEMPO-NH2solution; 100 mg of dopamine hydrochloride was dissolved in 20 mL of deionized water to obtain a dopamine hydrochloride solution; the dopamine hydrochloride solution was quickly injected into the TEMPO-NH2solution, and after stirring for 4 h, the Fe-MoO4solution was quickly injected, and after stirring for 5 h, the solid product was collected by centrifugal washing in water and ethanol, and the solid product was dried at a temperature of 60 °C overnight to obtain a solid powder, and after grinding, FMP nanoparticles were obtained. v v S2, 10 mg of Fe-MoO4obtained in S1 was dispersed in 30 mL of deionized water, and ultrasonic treatment was performed for 8 h to obtain a Fe-MoO4solution; 200 mg of 4-amino-2,2,6,6-tetramethylpiperidine oxyl free radical (TEMPO-NH2) was fully dissolved in 80 mL of deionized water, and magnetic stirring was performed for 20 min to obtain a TEMPO-NH2solution; 100 mg of dopamine hydrochloride was dissolved in 20 mL of deionized water to obtain a dopamine hydrochloride solution; the dopamine hydrochloride solution was quickly injected into the TEMPO-NH2solution, and after stirring for 4 h, the Fe-MoO4solution was quickly injected, and after stirring for 5 h, the solid product was collected by centrifugal washing in water and ethanol, and the solid product was dried at a temperature of 60 °C overnight to obtain a solid powder, and after grinding, FMP nanoparticles were obtained. v
[0127] S3. The carboxyl-modified aptamer apta1 was first activated by amide condensation, specifically including: adding 50 μL of 5 mg / mL 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) and 100 μL of 5 mg / mL N-hydroxysuccinimide (NHS) to MES buffer solution (pH 6.0, 50 mM), then adding 400 μL of aptamer apta1 (2.5 μM), incubating for 30 min, and then adding 500 μL of 1 mg / mL FMP nanoparticle solution in S2, reacting at room temperature for 4 h to obtain a mixed solution; the mixed solution was centrifuged at 8000 rpm for 10 min to remove unbound aptamer apta1, and a precipitate was obtained, which was the aptamer-incubated FMP; the precipitate was resuspended in 500 μL of BSA (0.5% w / v) and 0.05 The aptamer-incubated FMP solution was prepared in 10 mM PBS phosphate buffer solution (pH 7.4) containing 5% (v / v) Tween-20 and stored at 4 °C.
[0128] The nucleotide sequence of the aptamer apta1 is shown in SEQ ID No. 2;
[0129] The sequence of SEQ ID No. 2 is:
[0130] CTTTCTGTCCTTCCGTCACATCCCACGCATTCTCCACATCGCTCAGCTC.
[0131] The carboxyl-modified aptamer apta1 is 5′-HOOC-CTTTCTGTCCTTCCGTCACATCCCACGCATTCTCCACATCGCTCAGCTC-3′.
[0132] Step (2) Preparation of electrochemiluminescence sensor:
[0133] S1. Polish a 4 mm diameter glassy carbon electrode with 1.0 µm, 0.3 µm, and 0.05 µm alumina polishing powders in sequence and rinse with ultrapure water.
[0134] S2, the Ru-Co4P2W prepared in Example 2 18 Ultrasonication was performed until all particles were evenly dispersed in water to prepare Ru-Co4P2W with a concentration of 3 mg / mL. 18 Suspension, add 10 μL of suspension to the surface of the glassy carbon electrode washed in S1 as the sensing substrate, and place it at 37 °C to dry;
[0135] S3, add 10 μL of 0.4%wt chitosan solution to the surface of the dried glassy carbon electrode in S2 and place it at 37°C to dry;
[0136] S4. Add 100 μL of DNA1 (5'-HOOC-GAGCTGAGCG-3') to a mixture of 1 mg / mL N-hydroxysuccinimide (NHS) and 1 mg / mL 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC). Stir thoroughly and drip 10 μL onto the dried glassy carbon electrode in S3. Allow to air dry at 37°C. Rinse three times with pH 7.4 PBS buffer to remove unbound DNA1 and residual EDC and NHS, and allow to air dry at 37°C.
[0137] 5) Add 3 µL of 1-3% bovine serum albumin solution to the surface of the glassy carbon electrode dried in step 4) to block nonspecific active sites on the electrode surface. Rinse the electrode surface with phosphate buffered saline (PBS), pH 7.4, and allow to air dry at 4°C.
[0138] 6) Add 5 μL of the 1 mg / mL FMP solution incubated with the aptamer prepared in step (1) to the surface of the glassy carbon electrode dried in step 5), rinse the electrode surface with pH 7.4 phosphate buffer solution PBS, and place it at 4°C to dry. The construction is completed to obtain an electrochemiluminescence sensor.
[0139] Example 6
[0140] A method for preparing an electrochemiluminescence sensor comprises the following steps:
[0141] Step (1) Preparation of FMPs incubated with aptamers:
[0142] S1. Dissolve 0.45 g of tannic acid (TA), 0.323 g of sodium molybdate heptahydrate (Na2MoO4·7H2O), and 0.593 g of ferric chloride (FeCl3) in 35 mL of distilled water and stir for 30 min to obtain a mixed solution. Transfer the mixed solution into a 50 mL Teflon-lined autoclave and react at 160 °C for 10 h. Collect the solid product and wash it three times with distilled water to obtain Fe-MoO v ;
[0143] S2, 15 mg of Fe-MoO obtained in S1 v Dispersed in 30 mL deionized water, ultrasonicated for 8 h, and obtained Fe-MoO vSolution; 300 mg of 4-amino-2,2,6,6-tetramethylpiperidinyloxy free radical (TEMPO-NH2) was fully dissolved in 80 mL of deionized water and magnetically stirred for 20 min to obtain TEMPO-NH2 solution; 150 mg of dopamine hydrochloride was dissolved in 20 mL of deionized water to obtain dopamine hydrochloride solution; the dopamine hydrochloride solution was rapidly injected into the TEMPO-NH2 solution, stirred for 4 h, and then the Fe-MoO v The solution was stirred for 5 h, and then the solid product was collected by centrifugal washing in water and ethanol. The solid product was dried at 60 ° C overnight to obtain a solid powder. The solid powder was ground to obtain FMP nanoparticles.
[0144] S3. The carboxyl-modified aptamer apta1 was first activated by amide condensation, specifically including: adding 50 μL of 5 mg / mL 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) and 100 μL of 5 mg / mL N-hydroxysuccinimide (NHS) dissolved in MES buffer solution (pH 6, 50 mM) to 400 μL of aptamer apta1 (2.5 μM), incubating for 30 min, then adding 500 μL of 1 mg / mL aqueous solution of FMP nanoparticles in S2, and reacting at room temperature for 4 h to obtain a mixed solution; the mixed solution was centrifuged at 8000 rpm for 10 min to remove unbound aptamer apta1, and a precipitate was obtained, which was the aptamer-incubated FMP; the precipitate was resuspended in 500 μL of BSA (0.5% w / v) and 0.05 The aptamer-incubated FMP solution was prepared in 10 mM PBS phosphate buffer solution (pH 7.4) containing 5% (v / v) Tween-20 and stored at 4 °C.
[0145] The nucleotide sequence of the aptamer apta1 is shown in SEQ ID No. 2;
[0146] The sequence of SEQ ID No. 2 is:
[0147] CTTTCTGTCCTTCCGTCACATCCCACGCATTCTCCACATCGCTCAGCTC.
[0148] The carboxyl-modified aptamer apta1 is
[0149] 5'-HOOC-CTTTCTGTCCTTCCGTCACATCCCACGCATTCTCCACATCGCTCAGCTC-3'.
[0150] Step (2) Preparation of electrochemiluminescence sensor:
[0151] S1. Polish a 4 mm diameter glassy carbon electrode with 1.0 µm, 0.3 µm, and 0.05 µm alumina polishing powders in sequence and rinse with ultrapure water.
[0152] S2, the Ru-Co4P2W prepared in Example 3 18 Ultrasonication was performed until all particles were evenly dispersed in water to prepare Ru-Co4P2W with a concentration of 4.5 mg / mL. 18 Suspension, add 10 μL of suspension to the surface of the glassy carbon electrode washed in S1 as the sensing substrate, and place it at 37 °C to dry;
[0153] S3, add 10 μL of 0.4%wt chitosan solution to the surface of the dried glassy carbon electrode in S2 and place it at 37°C to dry;
[0154] S4. Add 100 μL of DNA1 (5'-HOOC-GAGCTGAGCG-3') to a mixture of 1 mg / mL N-hydroxysuccinimide (NHS) and 1 mg / mL 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC). Stir thoroughly and drip 10 μL onto the dried glassy carbon electrode in S3. Allow to air dry at 37°C. Rinse three times with pH 7.4 PBS buffer to remove unbound DNA1 and residual EDC and NHS, and allow to air dry at 37°C.
[0155] S5. Add 3 μL of 1-3% bovine serum albumin solution to the surface of the glassy carbon electrode dried in step S4 to block nonspecific active sites on the electrode surface. Rinse the electrode surface with pH 7.4 phosphate buffer solution (PBS) and place it at 4°C to dry.
[0156] S6. Add 5 μL of the FMP solution incubated with the aptamer prepared in step (1) at a concentration of 1 mg / mL to the surface of the glassy carbon electrode dried in step S5, rinse the electrode surface with a pH 7.4 phosphate buffer solution (PBS), and place it at 4°C to dry. The construction is completed to obtain an electrochemiluminescence sensor.
[0157] Example 7
[0158] A method for preparing an electrochemiluminescence sensor comprises the following steps:
[0159] Step (1) Aptamer incubation with MnO x Quencher preparation
[0160] 100 mg of KMnO4 was added to 50 mL of water and stirred vigorously for 0.5 h. Then, 1 mL of oleic acid (OA) was injected into the above mixture and stirred vigorously at room temperature for 5 h. After that, the rough brown-black product was centrifuged and washed several times with deionized water and alcohol to eliminate any residual reactants. The precipitate was dried in vacuum at 60 ° C. 0.25 g of MnO x , 80 mL of toluene and 0.5 mL of APTES were added to a three-necked flask and rapidly stirred at 120°C for 6 h. The mixture was centrifuged at 6500 rpm for 10 min, washed three times with water, and then collected. The precipitate was vacuum dried at 60°C to obtain amino-modified MnO x Nanoparticles.
[0161] The carboxyl-modified aptamer apta1 was first activated by amide condensation, which included adding 50 μL of 5 mg / mL 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) and 100 μL of 5 mg / mL N-hydroxysuccinimide (NHS) dissolved in MES buffer solution (pH 6, 50 mM) to 400 μL of aptamer apta1 (2.5 μM), incubating for 30 min, and then adding 500 μL of 1 mg / mL MnO in (1). x The nanoparticles aqueous solution was reacted at room temperature for 4 h to obtain a mixed solution; the mixed solution was centrifuged at 8000 rpm for 10 min to remove the unbound aptamer apta1 and obtain a precipitate, which was the aptamer-incubated MnO x The precipitate was resuspended in 500 μL of 10 mM PBS phosphate buffer solution (pH 7.4) containing BSA (0.5% w / v) and 0.05% (v / v) Tween-20 to obtain the aptamer-incubated MnO x Solution, stored at 4 °C;
[0162] The nucleotide sequence of the aptamer apta1 is shown in SEQ ID No. 2;
[0163] The sequence of SEQ ID No. 2 is:
[0164] CTTTCTGTCCTTCCGTCACATCCCACGCATTCTCCACATCGCTCAGCTC.
[0165] The carboxyl-modified aptamer apta1 is
[0166] 5'-HOOC-CTTTCTGTCCTTCCGTCACATCCCACGCATTCTCCACATCGCTCAGCTC-3'.
[0167] Step (2) Preparation of electrochemiluminescence sensor:
[0168] S1. Polish a 4 mm diameter glassy carbon electrode with 1.0 µm, 0.3 µm, and 0.05 µm alumina polishing powders in sequence and rinse with ultrapure water.
[0169] S2, the Ru-Co4P2W prepared in Example 1 18 Ultrasonication was performed until all particles were uniformly dispersed in water to obtain Ru-Co4P2W with a concentration of 6 mg / mL. 18 Suspension, add 10 μL of suspension to the surface of the glassy carbon electrode washed in S1 as the sensing substrate, and place it at 37 °C to dry;
[0170] S3, add 10 μL of 0.4%wt chitosan solution to the surface of the dried glassy carbon electrode in S2 and place it at 37°C to dry;
[0171] S4. Add 100 μL of DNA1 (5'-HOOC-GAGCTGAGCG-3') to a mixture of 1 mg / mL N-hydroxysuccinimide (NHS) and 1 mg / mL 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC). Stir thoroughly and drip 10 μL onto the dried glassy carbon electrode in S3. Allow to air dry at 37°C. Rinse three times with pH 7.4 PBS buffer to remove unbound DNA1 and residual EDC and NHS, and allow to air dry at 37°C.
[0172] S5. Add 3 μL of 1-3% bovine serum albumin solution to the surface of the glassy carbon electrode dried in step S4 to block nonspecific active sites on the electrode surface. Rinse the electrode surface with pH 7.4 phosphate buffer solution (PBS) and place it at 4°C to dry.
[0173] S6, add 5 μL of 1 mg / mL aptamer-incubated MnO2 to the surface of the glassy carbon electrode dried in step S5. x The electrode surface was rinsed with a phosphate buffer solution (PBS) of pH 7.4 and placed at 4°C to dry. The construction was completed to obtain an electrochemiluminescence sensor.
[0174] Detection and Analysis
[0175] 1) Scanning electron microscopy analysis
[0176] The Ru-Co4P2W prepared in Example 1 18 The nanoparticles were analyzed by scanning electron microscopy. Figure 1 shown.
[0177] from Figure 1 The analysis shows that the prepared Ru-Co4P2W 18 It is a granular structure with a layer of oily structure similar to organic compounds on the surface and there are gaps. It can be seen that Ru(bpy)3 2+ Successfully loaded on negatively charged Co4(H2O)2(PW9O 34 )2 10- Polyacid molecular surface, indicating Ru-Co4P2W 18 The synthesis was successful.
[0178] 2) Transmission electron microscopy analysis
[0179] The Ru-Co4P2W prepared in Example 1 18 The nanoparticles were analyzed by transmission electron microscopy. Figure 2 shown.
[0180] from Figure 2 From the analysis, we can see that Ru-Co4P2W 18 The structure is lamellar and shows the anionic polyacid molecules Co4(H2O)2(PW9O 34 )2 10- With Ru(bpy)3 2+ Electrostatic interaction forms a network structure, indicating that Ru-Co4P2W 18 The synthesis was successful.
[0181] 3) EDS energy spectrum analysis
[0182] The Ru-Co4P2W prepared in Example 1 18 The nanoparticles were analyzed by EDS. Figure 3 and Figure 4 shown.
[0183] from Figure 3 and Figure 4 The analysis shows that the Ru-Co4P2W 18 The nanoparticles contain Ru, Co, P, W, O, C and other elements, and the Ru, Co, P, W, O and C elements are evenly distributed, which proves that Ru-Co4P2W 18 successful synthesis.
[0184] 4) Infrared absorption spectroscopy analysis
[0185] The Co4P2W prepared in S4 in Example 1 18 Infrared absorption spectrum analysis was performed, and the results were as followsFigure 5 shown.
[0186] from Figure 5 The analysis shows that at 1300cm -1 to 400cm -1 The absorption peak in the infrared fingerprint region of Co4P2W 18 This is consistent with the results of Co4P2W 18 The synthesis was successful.
[0187] 5) Electrochemiluminescence working curve
[0188] Specific steps:
[0189] Prepare 2 mL of each solution with a concentration of 2.5×10 -5 ng / mL, 5×10 -5 ng / mL, 10 -4 ng / mL, 2×10 -4 ng / mL, 4×10 -4 ng / mL, 8×10 -4 ng / mL, 5×10 -3 ng / mL, 10 -2 ng / mL, 10 -1 ng / mL, 1 ng / mL, 5 ng / mL, 10ng / mL, 20 ng / mL, 40 ng / mL and 100 ng / mL DBP buffer solution (pH 4.0 ~ 3.0);
[0190] The test was performed using an electrochemical analyzer three-electrode system, with a saturated silver / silver chloride electrode as the reference electrode, a platinum electrode as the auxiliary electrode, and the electrochemiluminescence sensor constructed in Example 4 as the working electrode. The electrodes were immersed in DBP buffer solutions of varying concentrations for 10 min, then rinsed once with 1 mL of PBS buffer solution at pH 4.0 to 3.0. The rinse solution was then re-injected into the immersion solution, and then the electrochemiluminescence test was performed.
[0191] Cyclic voltammetry was used to detect dibutyl phthalate (DBP), with the voltage range set to -1.5 V to 0 V and the photomultiplier tube voltage set to 800 V.
[0192] After the electrode device is completed, start the instrument to detect the electrochemiluminescence signal intensity corresponding to different concentrations of DBP, draw a working curve, and draw the working curve with the obtained result data. The results are as follows: Figure 6 shown.
[0193] from Figure 6Analysis shows that the working curve of the constructed electrochemiluminescence sensor exhibits good linearity, with a square correlation coefficient of 0.992. The ordinate of the working curve represents ECL luminescence intensity, while the abscissa represents the logarithm of DBP concentration (ng / mL). The quenching ability of FMP nanoparticles is affected by the lower DBP concentration, resulting in a better FMP quenching effect and lower ECL intensity. This demonstrates the high sensitivity and detection accuracy of the electrochemiluminescence sensor of the present invention.
[0194] 6) Electrochemiluminescence stability test
[0195] Specific operation steps: 1. Use the three-electrode system of electrochemical analyzer for testing, with a saturated silver / silver chloride electrode as the reference electrode, a platinum electrode as the auxiliary electrode, and the electrochemiluminescence sensor constructed in Example 4 as the working electrode. Test in 10 mL of PBS, pH 6.0, 50 mM potassium persulfate solution; 2. Use cyclic voltammetry for detection, setting the voltage range to -1.5~0 V, the photomultiplier tube voltage to 800 V, and lasting for 85 seconds. The results are as follows. Figure 7 shown.
[0196] from Figure 7 The analysis shows that three ECL signals are generated within 85s, and the ECL intensity is close to 18ka.u. three times, and the three signal intensities are similar, which proves that Ru-Co4P2W 18 Stability of electrochemiluminescence.
[0197] 7) Detection of butylene phthalate
[0198] Colorimetric analysis test steps:
[0199] (1) The glassy carbon electrode of the sensor constructed in Example 4 was immersed in 2 mL of PBS buffer solution (pH 4.0) containing butylene phthalate for 10 min, then washed once with 1 mL of pH 4.0 PBS buffer solution and the washing solution was re-injected into the immersion solution; at this time, the glassy carbon electrode can be subjected to electrochemiluminescence testing.
[0200] (2) Add 200 μL of 3% hydrogen peroxide solution to the soaking solution and let it stand for 5 minutes. Then, add 100 μL of TMB solution. Observe that the solution changes from colorless to blue. The higher the DBP concentration of the soaking solution, the darker the blue. The test is complete.
[0201] Electrochemiluminescence test steps:
[0202] (1) The electrochemical analyzer three-electrode system was used for testing, the saturated silver / silver chloride electrode was the reference electrode, the platinum electrode was the auxiliary electrode, and the electrochemiluminescence sensor prepared in Example 4 was the working electrode. The test was carried out in 10 mL of PBS with pH 6.0 and 50 mM of potassium persulfate solution;
[0203] (2) The cyclic voltammetry was used to detect the butyl phthalate (DBP), and the voltage range was set to-1.5 V~0V, and the photomultiplier tube voltage was 800 V;
[0204] (3) After the electrode device was completed, the instrument was started, the electrochemiluminescence signal intensity corresponding to different concentrations of DBP was detected, and the working curve was drawn;
[0205] (4) The DBP sample solution to be tested was used to replace the DBP standard solution for testing.
[0206] Colorimetric analysis test steps:
[0207] (1) The glassy carbon electrode of the electrochemiluminescence sensor constructed in Example 5 was immersed in 2 mL of butyl phthalate-containing PBS buffer solution (pH 3.0) for 10 min, then washed once with 1 mL of PBS buffer solution with pH 3.0 and the washing liquid was re-injected into the soaking liquid. At this time, the glassy carbon electrode can be tested for electrochemiluminescence
[0208] (2) 200 μL of 3% hydrogen peroxide solution was added to the soaking liquid, and it was left for 5 min, then 100 μL of TMB solution was added, and it was observed that the solution changed from colorless to blue. The higher the concentration of DBP contained in the soaking liquid, the deeper the blue color, and the testing was completed.
[0209] Electrochemiluminescence test steps:
[0210] (1) The electrochemical analyzer three-electrode system was used for testing, the saturated silver / silver chloride electrode was the reference electrode, the platinum electrode was the auxiliary electrode, and the electrochemiluminescence sensor prepared in Example 5 was the working electrode. The test was carried out in 10 mL of PBS with pH =8.0 and 150 mM of potassium persulfate solution;
[0211] (2) The cyclic voltammetry was used to detect the butyl phthalate (DBP), and the voltage range was set to-1.5 V~0V, and the photomultiplier tube voltage was 800 V;
[0212] (3) After the electrode device was completed, the instrument was started, the electrochemiluminescence signal intensity corresponding to different concentrations of DBP was detected, and the working curve was drawn;
[0213] (4) The DBP sample solution to be tested was used to replace the DBP standard solution for testing.
[0214] In summary, the electrochemiluminescence sensor of the present application utilizes hydrothermal synthesis of Fe-MoO v , and the Fe-MoO v is wrapped by dopamine self-aggregation to form polydopamine microparticles, and carboxylated aptamer (apta1) is immobilized on the abundant amino sites of dopamine for signal regulation and quenching. Specifically, with the addition of the analyte (DBP), the FMP-apta1 can be broken by specific biological recognition, and part of the FMP-apta1 is free in the buffer solution, and catalyzes the reduction of H2O2 to release hydroxyl radicals (OH•), which promotes the oxidation of 3,3',5,5'-tetramethylbenzidine (TMB) to perform colorimetric detection. At the same time, the unbroken Ru-Co4P2W 18 -DNA1-apta1-FMP sensing system is combined on the sensing interface to produce a significant ECL quenching signal. By matching the visual and ECL signal intensity, acceptable prediction and accuracy analysis is achieved, and all steps can be pre-processed, and the sensing system is constructed in advance to facilitate rapid on-site detection, avoiding the shortcomings of layer-by-layer drop coating to construct the sensing system during on-site detection. The portable, instant, sensitive and visual detection of butyl phthalate in water samples is achieved, which has great popularization and application value in the field of electrochemiluminescence material technology. 18
[0215] The above examples are only preferred embodiments for fully illustrating the present application, and the protection scope of the present application is not limited thereto. Any equivalent replacement or transformation of the present application made by those skilled in the art based on the present application is within the protection scope of the present application.
Claims
1. A composite material of ruthenium terpyridine and polyoxometalate, characterized in that: The invention comprises a polyoxometalate, wherein the polyoxometalate is loaded with terpyridine ruthenium; The polyoxometalate is selected from K 10 Co4(H2O)2(PW9O 34 )2.
2. The composite material of ruthenium terpyridine and polyoxometalate according to claim 1, characterized in that: The polyoxometalate loads the terpyridine ruthenium through electrostatic interaction.
3. A method for preparing a composite material according to claim 1 or claim 2, characterized in that: The following steps are involved: Tungstate, cobalt salt, phosphate and hydrochloric acid are added to water, heated to reflux, cooled, and filtered to obtain a filtrate; Add chloride salt to the filtrate and filter to obtain a precipitate; dissolving the precipitate and recrystallizing it to obtain polyoxometalate; dispersing dichlorotris(2,2′-bipyridine)ruthenium hexahydrate in water to obtain a dichlorotris(2,2′-bipyridine)ruthenium solution, and dispersing a polyoxometalate in water to obtain a polyoxometalate solution; Under heating conditions, a polyoxometalate solution is added dropwise to a dichlorotris(2,2'-bipyridine)ruthenium solution to obtain a composite material.
4. The preparation method according to claim 3, characterized in that The heating reflux temperature is 110°C to 130°C, and the time is 10 h to 14 h; And / or, the recrystallization temperature is 3°C to 8°C; And / or, the heating temperature for dropwise adding the polyoxometalate solution is 60° C. to 70° C.
5. The preparation method according to claim 3, characterized in that The mass ratio of the tungstate, cobalt salt, phosphate and chloride salt is 10-20:1.8-3.9:0.48-0.96:10-20; And / or, the mass ratio of dichlorotris(2,2′-bipyridyl)ruthenium hexahydrate to polyoxometalate is 18.7-37.4:274.1-548.
2.
6. The preparation method according to claim 3, characterized in that The tungstate is selected from Na2WO4·2H2O and / or Na2WO4; and / or, the cobalt salt is selected from Co(NO3)2 and / or Co(NO3)2·6H2O; and / or, the phosphate is selected from Na2HPO4; And / or, the chloride salt is selected from KCl.
7. Use of the composite material according to claim 1 or claim 2, characterized in that: The composite material is used as an electrochemiluminescent material.
Citation Information
Patent Citations
Formaldehyde mesoporous catalyst and preparation method thereof
CN105688907A
DNA (deoxyribonucleic acid) aptamer of phthalate type plasticizer and screening and expression method and electro-chemical sensor thereof
CN106399317A