Preparation method of retinal pigment epithelial cells

Through a multi-step method, using specific differentiation medium and mature medium, pluripotent stem cells are induced to differentiate and culture, which solves the problem of long preparation cycle and low purity of retinal pigment epithelial cells in the prior art, and achieves efficient and economical preparation of high-purity RPE cells.

CN120060139APending Publication Date: 2025-05-30ZHEJIANG QUANSHENG BIOENGINEERING CO LTD +1

Patent Information

Application Number
CN202311601379.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2023-11-28
Publication Date
2025-05-30

AI Technical Summary

Technical Problem

The existing methods of pluripotent stem cells inducing differentiation into retinal pigment epithelial cells have problems such as long production cycle, low RPE purity, expensive cost, and complex preparation.

Method used

The preparation of retinal pigment epithelial cells is carried out using a method that includes multiple steps, including inducing differentiation culture of pluripotent stem cells using a specific differentiation medium, dissociating single cells through cell digestion enzymes, and culturing them in different mature culture mediums, and finally obtaining high-purity RPE cells within 40-45 days.

Benefits of technology

Retinal pigment epithelial cell preparation with short induction cycle, cell purity is higher than 95%, low cost and simple preparation process is achieved, which improves the preparation efficiency and economicality.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120060139A_ABST
    Figure CN120060139A_ABST
Patent Text Reader

Abstract

The invention provides a preparation method of retinal pigment epithelial cells. The preparation method comprises the following steps: S1, carrying out induced differentiation culture on pluripotent stem cells for 5-7 days by adopting a first RPE differential medium; sB431542, LDN193189, CKI-7 and NIC are added into the first RPE differential culture medium, and SB431542 and LDN193189 are added into the first RPE differential culture medium; s2, adopting a second RPE differential culture medium to continuously perform induced differentiation culture for 5-7 days; cHIR99021 and IDE-2 are added into the second RPE differential medium, and the CHIR99021 and the IDE-2 are added into the second RPE differential medium; s3, dissociating into single cells by using a cell digestive enzyme, and then culturing the single cells in a cell culture container for 1-3 days by using a first RPE mature culture medium; the first RPE maturation culture medium comprises Y-27632 (Y-27632); and S4, continuously culturing the cells obtained in the step S3 for 25-30 days by using a second RPE mature culture medium to obtain the retinal pigment epithelial cells. The preparation method of the retinal pigment epithelial cells, provided by the invention, is simple to operate, high in efficiency, low in cost and short in induction period, and the cell purity is higher than 95%.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of cell biology, and specifically, to a method for preparing retinal pigment epithelial cells. Background Art

[0002] Retinal pigment epithelial cells (RPE) are a dense monolayer of cells located between photoreceptors and the choroid. They are in a "cobblestone" shape, rich in pigment granules, and are essential for supporting the nutritional, structural, and metabolic needs of photoreceptor cells. RPE plays an important role in maintaining retinal function, including providing nutrition by contacting photoreceptor cells, phagocytosis of metabolic waste, and participating in the formation of the blood-retinal barrier to prevent non-specific diffusion of substances from the choroid. Damage and loss of RPE cells can cause secondary depletion of retinal photoreceptor cells, leading to retinal degenerative diseases. Since it has been clinically observed that the regenerative ability of RPE is poor, and it is difficult to repair and regenerate degenerated or dead RPE, a large number of reports have been made on treatment methods based on cell therapy that can replace damaged RPE to restore visual function, showing promising prospects.

[0003] The emergence of human pluripotent stem cells (hPSC) provides a new cell source for cell therapy. Current clinical data show that retinal pigment epithelial cells derived from human pluripotent stem cells are safe and effective. Existing methods for inducing the differentiation of pluripotent stem cells into RPE mainly include suspension culture and adherent culture. However, existing hPSC-RPE preparation technologies have problems such as a long production cycle, low RPE purity, high cost, and complex preparation.

[0004] Among them, the suspension culture method requires pluripotent stem cells to form cell aggregates, and a large number of heterologous cells will be generated during cell differentiation, and RPE cells need to be manually picked. This method has a complex operation process, low differentiation efficiency, and an induction differentiation time of more than 63 days. Among them, the method for inducing the differentiation of pluripotent stem cells into RPE disclosed in the Chinese invention patent with the publication number CN113699097B adopts the suspension culture method.

[0005] Among them, the adherent culture method has advantages such as simple operation and controllable process compared with suspension culture. However, it often has disadvantages such as high preparation cost due to the use of cytokines during the preparation process, long cycle, low efficiency, and the need to manually pick RPE cells. Among them, the methods for inducing the differentiation of pluripotent stem cells disclosed in the US patent application with the publication number US20220333065A1, the Chinese invention patent with the publication number CN113549596B, and the US patent with the publication number US20220098551A1 all adopt the adherent culture method. Summary of the Invention

[0006] In view of the deficiencies in the prior art, the object of the present invention is to provide a method for preparing retinal pigment epithelial cells, which is simple to operate, has high efficiency, low cost, a short induction period (mature RPE cells can be obtained in only 40 - 45 days), and a cell purity higher than 95%.

[0007] The present invention provides a method for preparing retinal pigment epithelial cells, comprising the following steps:

[0008] S1. Induce and differentiate pluripotent stem cells with a first RPE differentiation medium for 5 - 7 days, and change the medium every 1 - 3 days; SB431542, LDN193189, CKI-7, and Nicotinamide (NIC) are added to the first RPE differentiation medium.

[0009] S2. Continuously induce and differentiate the cells obtained from the induction and differentiation culture in step S1 with a second RPE differentiation medium for 5 - 7 days, and change the medium every 1 - 3 days; CHIR99021 and IDE-2 are added to the second RPE differentiation medium.

[0010] S3. Dissociate the cells obtained from the induction and differentiation in step S2 into single cells with a cell digestive enzyme, and then culture the single cells in a cell culture container with a first RPE maturation medium for 1 - 3 days; the first RPE maturation medium includes Y-27632.

[0011] S4. Continuously culture the cells obtained from the culture in step S3 with a second RPE maturation medium for 25 - 30 days, and change the medium every 1 - 3 days to obtain retinal pigment epithelial cells.

[0012] In an embodiment of the present invention, the pluripotent stem cells in step S1 are obtained through the following steps: Passage culture of pluripotent stem cells with a pluripotent stem cell medium, and remove the pluripotent stem cell medium when the cell colony growth confluence reaches 50% - 70% to obtain pluripotent stem cells; the pluripotent stem cell medium is mTeSR1 or TeSR-E8.

[0013] In an embodiment of the present invention, the pluripotent stem cells are cultured in a culture container coated with a cell culture matrix, and the cell culture matrix is one of Matrigel, Collagen, Laminin, and Vitronectin.

[0014] In one embodiment of the present invention, both the first RPE differentiation medium and the second RPE differentiation medium are prepared through the following steps: Add 10% KnockOut SR, 1% NEAA, 1% GlutaMAX-I, and 55 μM 2-Mercaptoethanol to the DMEM / F12 medium.

[0015] In one embodiment of the present invention, in the first RPE differentiation medium: the addition concentration of SB431542 is 5 - 15 μM, the addition concentration of LDN193189 is 50 - 150 nM, the addition concentration of CKI-7 is 1 - 10 μM, and the addition concentration of NIC is 5 - 15 mM.

[0016] In one embodiment of the present invention, in the first RPE differentiation medium: the addition concentration of SB431542 is 8 - 12 μM, the addition concentration of LDN193189 is 80 - 120 nM, the addition concentration of CKI-7 is 3 - 7 μM, and the addition concentration of NIC is 8 - 13 mM.

[0017] In one embodiment of the present invention, in the first RPE differentiation medium: the addition concentration of SB431542 is 10 μM, the addition concentration of LDN193189 is 100 nM, the addition concentration of CKI-7 is 5 μM, and the addition concentration of NIC is 10 mM.

[0018] In one embodiment of the present invention, in the second RPE differentiation medium: the addition concentration of CHIR99021 is 1 - 5 μM, and the addition concentration of IDE-2 is 200 - 300 nM.

[0019] In one embodiment of the present invention, in the second RPE differentiation medium: the addition concentration of CHIR99021 is 2 - 4 μM, and the addition concentration of IDE-2 is 230 - 270 nM.

[0020] In one embodiment of the present invention, in the second RPE differentiation medium: the addition concentration of CHIR99021 is 3 μM, and the addition concentration of IDE-2 is 250 nM.

[0021] In one embodiment of the present invention, the first RPE maturation medium is prepared through the following steps: Add 5% KnockOut SR, 1% Sodium pyruvate, and 1% GlutaMAX-I to the DMEM medium.

[0022] In one embodiment of the present invention, the cell digestive enzyme in step S3 is one of TrypLE, Accutase, or trypsin.

[0023] In one embodiment of the present invention, in step S3, the cells obtained by induced differentiation in step S2 are digested with a cell digestive enzyme for 5 - 10 minutes.

[0024] In one embodiment of the present invention, the addition concentration of Y - 27632 in the first RPE maturation medium is 5 - 15 μM.

[0025] In one embodiment of the present invention, the addition concentration of Y - 27632 in the first RPE maturation medium is 8 - 12 μM.

[0026] In one embodiment of the present invention, the addition concentration of Y - 27632 in the first RPE maturation medium is 10 μM.

[0027] In one embodiment of the present invention, in step S3, single cells are cultured in a cell culture container coated with a cell culture matrix, and the cell culture matrix is one of Matrigel, Collagen, Laminin, and Vitronectin.

[0028] In one embodiment of the present invention, in step S4, the second RPE maturation medium is prepared by the following steps: adding 1% KnockOut SR, 1% Sodium pyruvate, and 1% GlutaMAX - I to DMEM medium.

[0029] In one embodiment of the present invention, the pluripotent stem cells are human induced pluripotent stem cells (hiPSC) or human embryonic stem cells (hESC).

[0030] Compared with the prior art, the embodiments of the present invention have the following beneficial effects:

[0031] 1. The method for preparing retinal pigment epithelial cells provided by the present invention has a short induction period. It only takes 40 - 45 days to obtain mature RPE cells, and the cell purity is higher than 95%.

[0032] 2. All the induction factors used in the method for preparing retinal pigment epithelial cells provided by the present invention are small - molecule substances (SB431542, LDN193189, CKI - 7, Nicotinamide, CHIR99021, and IDE - 2), and the cost is relatively low compared to cytokines.

[0033] 3. The cell culture of the present invention adopts an adherent method. Except for routine medium replacement, the induced differentiation process only requires one digestion and sub - culture operation on the cells, and the preparation process is simple.

[0034] Of course, it is not necessary for any product implementing the present invention to achieve all the above - mentioned advantages simultaneously. Brief Description of the Drawings

[0035] Other features, objects, and advantages of the present invention will become more apparent from the following detailed description of non - limiting embodiments read in conjunction with the accompanying drawings:

[0036] Figure 1 Morphology diagram of hiPSC cells grown on Matrigel;

[0037] Figure 2 Morphology diagrams of cells at various time periods during the induction of hiPSC differentiation on Matrigel;

[0038] Figure 3 Results diagram of RT - qPCR detection of the expression of OCT4 and NANOG (pluripotency genes) at various time periods during the induction of hiPSC differentiation on Matrigel;

[0039] Figure 4 Results diagram of RT - qPCR detection of the expression of PAX6 and LHX2 (RPE progenitor cell genes) at various time periods during the induction of hiPSC differentiation on Matrigel;

[0040] Figure 5 Results diagram of RT - qPCR detection of the expression of MITF and PMEL17 (early RPE cell genes) at various time periods during the induction of hiPSC differentiation on Matrigel;

[0041] Figure 6 Results diagram of RT - qPCR detection of the expression of BEST1 and RPE65 (mature RPE genes) at various time periods during the induction of hiPSC differentiation on Matrigel;

[0042] Figure 7 Results diagram of RT - qPCR detection of the expression of CRLBP (mid - stage RPE gene) at various time periods during the induction of hiPSC differentiation on Matrigel;

[0043] Figure 8 Results diagram of flow cytometry detection of the expression of OCT4 at various time periods during the induction of hiPSC differentiation on Matrigel;

[0044] Figure 9 Results diagram of flow cytometry detection of the expression of MITF at various time periods during the induction of hiPSC differentiation on Matrigel;

[0045] Figure 10 Results diagram of flow cytometry detection of the expression of CD140b at various time periods during the induction of hiPSC differentiation on Matrigel;

[0046] Figure 11Results of flow cytometry detection of PMEL17 expression at various time points during the induction of hiPSC differentiation on Matrigel;

[0047] Figure 12 Results of flow cytometry detection of BEST1 expression at various time points during the induction of hiPSC differentiation on Matrigel;

[0048] Figure 13 Results of flow cytometry detection of CRLBP expression at various time points during the induction of hiPSC differentiation on Matrigel;

[0049] Figure 14 Results of immunofluorescence detection of the expression of RPE-specific marker proteins ZO-1, MITF, RPE65, BEST1, CD140b, and PMEL17 in hiPSC-derived cells differentiated on Matrigel for 45 days;

[0050] Figure 15 Results of polar secretion ELISA detection of cytokines PEDF and VEGF-A in hiPSC-derived cells differentiated on Matrigel for 45 days;

[0051] Figure 16 Results of phagocytosis function detection in hiPSC-derived cells differentiated on Matrigel for 45 days;

[0052] Figure 17 Morphology of hiPSC cells grown on Laminin521;

[0053] Figure 18 Morphology of hiPSC-derived cells at various time points during the induction of differentiation on Laminin521;

[0054] Figure 19 Results of RT-qPCR detection of the expression of OCT4, MITF, PMEL17, BEST1, RPE65, and CRLBP in hiPSC-derived cells differentiated on Laminin521 at d0 and d45;

[0055] Figure 20 Results of flow cytometry detection of the expression of OCT4, MITF, and PMEL17 in hiPSC-derived cells differentiated on Laminin521 for 45 days;

[0056] Figure 21 Results of flow cytometry detection of the expression of CD140b and BEST1 in hiPSC-derived cells differentiated on Laminin521 for 45 days;

[0057] Figure 22ELISA detection result graph of the polar secretion of cytokines PEDF and VEGF-A for inducing the differentiation of hiPSCs on Laminin521 at d45;

[0058] Figure 23 Graph of the detection result of the phagocytic function of cells for inducing the differentiation of hiPSCs on Laminin521 at d45. Detailed implementation manners

[0059] The present invention will be described in detail below in conjunction with specific embodiments. The following embodiments will help those skilled in the art to further understand the present invention, but do not limit the present invention in any form. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several changes and improvements can still be made. These all belong to the protection scope of the present invention.

[0060] In addition, the technical features involved in different embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0061] Example 1: Resuscitation and subculture of hiPSCs in Matrigel-coated culture dishes

[0062] 1. Resuscitation culture of hiPSCs

[0063] (1) After taking out the cryopreserved hiPSCs from liquid nitrogen, quickly place them in a 37.5 °C water bath and quickly shake until melted (about 1 min) to obtain a cell suspension;

[0064] (2) Transfer the cell suspension to a 15 ml centrifuge tube, slowly add 10 ml of mTeSR1 complete medium (containing 10 μM Y-27632), and mix well;

[0065] (3) Centrifuge at 1130 r / min for 5 min, discard the supernatant, add 1 ml of mTeSR1 complete medium (containing 10 μM Y-27632) and gently resuspend the cells, and count;

[0066] (4) Take out the 35 mm culture dish pre-coated with Matrigel from the 4 °C refrigerator 1 day in advance, incubate at room temperature for 1 h for standby, and inoculate the cells at a density of 0.5×10 6 cells / 35 mm culture dish, and supplement the medium to 2 ml per dish;

[0067] (5) Culture in a 37 °C, 5% CO 2 incubator, change the medium every day until subculture is possible.

[0068] 2. Subculture of hiPSCs

[0069] The Matrigel-coated culture dishes were pre-incubated at room temperature for 1 h for later use.

[0070] (1) Discard the old medium in the laminar flow hood. Add 1 ml of PBS to each dish and wash once.

[0071] (2) Add 1 ml of Accutase to each dish and digest at 37 °C for 2 - 5 min. Wait until the cells become round and detach from the dish around them. Discard Accutase, add 1 ml of mTeSR1 complete medium (containing 10 μM Y-27632) to stop digestion, gently pipette the cells to resuspend them, and count.

[0072] (3) Seed cells at a density of 0.5×10 6 cells / 35 mm culture dish, and supplement the medium to 2 ml per dish.

[0073] (4) Culture in an incubator at 37 °C and 5% CO 2 2. Change the medium every day until subculture is possible, and then subculture 2 more times into T75 flasks for RPE induction and differentiation culture.

[0074] hiPSCs in subculture were photographed under a microscope. As Figure 1 shown, the hiPSCs in subculture showed typical cell morphology, with a large nuclear-cytoplasmic ratio, dense growth, colony growth, and smooth colony edges.

[0075] Example 2: Inducing the differentiation of hiPSCs into RPE in Matrigel-coated culture dishes

[0076] (1) d0: When the confluence of hiPSC cells in the T75 culture flask reaches about 60%, start the first-stage induction. Replace the medium with the first RPE differentiation medium, and add small molecule compounds SB431542 (10 μM), LDN193189 (100 nM), CKI-7 (5 μM), and NIC (10 mM) to the first RPE differentiation medium. Culture for 6 days, change the medium every 1 - 3 days, and the medium volume per flask is 15 mL.

[0077] (2) d6: Replace the medium with the second RPE differentiation medium supplemented with CHIR99021 (3 μM) and IDE-2 (250 nM) until the appearance of early hiPSC-RPE morphology is observed on the 9th day. Change the medium every 1 - 3 days, and the medium volume per flask is 15 mL. Among them, the preparation methods of the first RPE differentiation medium and the second RPE differentiation medium are the same, as follows: Add 10% KnockOutSR, 1% NEAA, 1% GlutaMAX-I, and 55 μM 2-Mercaptoethanol to DMEM / F12 medium.

[0078] (3), d12: Digest the cells with 8 mL of Accutase for about 4 minutes. Discard the Accutase, add the first RPE maturation medium (containing 10 μM Y-27632) to resuspend the cells, passage the cells at a ratio of 1:3, inoculate them in a Matrigel-coated T75 culture flask, and culture for 3 days with 15 mL of medium per flask; among them, the preparation method of the first RPE maturation medium is to add 5% KnockOut SR, 1% Sodium pyruvate, and 1% GlutaMAX-I to the DMEM medium; 10 μM Y-27632 is added to the first RPE maturation medium;

[0079] (4), d15: Thereafter, start the RPE maintenance culture, change to the second RPE maturation medium, and change the medium once every 2 - 3 days with 15 mL of medium per flask; the preparation method of the second RPE maturation medium is to add 1% KnockOut SR, 1% Sodium pyruvate, and 1% GlutaMAX-I to the DMEM medium;

[0080] (5), Culture until day 45 for detection.

[0081] Microscopically photograph the cell morphology. Results: Induction starts from d0, the cells completely cover the bottom of the culture dish on d7, a small amount of pigmentation appears in the cells on d29, and the cells on d45 present the typical RPE cell morphology, which are cobblestone-like hexagonal cells with a large amount of cell deposition (microscopically photograph the cells on day 45, Figure 2 as described).

[0082] Respectively select the cells on days 0, 2, 7, 14, 22, 29, and 45 of differentiation to extract RNA, and detect the expression of OCT4, NANOG (pluripotency genes), PAX6 and LHX2 (RPE progenitor cell genes), MITF, PMEL17 (early RPE cell genes), CRLBP (mid-stage RPE gene), BEST1 and RPE65 (mature RPE genes) by RT-qPCR. The specific steps are as follows:

[0083] A. Respectively extract the total RNA of hiPSC-RPE on days 0, 2, 7, 14, 29, and 45 of differentiation:

[0084] a) Discard the medium in the 35 mm culture dish, add 1 mL of PBS to wash the cells 2 times, add 500 μL of Trizol reagent, pipette repeatedly with a pipette gun, and then transfer it to a 1.5 mL centrifuge tube and let it stand at room temperature for 5 minutes;

[0085] b) Add chloroform at a ratio of 1 / 5, shake vigorously for 15 s, and let it stand for 5 minutes;

[0086] c) Centrifuge at 4°C and 12,000 rpm for 15 min using a low-temperature centrifuge;

[0087] d) Pipette the upper aqueous phase into a new 1.5 mL centrifuge tube, record the volume, add the same volume of isopropanol, mix well, and let stand at room temperature for over 30 min;

[0088] e) Centrifuge at 4°C and 12,000 rpm for 10 min, discard the supernatant, add 1 mL of pre-cooled 75% ethanol, and shake several times to wash the precipitate;

[0089] f) Centrifuge at 4°C and 7,500 rpm for 10 min, aspirate the supernatant completely, keep the tube mouth downwards, and try to aspirate off the remaining ethanol;

[0090] g) After drying, dissolve the precipitate with an appropriate amount of DEPC water, measure and record the RNA concentration.

[0091] B. Reverse Transcription

[0092] Thaw the reagents used in advance on ice. Use RNase-free pipette tips and centrifuge tubes throughout the process. Calculate the reaction system. Conduct the entire operation on ice.

[0093] (a) Prepare the reverse transcription system according to the PrimeScriptR reagent kit instructions:

[0094] Reagent Dosage Use concentration 5×PrimeScript buffer 20μL 1× PrimeScript RT Enzyme mix I 5μL OligodT primer(50μM) 5μL 25pmol Random 6mers(100μM) 5μL 50pmol Total RNA 5μL <![CDATA[RNase Free dH 2 O]]> up to 100μL

[0095] (b) Reverse transcription conditions:

[0096] Temperature Time 37℃ 15min 85℃ 5s 4℃ Forever

[0097] C. Thaw the qPCR amplification reaction reagents in advance on ice. The reagents are as follows:

[0098] Reagent Use volume Use concentration SYBR Premix Ex TaqⅡ(Tli RNaseH Plus)(2×) 10μL 1× PCR SensePrimer(10μM) 0.8μL 0.4μM PCR SensePrimer(10μM) 0.8μL 0.4μM ROX reference DyeⅡ(50×) 0.4μL 1× cNA solution 2μL dH2O 6μL Total up to 20μL

[0099] Reaction conditions:

[0100]

[0101] Primer information

[0102] Gene Forward primer(5’-3’) Reverse primer(5’-3’) Nanog ACCTTCCGGTATGGAACAA CCAAGTCACTGGCAGGAGA Oct-4 AAGGGCAAGCGATCAAGCA GGGAATGGGACCGAGGAGTA SOX2 AATAGCATGGCGAGCGGGGTC TCTGCGAGCTGGTCATGGAG LHX2 TCGGGACTTGGTTTATCACCT GCAAGCGGCAGTAGACCAG PAX6 AGTGAATCAGCTCGGTGGTGTCTT TGCAGAATTCGGGAAATGTCGCAC MITF TCACAACCTGATTGAACGAAGAA ACTTTCGGATATAGTCCACGGAT BEST1 CTTGATGGAGCACCCAGAAGT GCTTCATCCCTGTTTTCCAAGG RPE65 CAAGGCTGACACAGGCAAGA TTGACGAGGCCCTGAAAAGA CRLBP CACGCTGCCCAAGTATGATG CCAGGACAGTTGAGGAGAGG PMEL17 GTTGATGGCTGTGGTCCTTG CAGTGACTGCTGCTATGTGG

[0103] The RT-qPCR detection results are as Figure 3-7 shown. The results show that the expression levels of pluripotency genes decreased significantly with induced differentiation, while the expression levels of RPE cell genes increased significantly with induced differentiation ( Figure 3-7 ).

[0104] Flow cytometry was used to detect the expression of related proteins in hiPSC-RPE on the 14th, 30th, and 45th days of differentiation. The detection steps are as follows:

[0105] (a) Collect hiPSC-RPE cells on the 14th, 30th, and 45th days of differentiation. Discard the culture medium in the six-well plate, and add 500 μL of PBS to each well for washing once;

[0106] (b) Add TryPLE Express to each well for digestion for 10 min, and add culture medium to terminate digestion.

[0107] (c) Centrifuge at 1000 rpm for 3 min, discard the supernatant, add 1 mL of paraformaldehyde, and fix at room temperature for 10 min;

[0108] (d) Centrifuge at 1000 rpm for 3 min, discard, add 1 mL of PBS for washing once, centrifuge at 1000 rpm for 3 min, and discard;

[0109] (e) Add 1 mL of 0.25% Triton and incubate at room temperature for 10 min, centrifuge at 1000 rpm for 3 min, discard, add 1 mL of PBS for washing once, centrifuge at 1000 rpm for 3 min, and discard;

[0110] (f) Dilute the primary antibody with PBS containing 10% goat serum according to the recommended dilution ratio of the antibody, incubate overnight at 4 °C, and add nothing to the blank group;

[0111] (g) Wash 3 times with PBS, dilute the secondary antibody with PBS according to the recommended dilution ratio of the antibody, incubate at room temperature in the dark for 30 min, and add the secondary antibody to the control group for incubation;

[0112] (h) Wash 3 times with PBS, filter through a filter gauze, and detect with a flow cytometer within 1 h.

[0113] The results of flow cytometry showed that the cells expressing OCT4 decreased rapidly with cell differentiation, and the positive rate on d45 was less than 0.19%; the cells expressing the RPE-specific marker increased rapidly ( Figure 8 - Figure 13 ).

[0114] Cell immunofluorescence was used to detect the expression of ZO-1, MITF, RPE65, BEST1, CD140b, and PMEL17 in hiPSC differentiated on d45 (the 45th day). The specific steps are as follows:

[0115] (a) Re-seed the hiPSC-RPE on the 14th day of differentiation in a 35-mm laser confocal culture dish coated with Matrigel for maturation culture, and use it for immunofluorescence experiments on the 45th day;

[0116] (b) Discard the culture medium in the 35 mm laser confocal culture dish, add 500 μL of PBS and wash 3 times, after cleaning, add 500 μL of 4% paraformaldehyde and fix at room temperature for 20 min;

[0117] (c) Add 500 μL of PBS and wash 3 times, 5 min each time, add 50 μL of 0.25% Triton and let stand at room temperature for 10 min;

[0118] (d) Wash 3 times with 500 μL of PBS, 5 min each time, incubate with PBS containing 10% goat serum at room temperature for 30 min;

[0119] (e) Add 500 μL of PBS and wash 3 times, 5 min each time, dilute the primary antibody with PBS containing 10% goat serum, add 150 μL to each 35 mm laser confocal culture dish, and incubate overnight at 4 °C;

[0120] (f) Add 500 μL of PBS and wash 3 times, 5 min each time, incubate the secondary antibody in the dark at room temperature for 1 h;

[0121] (g) Add 500 μL and wash 3 times, 5 min each time, add 50 μL of DAPI staining solution and incubate for 5 min;

[0122] (h) Add 500 μL of PBS and wash 3 times, add anti-fluorescence quenching agent dropwise to cover the cells;

[0123] (i) Take pictures with a laser confocal microscope.

[0124] The results of immunofluorescence detection showed that the expressions of ZO-1, MITF, RPE65, BEST1, CD140b, and PMEL17 in hiPSC differentiated on d45 (day 45) were all positive in the immunofluorescence detection ( Figure 14 ).

[0125] Culture the cells differentiated from hiPSC on d45 on Transwell, and detect the polarized distribution of cytokines PEDF and VEGF-A in the apical culture medium and the bottom culture by ELISA. The specific steps are as follows:

[0126] (a) Inoculate hiPSC-RPE differentiated on day 14 in a Matrigel-coated 12-well Transwell chamber for culture, collect the cell culture media in the upper and lower chambers on days 17, 29, and 45 respectively, and collect the supernatant after centrifugation at 3000 rpm for 10 min for detection;

[0127] (b) Prepare a standard curve according to the instructions of the PEDF and VEGF-A kits;

[0128] (c) Take out the 96-well plate equilibrated at room temperature and set up a blank control group, a standard group, and a test sample group.

[0129] (d) Add 50 μL of the standard, and select the dilution multiple according to the sample to make the total volume reach 50 μL; add 100 μL of horseradish peroxidase-labeled detection antibody to the remaining wells except the blank well, seal the plate with a sealing film and incubate at 37°C for 1 h;

[0130] (e) Washing: Remove the sealing film and shake off the liquid, fill the wells with the prepared washing solution, let it stand for 1 min, then spin dry, then pat dry on absorbent paper, and repeat this washing process 5 times;

[0131] (f) Add 50 μL of color developing reagent A and B respectively and develop at 37°C for 15 min;

[0132] (g) Add 50 μL of stop solution, and the liquid can be observed to change from blue to yellow;

[0133] (h) Use an ELISA reader to measure the OD value of each well at 450 nm within 15 min; make a standard curve and calculate the sample concentration.

[0134] ELISA was used to detect the polar distribution of cytokines PEDF and VEGF-A in the apical culture medium and the basal culture medium. The test results are shown in Figure 15 As shown, the results showed that the PEDF content at the top was higher than that at the bottom, and the VEGF-A content at the top was lower than that at the bottom.

[0135] Cell immunofluorescence was used to detect cells at d45 (day 45) of hiPSC differentiation. The specific steps are as follows:

[0136] (a) hiPSC-RPE on day 14 of differentiation were re-seeded in a Matrigel-coated 35 mm laser confocal culture dish for maturation culture and used for phagocytosis experiment on day 45;

[0137] (b) The culture medium in the 35 mm laser confocal culture dish was discarded, and 1.5 mL of culture medium containing red fluorescent microspheres (1:500) was added, and the cells were incubated at 37°C for 24 h. The control group was incubated at 4°C for 24 h.

[0138] (c) Discard the culture medium and wash with PBS three times;

[0139] (d) Add 500 μL of 4% paraformaldehyde to fix the cells for 20 min, and wash the cells with PBS for 5 min, three times in total;

[0140] (e) Add 0.25% TritonX100 to permeabilize for 10 min, and wash the cells with PBS for 5 min, three times in total;

[0141] (f) Block with PBS containing 10% goat serum for 1 h. Discard it, add ZO-1 antibody, and incubate overnight at 4°C;

[0142] (g) Discard the primary antibody, wash the cells with PBS for 5 min, 3 times in total. Add the secondary antibody 488, and incubate for 1 h at room temperature in the dark.

[0143] (h) Discard the secondary antibody, wash the cells with PBS for 5 min, 3 times in total. Add DAPI and stain for 5 min. Discard it and wash with PBS 3 times.

[0144] (i) Observe by confocal laser microscopy.

[0145] The results showed that the cells differentiated from hiPSC on d45 (day 45) had strong phagocytic function at 37°C ( Figure 16 ).

[0146] Example 3: Recovery and passage culture of hiPSC in a culture dish coated with Laminin521

[0147] 1. Recovery culture of hiPSC

[0148] (1) The cryopreserved hiPSC was quickly taken out from liquid nitrogen and placed in a 37.5°C water bath, and quickly shaken until melted (about 1 min);

[0149] (2) Transfer the cell suspension to a 15 ml centrifuge tube, slowly add 10 ml of TeSR-E8 complete medium (containing 10 μM Y-27632), and mix well;

[0150] (3) Centrifuge at 1130 rpm for 5 min, discard the supernatant, add 1 ml of TeSR-E8 complete medium (containing 10 μM Y-27632) and gently resuspend the cells, and count;

[0151] (4) Take out the 35 mm culture dish coated with Laminin521 from the 4°C refrigerator one day in advance, incubate at room temperature for 1 h for standby, and inoculate the cells at a density of 0.5×10 6 cells / 35 mm culture dish, and supplement the medium to 2 ml per dish;

[0152] (5) Culture in an incubator at 37°C and 5% CO 2 2, and change the medium every day until passage.

[0153] 2. Passage culture of hiPSC

[0154] The culture dish coated with Laminin521 was incubated at room temperature for 1 h in advance for standby.

[0155] (1) Discard the old medium in the laminar flow hood, add 1 ml of PBS to each dish and wash once;

[0156] (2) Add 1 ml of TrypLE to each dish and digest at 37°C for 2 - 5 min. Wait until the cells become round and detach from the culture dish around them. Discard the TrypLE, add 1 ml of TeSR-E8 complete medium (containing 10 μM Y-27632) to stop digestion, gently blow up the cells, and count them.

[0157] (3) Inoculate cells at a density of 0.5×10 6 cells per 35-mm culture dish, and supplement the medium in each dish to 2 ml.

[0158] (4) Culture in an incubator at 37°C with 5% CO 2 Replace the medium every day until subculture is possible, and then subculture 2 more generations into T75 flasks for RPE induction and differentiation culture.

[0159] Take pictures of the subcultured hiPSCs under a microscope. The results show that the subcultured hiPSCs exhibit typical cell morphology, with a large nucleus-cytoplasm ratio, dense growth, clonal growth, and smooth clone edges ( Figure 17 ).

[0160] Example 4: Induce hiPSCs to differentiate into RPE in a culture dish coated with Laminin521

[0161] (1) d0: When the confluence of hiPSC cells in the T75 culture flask reaches about 60%, start the first-stage induction. Replace the medium with RPE differentiation medium and add small molecule compounds SB431542 (10 μM), LDN193189 (100 nM), CKI-7 (5 μM), and NIC (10 mM). Culture for 6 days, change the medium every 1 - 3 days, and 15 mL of medium per flask.

[0162] (2) d6: Replace with RPE differentiation medium supplemented with CHIR99021 (3 μM) and IDE-2 (250 nM) until the appearance of early hiPSC-RPE morphology is observed on the 9th day. Change the medium every 1 - 3 days, and 15 mL of medium per flask.

[0163] (3) d12: Digest the cells with 8 mL of TrypLE for about 4 min, discard the TrypLE, resuspend the cells with RPE maturation medium 1 (containing 10 μM Y-27632), subculture at a ratio of 1:3, inoculate in a T75 culture flask coated with Laminin521, culture for 3 days, and 15 mL of medium per flask.

[0164] (4) d15: Thereafter, start RPE maintenance culture, change to the second RPE maturation medium, change the medium every 2 - 3 days, and 15 mL of medium per flask.

[0165] (5) Incubate until day 45 for detection.

[0166] hiPSCs in passage culture were photographed under a microscope. The results showed that starting from induction at d0, the cells completely covered the bottom of the culture dish at d7, a small amount of pigmentation appeared in the cells at d29, and the cells at d45 presented a typical RPE cell morphology, being cobblestone-like hexagonal cells, with a large amount of cell deposition ( Figure 18 ).

[0167] Cells at differentiation days 0 and 45 were respectively selected to extract RNA, and RT-qPCR was used to detect the expression of OCT4, MITF, PMEL17, BEST1, RPE65, and CRLBP. The specific steps were as follows:

[0168] A. Extract the total RNA of hiPSC-RPE at differentiation days 0 and 45 respectively:

[0169] (a) Discard the medium in the 35 mm culture dish, add 1 mL of PBS to wash the cells twice, add 500 μL of Trizol reagent, pipette repeatedly with a pipette gun, and then transfer it to a 1.5 mL centrifuge tube and let it stand at room temperature for 5 min;

[0170] (b) Add chloroform at 1 / 5 volume, shake vigorously for 15 s, and let it stand for 5 min;

[0171] (c) Use a low-temperature centrifuge at 4 °C and 12,000 rpm for centrifugation for 15 min;

[0172] (d) Pipette the upper aqueous phase into a new 1.5 mL centrifuge tube and record the volume, add the same volume of isopropanol, mix well, and let it stand at room temperature for more than 30 min;

[0173] (e) Centrifuge at 4 °C and 12,000 rpm for 10 min, discard the supernatant, add 1 mL of pre-cooled 75% ethanol, and shake several times to wash the precipitate;

[0174] (f) Centrifuge at 4 °C and 7500 rpm for 10 min, aspirate the supernatant completely, keep the tube mouth downward, and try to aspirate the remaining ethanol;

[0175] (g) After drying, dissolve the precipitate with an appropriate amount of DEPC water, detect the RNA concentration, and record it.

[0176] B. Reverse transcription

[0177] Thaw the reagents used in advance on ice. Use RNase-free pipette tips and centrifuge tubes throughout the process, and calculate the reaction system. The whole operation is carried out on ice.

[0178] (a) According to the PrimeScriptRtreagentkit kit instructions, configure the reverse transcription system:

[0179] Reagent Dosage Use concentration 5×PrimeScriptbuffer 20μL 1× PrimeScriptRTEnzymemixI 5μL OligodTprimer(50μM) 5 μL 25 pmol Random 6-mers (100 μM) 5 μL 50 pmol Total RNA 5 μL <![CDATA[RNaseFreedH 2 O]]> up to 100 μL

[0180] (b) Reverse transcription conditions:

[0181]

[0182]

[0183] (c) Thaw the qPCR amplification reaction reagents in advance on ice. The reagents are as follows:

[0184]

[0185] Reaction conditions:

[0186]

[0187] Primer information

[0188] Gene Forward primer (5’-3’) Reverse primer (5’-3’) Nanog ACCTTCCGGTATGGAACAA CCAAGTCACTGGCAGGAGA Oct-4 AAGGGCAAGCGATCAAGCA GGGAATGGGACCGAGGAGTA MITF TCACAACCTGATTGAACGAAGAA ACTTTCGGATATAGTCCACGGAT BEST1 CTTGATGGAGCACCCAGAAGT GCTTCATCCCTGTTTTCCAAGG RPE65 CAAGGCTGACACAGGCAAGA TTGACGAGGCCCTGAAAAGA CRLBP CACGCTGCCCAAGTATGATG CCAGGACAGTTGAGGAGAGG PMEL17 GTTGATGGCTGTGGTCCTTG CAGTGACTGCTGCTATGTGG

[0189] RT-qPCR detection results showed that the expression levels of pluripotency genes decreased significantly with induced differentiation, while the expression levels of RPE cell genes increased significantly with induced differentiation ( Figure 19 ).

[0190] Flow cytometry detection (specific detection steps refer to the flow cytometry detection steps in Example 2) of the results of differentiating d45 showed that the positive rate of OCT4 was less than 0.7%; the positive rates of MITF, CD140b, PMEL17, and BEST1 were as high as over 95.7% ( Figure 20 , Figure 21 ).

[0191] Cultivate the cells of hiPSC differentiated d45 on Transwell, and detect the polar distribution of cytokines PEDF and VEGF-A in the apical culture medium and the bottom culture by ELISA (specific detection steps refer to the ELISA detection steps in Example 2). The results showed that the content of PEDF at the top was higher than that at the bottom, and the content of VEGF-A at the top was lower than that at the bottom ( Figure 22 ).

[0192] Cell immunofluorescence detection (specific detection steps refer to the cell immunofluorescence detection steps in Example 2) of the cells of hiPSC differentiated d45 showed strong phagocytic function at 37°C ( Figure 23 ).

[0193] The specific embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art can make various changes or modifications within the scope of the claims, which do not affect the essence of the present invention. Without conflict, the embodiments of the present application and the features in the embodiments can be arbitrarily combined with each other.

Claims

1. A method for preparing retinal pigment epithelial cells, characterized in that, it comprises the following steps: S1. Induce and differentiate pluripotent stem cells with a first RPE differentiation medium for 5 - 7 days, and change the medium every 1 - 3 days; SB431542, LDN193189, CKI-7 and NIC are added to the first RPE differentiation medium; S2. Continuously induce and differentiate the cells obtained from the induction and differentiation culture in step S1 with a second RPE differentiation medium for 5 - 7 days, and change the medium every 1 - 3 days; CHIR99021 and IDE-2 are added to the second RPE differentiation medium; S3. Dissociate the cells obtained from the induction and differentiation in step S2 into single cells with a cell digestive enzyme, and then culture the single cells in a cell culture container with a first RPE maturation medium for 1 - 3 days; the first RPE maturation medium includes Y-27632; S4. Continuously culture the cells obtained from the culture in step S3 with a second RPE maturation medium for 25 - 30 days, and change the medium every 1 - 3 days to obtain retinal pigment epithelial cells.

2. The method for preparing retinal pigment epithelial cells according to claim 1, characterized in that, the pluripotent stem cells in step S1 are obtained through the following steps: Passage culture the pluripotent stem cells with a pluripotent stem cell medium, and remove the pluripotent stem cell medium when the cell colony growth confluence reaches 50% - 70% to obtain pluripotent stem cells; the pluripotent stem cell medium is mTeSR1 or TeSR-E8.

3. The method for preparing retinal pigment epithelial cells according to claim 2, characterized in that, the pluripotent stem cells are cultured in a culture container coated with a cell culture matrix, and the cell culture matrix is one of Matrigel, Collagen, Laminin and Vitronectin.

4. The method for preparing retinal pigment epithelial cells according to claim 1, characterized in that, both the first RPE differentiation medium and the second RPE differentiation medium are prepared through the following steps: Add 10% KnockOut SR, 1% NEAA, 1% GlutaMAX-I, 55 μM 2-Mercaptoethanol to the DMEM / F12 medium.

5. The method for preparing retinal pigment epithelial cells according to claim 1, characterized in that, in the first RPE differentiation medium: the addition concentration of SB431542 is 5 - 15 μM, the addition concentration of LDN193189 is 50 - 150 nM, the addition concentration of CKI-7 is 1 - 10 μM, and the addition concentration of NIC is 5 - 15 mM.

6. The method for preparing retinal pigment epithelial cells according to claim 5, characterized in that, In the first RPE differentiation medium: the added concentration of SB431542 is 8 - 12 μM, the added concentration of LDN193189 is 80 - 120 nM, the added concentration of CKI-7 is 3 - 7 μM, and the added concentration of NIC is 8 - 13 mM.

7. The method for preparing retinal pigment epithelial cells according to claim 6, wherein, in the first RPE differentiation medium: the added concentration of SB431542 is 10 μM, the added concentration of LDN193189 is 100 nM, the added concentration of CKI-7 is 5 μM, and the added concentration of NIC is 10 mM.

8. The method for preparing retinal pigment epithelial cells according to any one of claims 1 - 7, wherein, in the second RPE differentiation medium: the added concentration of CHIR99021 is 1 - 5 μM, and the added concentration of IDE-2 is 200 - 300 nM.

9. The method for preparing retinal pigment epithelial cells according to claim 8, wherein, in the second RPE differentiation medium: the added concentration of CHIR99021 is 2 - 4 μM, and the added concentration of IDE-2 is 230 - 270 nM.

10. The method for preparing retinal pigment epithelial cells according to claim 9, wherein, in the second RPE differentiation medium: the added concentration of CHIR99021 is 3 μM, and the added concentration of IDE-2 is 250 nM.

11. The method for preparing retinal pigment epithelial cells according to claim 1, wherein, the first RPE maturation medium is prepared by the following steps: adding 5% KnockOut SR, 1% Sodium pyruvate, and 1% GlutaMAX-I to the DMEM medium.

12. The method for preparing retinal pigment epithelial cells according to claim 1, wherein, the cell digestive enzyme in step S3 is one of TrypLE, Accutase, or trypsin.

13. The method for preparing retinal pigment epithelial cells according to claim 12, wherein, in step S3, the cells induced and differentiated in step S2 are digested with the cell digestive enzyme for 5 - 10 minutes.

14. The method for preparing retinal pigment epithelial cells according to claim 1, wherein, the added concentration of Y-27632 in the first RPE maturation medium is 5 - 15 μM.

15. The method for preparing retinal pigment epithelial cells according to claim 14, wherein, the added concentration of Y-27632 in the first RPE maturation medium is 8 - 12 μM.

16. The method for preparing retinal pigment epithelial cells according to claim 15, wherein, the added concentration of Y-27632 in the first RPE maturation medium is 10 μM.

17. The method for preparing retinal pigment epithelial cells according to claim 1, wherein, In step S3, the single cells are cultured in a cell culture container coated with a cell culture matrix, and the cell culture matrix is one of Matrigel, Collagen, Laminin, and Vitronectin.

18. The method for preparing retinal pigment epithelial cells according to claim 1, wherein, in step S4, the second RPE maturation medium is prepared by the following steps: adding 1% KnockOut SR, 1% Sodium pyruvate, and 1% GlutaMAX-I to the DMEM medium.

19. The method for preparing retinal pigment epithelial cells according to claim 1, wherein, the pluripotent stem cells are human induced pluripotent stem cells or human embryonic stem cells.

Citation Information

Patent Citations

  • An induction culture medium, its usage and application

    CN113549596B

  • Methods for preparing retinal pigment epithelial cells

    CN113699097B

  • Large scale production of retinal pigment epithelial cells

    US20220098551A1

  • Automated method for preparing retinal pigment epithelium cells

    US20220333065A1

Cited By

  • Method for preparing retinal pigment epithelial cells through induced differentiation

    CN122235069A