Gene related to high temperature resistance of non-heading Chinese cabbage and application thereof

Abstract

The invention provides a gene related to high temperature resistance of non-heading Chinese cabbages and application of the gene, and relates to the technical field of genetic breeding, the gene is named as BrNAC043 gene, the nucleotide sequence of the gene is shown as SEQ ID NO.1, the amino acid sequence of the gene is shown as SEQ ID NO.2, the high temperature resistance of various non-heading Chinese cabbage varieties is judged according to the expression quantity of the BrNAC043 gene, the high temperature resistance of the non-heading Chinese cabbage variety with high expression quantity of the BrNAC043 gene is superior to that of the non-heading Chinese cabbage variety with low expression quantity of the BrNAC043 gene. The gene and the method provided by the invention are beneficial to genetic breeding of the non-heading Chinese cabbage.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic breeding, and particularly relates to a gene related to the high-temperature tolerance of non-heading Chinese cabbage and its application. Background Art

[0002] Non-heading Chinese cabbage (Brassica chinensis), also known as small rapeseed, belongs to the genus Brassica of the Cruciferae family. It is an important vegetable crop commonly cultivated in southern China and plays an important role in the annual supply of vegetables.

[0003] High temperature is the most common stress factor in vegetable production. Since non-heading Chinese cabbage prefers a cool climate and is not tolerant to high temperature, the high-temperature stress in summer and autumn easily restricts the growth of non-heading Chinese cabbage in the field environment and affects the supply of non-heading Chinese cabbage in summer and autumn.

[0004] In the prior art, the methods for cultivating high-temperature-tolerant non-heading Chinese cabbage are mostly traditional planting and screening methods, which have defects such as long cycle and slow effect.

[0005] Therefore, studying the high-temperature tolerance mechanism of non-heading Chinese cabbage at the gene level is an important means for cultivating high-temperature-tolerant non-heading Chinese cabbage. Summary of the Invention

[0006] (I) Technical Problems to be Solved

[0007] Aiming at the deficiencies of the prior art, the present invention provides a gene related to the high-temperature tolerance of non-heading Chinese cabbage and its application, so as to solve the technical problems such as the long cycle in cultivating non-heading Chinese cabbage varieties with strong high-temperature tolerance in the prior art.

[0008] (II) Technical Solutions

[0009] To achieve the above object, the present invention is realized through the following technical solutions:

[0010] In the first aspect of the present invention, a gene related to the high-temperature tolerance of non-heading Chinese cabbage is provided. The gene is named BrNAC043 gene, and its nucleotide sequence is shown in SEQ ID NO.1, and its amino acid sequence is shown in SEQ ID NO.2.

[0011] In the second aspect of the present invention, it also relates to the application of the above BrNAC043 gene in the breeding of high-temperature-tolerant non-heading Chinese cabbage. The application includes overexpressing the BrNAC043 gene to improve the high-temperature tolerance of non-heading Chinese cabbage.

[0012] In the third aspect of the present invention, it also relates to the application of the above BrNAC043 gene in identifying the high-temperature tolerance of non-heading Chinese cabbage. The application is to judge the superiority of the high-temperature tolerance among different non-heading Chinese cabbage varieties according to the level of BrNAC043 gene expression.

[0013] Furthermore, the non-heading Chinese cabbage varieties with high BrNAC043 gene expression levels have better high-temperature tolerance than those with low BrNAC043 gene expression levels.

[0014] In the fourth aspect of the present invention, it also relates to a vector of the above-mentioned BrNAC043 gene, which is obtained by digesting the fragment shown in SEQ ID NO.1 with an enzyme and ligating it into the vector pCAMBIA1305.

[0015] In the fifth aspect of the present invention, it also relates to a method for obtaining the above-mentioned BrNAC043 gene, including amplifying the cDNA template of non-heading Chinese cabbage with a primer pair composed of F1 and R1 to obtain the BrNAC043 gene; wherein, the nucleotide sequence of F1 is as shown in SEQ ID NO.3, and the nucleotide sequence of R1 is as shown in SEQ ID NO.4.

[0016] In the sixth aspect of the present invention, it also relates to a method for identifying the high-temperature tolerance of non-heading Chinese cabbage, including:

[0017] Measuring the expression level of the BrNAC043 gene at the same position of non-heading Chinese cabbage plants cultured under the same conditions by fluorescence quantitative PCR, and judging the high-temperature tolerance of different non-heading Chinese cabbage varieties according to the high or low expression level of the BrNAC043 gene.

[0018] Furthermore, the step of judging the high-temperature tolerance of different non-heading Chinese cabbage varieties according to the high or low expression level of the BrNAC043 gene includes: the non-heading Chinese cabbage varieties with high BrNAC043 gene expression levels have better high-temperature tolerance than those with low BrNAC043 gene expression levels.

[0019] Furthermore, the primer pair used in the fluorescence quantitative PCR method is composed of F3 and R3; wherein, the nucleotide sequence of F3 is as shown in SEQ ID NO.8, and the nucleotide sequence of R3 is as shown in SEQ ID NO.9.

[0020] (III) Beneficial effects

[0021] A gene related to the high-temperature tolerance of non-heading Chinese cabbage and its application provided by the present invention have the following beneficial effects compared with the prior art:

[0022] The present invention discloses the nucleotide sequence of the BrNAC043 gene in non-heading Chinese cabbage. According to the high or low expression level of the BrNAC043 gene, the heat tolerance of different non-heading Chinese cabbage varieties can be judged. Among them, the non-heading Chinese cabbage variety with a high expression level of the BrNAC043 gene has better heat tolerance than the non-heading Chinese cabbage variety with a low expression level of the BrNAC043 gene. The genes and methods involved in the present invention contribute to the genetic breeding of non-heading Chinese cabbage. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0024] Figure 1 It is a comparison chart of the expression levels of the BrNAC043 gene in different non-heading Chinese cabbage materials at room temperature;

[0025] Figure 2 It is a comparison chart of the expression levels of the BrNAC043 gene in different non-heading Chinese cabbage materials at high temperature;

[0026] Figure 3 It is a comparison chart of the expression levels of the BrNAC043 gene in wild-type lines and overexpression lines;

[0027] Figure 4 It is a comparison chart of the phenotypic states of wild-type lines and lines overexpressing the BrNAC043 gene at room temperature and high temperature;

[0028] Figure 5 It is a PCR amplification gel diagram of the BrNAC043 gene in non-heading Chinese cabbage;

[0029] Figure 6 It is a bacterial liquid PCR identification gel diagram of the BrNAC043 gene in non-heading Chinese cabbage. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0030] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described. Obviously, the described embodiments are some, but not all, of the embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the scope of protection of the present invention.

[0031] Example 1

[0032] The following operations were performed on the non-heading Chinese cabbage germplasm of variety QS054.

[0033] Obtaining the Brassica rapa subsp. chinensis BrNAC043 gene, and the obtaining process includes:

[0034] Step 1. Extracting total RNA from the Brassica rapa subsp. chinensis genome and synthesizing cDNA: Refer to the instruction manual of the Takara RNA extraction kit to extract total RNA from the Brassica rapa subsp. chinensis genome. After quantifying the obtained RNA, add samples to synthesize cDNA according to the system in Table 1, and specifically refer to the Takara reverse transcription instruction manual.

[0035] Table 1

[0036] Reagent Volume (μL) 5x gDNA Eraser Buffer 2 gDNA Eraser 1 Total RNA 1μg <![CDATA[RNase Free ddH 2 O]]> Up to 10μl PrimeScript RT Enzyme Mix I 1 RT Primer Mix 1 5x PrimeScript Buffer 2 4 <![CDATA[RNase Free ddH 2 O]]> 4 Total 20

[0037] Step 2. Obtaining, recovering and purifying the Brassica rapa subsp. chinensis BrNAC043 gene

[0038] Step 2.1. Using the upstream primer F1 (nucleotide sequence as shown in SEQ ID NO.3) and the downstream primer R1 (nucleotide sequence as shown in SEQ ID NO.4), perform PCR amplification on the cDNA template obtained in Step 1 to obtain the BrNAC043 gene, whose nucleotide sequence is as shown in SEQ ID NO.1 and amino acid sequence is as shown in SEQ ID NO.2. The amplification system is shown in Table 2; among them, the PCR amplification running program is: 95°C for 3 min, 95°C for 15 s, 58.5°C for 15 s, 72°C for 40 s, return to the second step, repeat 34 cycles (that is, repeat the three steps of (95°C for 15 s, 58.5°C for 15 s, 72°C for 40 s) 34 times), 72°C for 10 min, 8°C for 10 min.

[0039] Table 2

[0040] Reagent Volume (μL) 2×Phanta Max Master Mix 12.5 cDNA 1 F-Primer 1 R-Primer 1 <![CDATA[RNase Free ddH 2 O]]> 9.5 Total 25

[0041] Step 2.2. Add the restriction enzyme BamHⅠ and protective bases to the 5' end of the upstream primer F1 (obtaining the upstream primer F2, whose nucleotide sequence is as shown in SEQ ID NO.5), and add the restriction enzyme HindⅢ and protective bases to the 5' end of the downstream primer R1 (obtaining the downstream primer R2, whose nucleotide sequence is as shown in SEQ ID NO.6);

[0042] Step 2.3. Take 1 μl of the PCR amplification product obtained in Step 1 as the cDNA template, use the upstream primer F2 and downstream primer R2 obtained in Step 2.2 for PCR amplification, and detect the obtained product by 1% agarose gel electrophoresis. The electrophoresis result is as Figure 5, cut the obtained fragments that meet the expected size from the agarose gel, and recover the target DNA fragments according to the instructions of the TIANgel Purification Kit to obtain the gel recovery product. All the above primers were synthesized by General Biosystems; among them, the amplification system in this step is the same as that in Table 2, and the PCR amplification running program is: 95°C for 3 min, 95°C for 15 s, 58.5°C for 15 s, 72°C for 40 s, return to the second step, repeat 34 cycles (that is, the three steps of (95°C for 15 s, 58.5°C for 15 s, 72°C for 40 s) are repeated 34 times), 72°C for 10 min, 8°C for 10 min.

[0043] Step 3. Construction of cloning vector and transformation of Escherichia coli

[0044] Step 3.1: Use restriction enzymes BamHⅠ and HindⅢ to double-digest the vector pCAMBIA1305 according to the system in Table 3 to obtain a linearized vector;

[0045] Table 3

[0046] Reagent Volume (μL) 10×Quick Buffer 5 BamHⅠ 1 HindⅢ 1 1305 Plasmid 7.5 <![CDATA[RNase Free ddH 2 O]]> 10.5 Total 25

[0047] Step 3.2: Take the gel recovery product obtained in Step 2 and the linearized vector obtained in Step 3.1, and perform recombinant ligation at a volume ratio of 1:2 (the operation steps refer to the instructions of the Vazyme ClonExpressⅡ One Step Cloning Kit) to obtain a ligation product.

[0048] Step 3.3: Take 5 μL of the ligation product obtained in Step 3.2, add it to 50 μL of thawed Escherichia coli DH5α competent cells, let it stand on ice for 30 min, then heat shock at 42°C for 45 s, quickly place it on ice and let it stand for 3 min, add 600 μL of LB liquid medium (the preparation ratio of LB liquid medium is: 1 g of tryptone, 0.5 g of yeast extract, 1 g of NaCl, 100 ml of distilled water in 100 ml of LB) and culture it in a shaking incubator at 37°C and 220 rpm for 1 h. After the culture is completed, centrifuge at 5000 rpm for 3 min, discard most of the supernatant, and gently pipette the remaining 70 μL with a pipette gun, and evenly spread it on an LB culture dish containing 100 mg·L -1 kan (the preparation ratio of LB solid medium is: 1 g of tryptone, 0.5 g of yeast extract, 1 g of NaCl, 1.5 g of agar, 100 ml of distilled water in 100 ml of LB). After waiting for it to air dry, place it in a 37°C incubator and culture it overnight. The next day, pick 8 single colonies into a 1.5 mL EP tube, add 600 μL of liquid LB containing Kan resistance, and culture it in a shaking incubator at 37°C and 220 rpm for 6 h to obtain the target bacterial solution.

[0049] Step 4. Sequencing and bioinformatics analysis

[0050] Take the target bacterial solution obtained in Step 3 for bacterial solution PCR identification. Use the upstream primer F2 and the downstream primer 1305R (the nucleotide sequence of the downstream primer 1305R is shown in SEQ ID NO. 7) to amplify the BrNAC043 gene according to the system in Table 4. The amplification program is: 95°C for 3 min, 95°C for 15 s, 58.5°C for 15 s, 72°C for 40 s, return to the second step, repeat 34 cycles (i.e., repeat the three steps of (95°C for 15 s, 58.5°C for 15 s, 72°C for 40 s) 34 times), 72°C for 10 min, 8°C for 10 min.

[0051] After agarose gel electrophoresis, the imaging is as Figure 6 , and sequence the bacterial solution with the correct band size (the target band is around 1000 bp).

[0052] If the sequencing result is correct, take 500 μL of the target bacterial solution obtained in Step 3, uniformly mix it with 500 μL of 50% glycerol, and store it in a -80°C refrigerator.

[0053] Table 4

[0054] Reagent Volume (μL) 2×Rapid Taq Master Mix 5 Bacterial Solution 1 F-Primer 0.2 R-Primer 0.2 <![CDATA[RNase Free ddH 2 O]]> 3.6 Total 10

[0055] Example 2

[0056] Functional verification of the BrNAC043 gene

[0057] 1. Analysis of the expression pattern of the BrNAC043 gene in non-heading Chinese cabbage under normal temperature and high temperature stress conditions

[0058] In this experiment, 25 different non-heading Chinese cabbage varieties (the specific varieties are: QS023, QS026, QS027, QS028, QS029, QS032, QS033, QS035, QS037, QS038, QS042, QS045, QS046, QS048, QS050, QS051, QS053, QS054, QS055, QS089, QS093, QS094, QS096, QS097, QS098) were selected and planted at the same time. After the seeds germinated, they were placed in an artificial climate chamber for unified cultivation. The cultivation conditions of the artificial climate chamber were: the temperature was set at 20 / 15°C (day / night), the time was set at 16 / 8 h (day / night), the daytime light intensity was set at 300 μmol·m -2 s -1 , and the nighttime light intensity was set at 0 μmol·m -2 s -1 , and the humidity was kept constant at 70%.

[0059] When the non-heading Chinese cabbage grows to 5-6 true leaves, 24 seedlings of the same size and growth vigor are selected for each variety. Among them, 12 seedlings are subjected to high-temperature stress treatment, and 12 seedlings are subjected to normal-temperature control treatment, and the treatment duration is 1 day for both.

[0060] Among them:

[0061] The conditions of the artificial climate chamber for the high-temperature group are set as follows: the temperature is 42°C / 37°C (day / night), the time is 16 / 8 h (day / night), the daytime light intensity is 300 μmol·m -2 s -1 , and the nighttime light intensity is 0 μmol·m -2 s -1 , and the humidity is kept constant at 70%;

[0062] The conditions of the artificial climate chamber for the normal-temperature control group are set as follows: the temperature is 20 / 15°C (day / night), the time is 16 / 8 h (day / night), the daytime light intensity is 300 μmol·m -2 s -1 , and the nighttime light intensity is 0 μmol·m -2 s -1 , and the humidity is kept constant at 70%.

[0063] After 1 day of treatment of each seedling under the corresponding conditions, 0.1 g of samples are taken respectively, and the obtained samples are placed in 1.5 mL EP tubes and quickly frozen and stored in liquid nitrogen for subsequent experiments; among them, the sampling position is the third leaf counted from the inside out.

[0064] Place the 1.5 mL EP tube containing the sample on the grinder and grind it for 60 s until it becomes a powder. Obtain the RNA and cDNA of the sample according to the method shown in Example 1, and then measure the expression level of the BrNAC043 gene. The specific measurement of the BrNAC043 gene expression level is as follows:

[0065] According to the nucleotide sequence of the BrNAC043 gene shown in SEQ ID NO.1, use Oligo 7.0 software to design a fluorescent primer pair for detecting the expression of the BrNAC043 gene (where the nucleotide sequence of the upstream primer F3 is shown in SEQ ID NO.8, and the nucleotide sequence of the downstream primer R3 is shown in SEQ ID NO.9, and the primers are synthesized by General Biosystems), place the EP tube on ice and add samples to it according to the system in Table 5, and refer to YEASEN Perform real-time quantitative PCR operation according to the SYBR Green Master Mix reagent instruction manual, and detect the gene expression level in the CFX 96 PCR instrument (using the non-heading Chinese cabbage housekeeping gene Actin as a reference, and the nucleotide sequence is as shown in SEQ ID NO.12); among them, the BrNAC043 gene expression level of each sample is biologically replicated three times, and the primer pair for amplifying the housekeeping gene Actin is the upstream primer Actin-F (SEQ ID NO.10): AGGCTACACGTTCGGACAAG, and the downstream primer Actin-R (SEQ ID NO.11): TGGGGCACTAAACACAGTCA.

[0066] Table 5

[0067] Reagent Volume (μL) qPCR SYBR Green Master Mix 10 cDNA 1 F-Primer 1 R-Primer 1 <![CDATA[RNase Free ddH 2 O]]> 7 Total 20

[0068] The test results are as Figure 1 and Figure 2 shown. The expression levels of the BrNAC043 gene under normal temperature (conditions shown in the normal temperature control group) and high temperature (conditions shown in the high temperature group) are significantly different among different non-heading Chinese cabbage materials.

[0069] 2. Determination of heat tolerance-related indicators of non-heading Chinese cabbage under normal temperature and high temperature stress

[0070] Determine the heat tolerance-related indicators of 25 non-heading Chinese cabbages in the normal temperature control group and 25 non-heading Chinese cabbages in the high temperature group respectively, including the determination of the semi-lethal temperature, heat injury index, relative water content, malondialdehyde content, Fv / Fm and Fv / Fo.

[0071] (1) Determination of the semi-lethal temperature

[0072] The semi-lethal temperature of non-heading Chinese cabbage is determined by the conductivity method to measure the leaf electrolyte permeability at different treatment temperatures, and is fitted using the Logistic regression equation. Weigh 8 leaves (each 0.1 g) of non-heading Chinese cabbage in each group, put the 8 leaves into 8 portions of 10 ml double-distilled water and perform a 30-min water bath. The water bath temperatures of the 8 portions of double-distilled water are 25 °C at room temperature (CK), 30 °C, 35 °C, 40 °C, 45 °C, 50 °C, 55 °C, and 60 °C respectively. Then measure the current leaf electrolyte permeability K1 with a conductivity meter. Then put the 8 portions of double-distilled water into water at 100 °C for a 15-min water bath and take them out. After cooling to room temperature, measure the current leaf electrolyte permeability K2 again. Fit the treatment temperature and the leaf electrolyte permeability with the Logistic equation. The obtained fitting equation is shown in Table 6. The temperature at the inflection point of the curve corresponding to the fitting equation is the high temperature semi-lethal temperature.

[0073] (2) Determination of the heat injury index

[0074] According to the heat injury symptom grading standard, the damage conditions of the leaves of each group of plants were counted, and the heat injury index of this group was calculated.

[0075] The heat injury symptom grading standard is as follows:

[0076] Grade 0 - No heat injury symptoms, and the plants grow normally;

[0077] Grade 1 - The number of damaged leaves of the plant < 1 / 3 of the total number of leaves of the whole plant;

[0078] Grade 3 - 1 / 3 of the total number of leaves of the whole plant ≤ the number of damaged leaves of the plant < 1 / 2 of the total number of leaves of the whole plant;

[0079] Grade 5 - 1 / 2 of the total number of leaves of the whole plant ≤ the number of damaged leaves of the plant < 2 / 3 of the total number of leaves of the whole plant;

[0080] Grade 7 - The number of damaged leaves of the plant ≥ 2 / 3 of the total number of leaves of the whole plant, but the plant has not died;

[0081] Grade 9 - The plant has lost its economic value or died.

[0082] Heat injury index = [∑(X × Xi) / (A × N)] × 100%

[0083] X represents the heat injury grade, Xi represents the number of plants at the X heat injury grade, A represents the highest grade, and N represents the total number of plants surveyed.

[0084] (3) Determination of relative water content

[0085] The determination of the relative water content of leaves was carried out by the weighing method. Fresh plant leaves at the same position in each group (sampling position: the third leaf counted from the inside outwards) were collected, wiped clean and the fresh weight was measured. Then they were soaked in deionized water for 24 h to make them fully saturated with water, the surface water was blotted dry with blotting paper and the saturated fresh weight was measured. Then they were placed in an oven at 105 °C for 30 min for fixation, and then placed in an oven at 80 °C for drying for 48 h until the weight remained unchanged, and the dry weight was weighed. Each group had 3 replicates. The calculation formula is as follows:

[0086] Relative water content of leaves (%) = (fresh weight - dry weight) / (saturated fresh weight - dry weight) × 100%

[0087] (4) Determination of MDA (malondialdehyde) content

[0088] The content of MDA was determined by the thiobarbituric acid (TBA) method. 0.1 g of non-heading Chinese cabbage leaves were accurately weighed and put into a mortar, and 1.5 mL of 10% TCA (trichloroacetic acid) was added and ground into a homogenate. Then the homogenate was centrifuged at 6000 r / min for 10 min. 1 mL of the supernatant and 2 mL of TBA were added to a test tube and mixed evenly. The mixture was heated in a boiling water bath at 100 °C for 30 min, and its absorbance value was measured with a 1 cm cuvette at wavelengths of 600 nm, 532 nm and 450 nm. Each group had 3 replicates. The calculation formula for the content of MDA is:

[0089] MDA (mmol·g -1 FW) = [6.452×(D532 - D600) - 0.559×D450]×Vt / (Vs×W)

[0090] Where: Vt is the total volume of the extraction solution (mL). In this example, Vt is 3 mL (1 mL of supernatant + 2 mL of TBA); Vs is the volume of the extraction solution used (mL). In this example, Vs is 1 mL; W is the sample mass (g), and D532, D600, and D450 are the absorbance values of the sample at wavelengths of 532 nm, 600 nm and 450 nm, respectively.

[0091] (5) Measurement of chlorophyll fluorescence parameters

[0092] The chlorophyll fluorescence-related parameters were measured by a plant efficiency analyzer (Pocket PEA, Hansatech, UK). Before measurement, the leaves to be measured were clamped with a supporting dark adaptation clip. The leaves were selected from the same node of different plants (the sampling position was the third leaf counted from the inside out), avoiding the main vein. The leaf was clamped and the measurement window was closed. Each group had three replicates and was dark-treated for 20 min. After the dark treatment was completed, the plant efficiency analyzer was used for measurement and analysis. The instrument can complete the measurement of more than 50 chlorophyll fluorescence parameters including Fo, Fm, Fv, Tm, and PIABS, continuously record 100,000 fluorescence trace measurement values per second, and completely measure the OJIP fluorescence induction kinetic curve of chlorophyll within 1 s. The measured results are shown in Table 6 (heat tolerance indexes of 25 non-heading Chinese cabbage materials):

[0093] Table 6

[0094]

[0095]

[0096] Using the fuzzy membership function, the heat injury index, malondialdehyde content, relative leaf water content, Fv / Fm and Fv / Fo of non-heading Chinese cabbage after high temperature treatment were analyzed to comprehensively evaluate the heat tolerance of non-heading Chinese cabbage. The specific formula of the membership function is:

[0097] The index is positively correlated with heat resistance, and the formula M = (Mi - Mmin) / (Mmax - Mmin) is used;

[0098] The index is negatively correlated with heat resistance, and the formula M = 1 - (Mi - Mmin) / (Mmax - Mmin) is used;

[0099] In the formula, Mi represents the measured value of the index, Mmin represents the minimum value among the measured values of the index, and Mmax represents the maximum value among the measured values of the index.

[0100] The membership function values are calculated for each index respectively, and the materials are ranked according to the average membership function values. The higher the average membership function value, the stronger the high-temperature resistance of the material. As shown in Table 7 (Evaluation of Temperature Resistance of 25 Non-heading Chinese Cabbage Materials):

[0101] Table 7

[0102]

[0103]

[0104] From Table 7 and Figure 1 and 2 the data in it can be seen that under normal temperature and high temperature conditions, the trend of the average membership function value is basically the same as the expression level trend of the BrNAC043 gene in each non-heading Chinese cabbage material; among them, the higher the expression level of the BrNAC043 gene, the higher the corresponding membership function value, and the stronger the high-temperature resistance of the corresponding non-heading Chinese cabbage variety, indicating that plants with high expression levels of the BrNAC043 gene can better cope with the damage caused by high-temperature stress.

[0105] Example 3

[0106] The ligation product obtained in Example 1 with correct sequencing was transformed into Agrobacterium tumefaciens GV3101 (purchased from Shanghai Weidi Biotechnology Co., Ltd.). The specific operation was as follows: 1 μg of the recombinant vector plasmid DNA (the ligation product obtained in Example 1) was added to 100 μl of Agrobacterium tumefaciens GV3101 competent cells, and the tube bottom was gently tapped by hand to mix evenly. Then, it was left standing on ice for 5 min, in liquid nitrogen for 5 min, in a water bath at 37 °C for 5 min, and in an ice bath for 5 min. 700 μl of LB liquid medium without antibiotics was added, and the mixture was cultured with shaking at 28 °C for 2 h; the bacteria were collected by centrifugation at 6000 rpm for 1 min, about 70 μl of the supernatant was retained, the bacterial cells were gently pipetted and resuspended, and then evenly spread on an LB solid medium containing Kan and Rif, and inverted and placed in an incubator at 28 °C for 2 days to obtain the required bacterial solution. Several positive clones were picked into a 700 μl liquid LB centrifuge tube containing Kan and Rif antibiotics, and after culturing with shaking at 28 °C for 2 days, the results were verified by bacterial liquid PCR (the PCR program was the same as that in Example 1).

[0107] 1 mL of the required bacterial solution obtained above was added to 100 mL of LB liquid medium, 100 μL of Kan (kanamycin) and 200 μL of Rif (rifampicin), and the mixture was placed in a shaking incubator at 28 °C and 220 rpm for 12 h. Then, the OD value of the bacterial solution was measured. When the OD value reached 0.8 - 1.0, centrifugation was carried out at 6000 rpm for 5 min, the supernatant was discarded after precipitating the bacterial cells, an appropriate amount of buffer (the buffer was prepared from 5% sucrose and 50 μL of Silwet - 77) was added to the precipitated bacterial cells, and the bacterial cells were pipetted and resuspended evenly. After the resuspended bacterial solution was protected from light for 4 h, it was poured into a glass petri dish, the inflorescence of Arabidopsis thaliana was immersed in the petri dish, and gently shaken for 1 min. After transformation, the plants were protected from light and kept moist for 24 h, and then placed in a natural growth chamber for normal cultivation, and transformed again after one week.

[0108] The seeds of the T0 generation after infecting Arabidopsis thaliana were harvested. The T0 generation seeds were disinfected with 75% alcohol for 30 s, and then rinsed with 3% NaClO 3 for 6 min. The seeds were evenly spread on a 1 / 2MS medium containing 30 mg / L hygromycin and cultured under light at 22 °C for 7 to 10 days to screen for T1 generation positive plants.

[0109] The T1 generation positive seedlings were transplanted into nutrient soil, covered with plastic wrap for 2 to 3 days and then the plastic wrap was removed, and then they grew normally. The leaves of the selected T1 generation positive plants were taken to extract DNA, and the PCR method was used to identify that they contained the BrNAC043 gene, and finally it was confirmed that the gene had been transferred into the T1 generation positive plants. After successive screening (the screening methods for the T2 and T3 generation plants were the same as those for the T1 generation), finally, 3 T3 generation transgenic lines (OE#2, OE#7, and OE#8) with relatively high BrNAC043 gene expression levels were obtained.

[0110] Figure 3 The results of real-time quantitative PCR showed that the relative expression levels of the BrNAC043 gene in OE#2, OE#7, and OE#8 were all higher than those in the wild type (WT). These results indicated that the genetic transformation of transgenic Arabidopsis thaliana was successfully carried out, and the three obtained transgenic lines could be used for subsequent experiments.

[0111] Wild-type WT Arabidopsis thaliana and T3-generation seeds (OE#2, OE#7, and OE#8) were simultaneously placed on 1 / 2 MS medium. After 7 to 10 days, the seedlings were transplanted into nutrient soil, covered with plastic wrap for 2 to 3 days and then the wrap was removed. When the Arabidopsis thaliana grew to 6 weeks old, high-temperature stress treatment was carried out for 3 days. The conditions in the artificial climate chamber for the high-temperature group were set as follows: the temperature was 42°C / 37°C (day / night), the time was 16 / 8 h (day / night), the light intensity during the day was 300 μmol·m -2 s -1 , and the light intensity at night was 0 μmol·m -2 s -1 ; the humidity was kept constant at 70%. The conditions in the artificial climate chamber for the normal-temperature control group were set as follows: the temperature was 20 / 15°C (day / night), the time was 16 / 8 h (day / night), the light intensity during the day was 300 μmol·m -2 s -1 ; the light intensity at night was 0 μmol·m -2 s -1 , and the humidity was kept constant at 70%.

[0112] After high-temperature treatment of the wild type and transgenic line plants, as Figure 4 shown, obvious leaf curling and wilting and drying occurred in the wild-type lines, while there was no obvious or only slight dehydration in the transgenic lines. Subsequently, after rehydration for 3 days of the wild type and transgenic line plants, the survival rate of the transgenic lines was significantly higher than that of the wild-type lines, indicating that the BrNAC043 gene was positively correlated with heat tolerance in non-heading Chinese cabbage.

[0113] It should be noted that in this article, the term "including", "comprising", or any other variant thereof is intended to cover non-exclusive inclusion, such that a process, method, article, or device including a series of elements not only includes those elements but also includes other elements not expressly listed, or further includes elements inherent to such process, method, article, or device. Without further limitation, an element defined by the phrase "including a..." does not exclude the existence of additional identical elements in the process, method, article, or device including the said element.

[0114] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that: they can still modify the technical solutions recorded in the foregoing embodiments, or perform equivalent replacements on some of the technical features; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A gene related to high temperature tolerance of non-heading Chinese cabbage, the gene is named BrNAC043 gene, the nucleotide sequence of which is shown in SEQ ID NO.1, and the amino acid sequence of which is shown in SEQ ID NO.

2.

2. The use of the BrNAC043 gene in claim 1 in breeding heat-resistant non-heading cabbage, characterized in that: The application includes overexpressing the BrNAC043 gene to improve the high temperature resistance of non-heading cabbage.

3. The use of the BrNAC043 gene in claim 1 in identifying the high temperature resistance of non-heading Chinese cabbage, characterized in that: The application includes judging the superiority or inferiority of high temperature resistance among various non-heading cabbage varieties according to the level of BrNAC043 gene expression.

4. The use of the BrNAC043 gene according to claim 3 in identifying the high temperature resistance of non-heading Chinese cabbage, characterized in that: The non-heading cabbage varieties with high BrNAC043 gene expression levels have better high temperature tolerance than those with low BrNAC043 gene expression levels.

5. A vector containing the BrNAC043 gene according to claim 1, characterized in that: The vector is obtained by enzymatically cutting the fragment shown in SEQ ID NO.1 into vector pCAMBIA1305.

6. The method for obtaining the BrNAC043 gene according to claim 1, characterized in that: The invention comprises amplifying a cDNA template of non-heading Chinese cabbage with a primer pair consisting of F1 and R1 to obtain a BrNAC043 gene; wherein the nucleotide sequence of F1 is shown as SEQ ID NO.3, and the nucleotide sequence of R1 is shown as SEQ ID NO.

4.

7. A method for identifying the high temperature resistance of non-heading cabbage, characterized in that: include: The expression level of the BrNAC043 gene described in claim 1 is measured at the same position of each non-heading cabbage plant cultured under the same conditions by using the fluorescent quantitative PCR method, and the high temperature resistance of each non-heading cabbage variety is judged according to the level of BrNAC043 gene expression.

8. The method according to claim 7, characterized in that The method of judging the high temperature resistance of each non-heading cabbage variety according to the expression level of the BrNAC043 gene includes: the high temperature resistance of the non-heading cabbage variety with a high expression level of the BrNAC043 gene is better than that of the non-heading cabbage variety with a low expression level of the BrNAC043 gene.

9. The method according to claim 7, characterized in that: The primer pair used in the fluorescent quantitative PCR method consists of F3 and R3; wherein the nucleotide sequence of F3 is shown in SEQ ID NO.8, and the nucleotide sequence of R3 is shown in SEQ ID NO.9.

Images