Application of nicotiana benthamiana NbGRP gene in improving expression level of plant virus-mediated foreign protein and transgenic plant cultivation method

Abstract

The invention discloses an application of a nicotiana benthamiana NbGRP gene in improving the expression level of a plant virus mediated foreign protein and a transgenic plant cultivation method, the plant virus is tobacco mosaic virus or potato X virus, and the transcript sequence of the NbGRP gene is shown as SEQ ID NO: 1. The NbGRP gene edited nicotiana benthamiana plant is obtained by introducing a gene knockout vector carrying an NbGRP gene target into nicotiana benthamiana by using an agrobacterium transformation method. The mutant plant can remarkably promote plant growth and remarkably improve the expression level of foreign protein mediated by the tobacco mosaic virus and potato X virus vector, and a new thought is provided for efficient production of the foreign protein.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and particularly to the application of Nicotiana benthamiana NbGRP gene in improving the expression level of exogenous proteins mediated by plant viruses and a method for cultivating transgenic plants. Background Art

[0002] As an efficient bioreactor, plants have been widely used in the production of pharmaceutical and non-pharmaceutical target proteins. Compared with mammalian expression systems, plant expression systems have significant advantages, including higher scalability, lower production costs, lower risk of human pathogen contamination, and the ability to achieve high-level protein expression in a shorter time. In the past three decades, plant expression systems have been used to produce a variety of recombinant proteins, such as vaccines, therapeutic antibodies, and bioactive proteins, demonstrating their great potential in the field of biopharmaceuticals.

[0003] How to improve the yield of target proteins is a key factor to be considered for effective expression using plants. Although overexpressing the target in transgenic plants is a key means for large-scale production of vaccines or target molecules, the time required to obtain transgenic plants is relatively long, and the yield of target proteins or molecules may be affected by pathways such as RNA silencing. Therefore, the existing technologies for producing exogenous proteins using plant expression systems still have deficiencies such as unstable expression levels of exogenous proteins, low yields, long production cycles, and low production efficiencies. As obligate intracellular parasites, plant viruses have been successfully modified into plant virus vectors that can efficiently deliver target genes into plant cells, promoting the rapid expression of vaccines, monoclonal antibodies, or other therapeutic proteins. However, in order to resist virus infection, plants have evolved different levels of antiviral defense mechanisms, which affect the yield of target proteins. Therefore, exploring antiviral factors in plants and knocking them out will be beneficial to the infection of virus vectors, thereby increasing the yield of target proteins. Summary of the Invention

[0004] The object of the present invention is to provide an application of Nicotiana benthamiana NbGRP gene in improving the expression level of exogenous proteins mediated by plant viruses and a method for cultivating transgenic plants. By knocking out the NbGRP gene, the present invention obtains transgenic plants with NbGRP knocked out. These transgenic plants can not only promote the infection of virus vectors but also promote plant growth, significantly increasing the expression yield of target proteins mediated by plant virus expression vectors, providing a new idea for the optimization of plant virus vector expression systems.

[0005] To achieve the above object, the technical solutions adopted by the present invention are specifically as follows:

[0006] Use of Nicotiana benthamiana NbGRP gene in improving the expression level of exogenous proteins mediated by plant viruses, wherein the plant virus is tobacco mosaic virus or potato virus X, and the transcript sequence of the NbGRP gene is shown as SEQ ID NO:1.

[0007] The specific method is as follows: By constructing a Nicotiana benthamiana NbGRP gene knockout vector, introducing the gene knockout vector into the target plant, obtaining a Nicotiana benthamiana plant with NbGRP gene mutation, and the mutant plant can promote plant growth and significantly enhance the infection of tobacco mosaic virus and potato virus X. The transgenic plant with NbGRP mutation can improve the expression level of green fluorescent protein mediated by tobacco mosaic virus and potato virus X vectors.

[0008] A method for cultivating a transgenic NbGRP plant, by constructing a Nicotiana benthamiana NbGRP gene knockout vector, introducing the gene knockout vector into the target plant, and obtaining a Nicotiana benthamiana plant with NbGRP gene mutation.

[0009] Among them, constructing a Nicotiana benthamiana NbGRP gene knockout vector means designing a gRNA targeting NbGRP at the PAM site near the coding region of the Nicotiana benthamiana NbGRP gene, constructing the pCambia1300 - BKG - g1 vector. After culturing the pretreated Nicotiana benthamiana leaves into callus on the medium, using the Agrobacterium - mediated T - DNA insertion method to introduce the gene knockout vector into Nicotiana benthamiana, obtaining a Nicotiana benthamiana plant with NbGRP gene mutation. The obtained Nicotiana benthamiana plant with NbGRP gene mutation can promote plant growth and significantly enhance the expression level of GFP mediated by TMV and PVX.

[0010] Specifically, it includes the following steps:

[0011] (1) Design a gRNA targeting NbGRP at the PAM site near the coding region of the Nicotiana benthamiana NbGRP gene, obtaining the gRNA sequence as shown in SEQ ID NO:2; design the complementary strand based on this sequence, synthesize primers, and form complementary double - strands after high - temperature annealing;

[0012] gRNA sequence: TGATTGCCCTCGGCACCCACCTCCG;

[0013] (2) Digest the BKG vector with the restriction endonuclease Eco31I, and recover the gel - cut product;

[0014] (3) Use T4 ligase to ligate the double - strand gRNA to the BKG vector;

[0015] (4) Add the mixed product to 100 μL of Escherichia coli competent cells, perform heat - shock transformation, culture at 37 °C for 1 h, then spread on the medium with corresponding resistance, and culture overnight at 37 °C;

[0016] (5) Positive single colonies were screened using primers M13-F and NbGRP-BKG-R. The positive clone plasmids were confirmed by sequencing to obtain positive recombinant plasmids. The sequences of M13-F and NbGRP-BKG-R are shown in SEQ ID NO:3 and SEQ ID NO:6, respectively.

[0017] M13-F: GTAAAACGACGGCCAGT

[0018] NbGRP-BKG-R: AAACCGGAGGTGGGTGCCGAGGGCA

[0019] (6) The recombinant plasmids were transformed into Agrobacterium competent cells and spread on the medium with corresponding resistance, and cultured at 28 °C.

[0020] (7) The pre-cultured Nicotiana benthamiana explants were infected, callus was obtained through differentiation culture, and then T0 generation seedlings were obtained through rooting culture and transferred to the soil for continuous culture.

[0021] (8) After the seedlings grew stably, leaf samples were taken and DNA was extracted using the CTAB method. Using the extracted DNA as a template, PCR amplification was performed using primers M13-F and gRNA-R to determine whether the exogenous CRISPR-Cas9 sequence was transferred into the plant. The sequence of gRNA-R is shown in SEQ ID NO:4.

[0022] Sequence of gRNA-R: TTGATATTTTTGGAGTAGACAAGTGTGTCG

[0023] (9) DNA was extracted from positive transgenic plants, and amplification was performed using primers NbGRP-BKG-F and NbGRP-BKG-R. Whether the target gene was edited was detected by sequencing. The edited lines were reserved for seed production, T1 generation seeds were screened on the corresponding resistance medium, and the positive seedlings were used for experiments. Among them, the sequences of NbGRP-BKG-F and NbGRP-BKG-R are shown in SEQ ID NO:5-6.

[0024] (10) Virus expression vectors carrying GFP such as TMV-GFP and PVX-GFP were inoculated into NbGRP mutant transgenic plants by the method of Agrobacterium infiltration. The fluorescence intensity of GFP was observed under ultraviolet light, and RNA and total protein of the systemic leaves of the inoculated plants were extracted, and the accumulation of virus RNA and GFP protein was analyzed by western blot.

[0025] Compared with the prior art, the outstanding effect of the present invention lies in:

[0026] (1) By knocking out the antiviral factor NbGRP in Nicotiana benthamiana, the present invention weakens the antiviral defense response of plants, significantly enhances the infection of TMV and PVX, and further improves the expression level of exogenous proteins such as GFP mediated by plant virus vectors.

[0027] (2) Different from the abnormal plant development caused by knocking out antiviral factors such as RDR6 in the prior art, no obvious developmental defects were observed in the present invention by knocking out the NbGRP gene. Instead, it promoted the growth of plants. This characteristic enables the mutant plants to enhance the biomass of plants while increasing the protein yield, which is beneficial to further reducing the production cost.

[0028] (3) The present invention is not only applicable to tobacco mosaic virus (TMV) and potato virus X (PVX), but also has the potential to be extended to other plant virus vector systems, providing a general platform for the production of vaccine antigens, therapeutic antibodies and bioactive proteins.

[0029] The following further describes the application of the NbGRP gene of Nicotiana benthamiana in the present invention in improving the expression level of exogenous proteins mediated by plant viruses and the method for cultivating transgenic plants in combination with the accompanying drawings and specific examples. Description of the Drawings

[0030] Figure 1 Schematic diagram for the construction of the NbGRP gene knockout vector and the growth phenotypes of transgenic plants: (A) Schematic diagram for the construction of the NbGRP gene knockout vector; (B) Gene editing sites of NbGRP; (C) Phenotypic comparison between the NbGRP knockout mutant and wild-type plants.

[0031] Figure 2 Effect of NbGRP gene knockout in Nicotiana benthamiana on enhancing the expression level of GFP mediated by TMV and PVX. (A) TMV-GFP and PVX-GFP were infiltrated and inoculated into wild-type Nicotiana benthamiana and NbGRP gene knockout plants, and virus accumulation in systemic leaves was observed under ultraviolet light irradiation on the 7th day; (B) Western blot analysis of the accumulation amount of virus proteins, WT is the wild-type Nicotiana benthamiana control, and Ponceau S is the analysis of the loading level. Detailed Embodiments

[0032] A method for cultivating NbGRP transgenic plants that improve the expression level of exogenous proteins mediated by plant virus vectors. By means of Agrobacterium transformation, a gene knockout vector carrying the NbGRP gene target is introduced into the target plant to obtain Nicotiana benthamiana plants with NbGRP gene editing. Among them, the transcript sequence of the NbGRP gene is shown in SEQ ID NO: 1.

[0033] Specifically, it includes the following steps:

[0034] (1) Design gRNA targeting NbGRP at the PAM site near the coding region of the NbGRP gene in Nicotiana benthamiana to obtain the gRNA sequence, as shown in SEQ ID NO:2; design the complementary strand based on this sequence and synthesize primers;

[0035] gRNA sequence: TGATTGCCCTCGGCACCCACCTCCG

[0036] (2) Use Annealing Buffer for DNA Oligos (D0251) from Beyotime to anneal the obtained primers to get double-stranded DNA. The specific steps are as follows:

[0037] ① Configure the NbGRP-BKG-F / R dry powder to 50 μM with ddH 2 O;

[0038] ② Configure the reaction system in a PCR tube:

[0039] <![CDATA[ddH 2 O]]> 4 μL Annealing Buffer for DNA Oligo 2 μL Oligo A 2 μL Oligo B 2 μL Total volume 10 μL

[0040] ③ React with a PCR instrument: 95 °C for 2 minutes; decrease by 0.1 °C every 8 seconds until it reaches 25 °C; store temporarily at 4 °C for 5 minutes;

[0041] (3) Digest the BKG vector with the restriction enzyme Eco31I, ligate it with the annealed product through T4 ligase, transfer it into DH5α Escherichia coli, perform heat shock transformation, after culturing at 37 °C for 1 h, spread the bacterial solution on a culture plate screened with kanamycin, and culture overnight at 37 °C; use primers M13-F (shown in SEQ ID NO:3) and NbGRP-BKG-R (shown in SEQ ID NO:6) to screen positive single colonies, confirm the positive clone plasmid by sequencing, and obtain the positive recombinant plasmid;

[0042] M13-F: GTAAAACGACGGCCAGT

[0043] NbGRP-BKG-R: AAACCGGAGGTGGGTGCCGAGGGCA

[0044] Schematic diagram of the construction of the NbGRP gene knockout vector (pCambia1300-BKG-g1 vector) is as shown in Figure 1 A;

[0045] (4) Add the recombinant plasmid to 100 μL of Agrobacterium competent cells, after electrotransformation, spread it on the corresponding resistant medium and culture at 28 °C;

[0046] (5) Infect tobacco leaves with Agrobacterium carrying the recombinant plasmid, obtain callus through differentiation culture, and then obtain T0 generation seedlings through rooting culture, and transfer them to the soil for continuous culture;

[0047] (6) After the seedlings grow stably, take leaf samples and extract DNA using the CTAB method; using the extracted DNA as a template, utilize primers M13-F and gRNA-R (shown in SEQ ID NO: 3-4) to perform PCR amplification to determine whether an exogenous CRISPR-Cas9 sequence has been transferred into the plant;

[0048] M13-F: GTAAAACGACGGCCAGT

[0049] gRNA-R: TTGATATTTTTGGAGTAGACAAGTGTGTCG

[0050] (7) Extract DNA from positive transgenic plants, perform amplification using primers NbGRP-BKG-F and NbGRP-BKG-R (shown in SEQ ID NO: 5-6), and confirm whether the target gene has been edited through sequence determination; save seeds from the edited lines, screen T1 generation seeds on the corresponding resistant medium, and use positive seedlings for experiments.

[0051] NbGRP-BKG-F: TGATTGCCCTCGGCACCCACCTCCG

[0052] NbGRP-BKG-R: AAACCGGAGGTGGGTGCCGAGGGCA

[0053] (8) Among the obtained positive editing materials, screen for Nicotiana benthamiana materials in which NbGRP has been edited. As Figure 1 shown in B, a 7-base deletion mutation occurred in the target sequence, named: Nbgrp-3.

[0054] (9) Obtain transgenic lines through screening, observe the effect of NbGRP knockout on the growth of Nicotiana benthamiana, indicating that the mutation of NbGRP promotes the growth of Nicotiana benthamiana ( Figure 1 C).

[0055] Infect wild-type Nicotiana benthamiana and Nicotiana benthamiana with NbGRP gene knockout with the infectious clones of tobacco mosaic virus with GFP fluorescence (TMV-GFP) and potato virus X with GFP fluorescence (PVX-GFP). On the 7th day after inoculation, observe the green fluorescence of the systemic leaves using a portable ultraviolet lamp, as Figure 2 shown in A, 2C; take samples from the same diseased part of different plants for western blot detection, and the results are as Figure 2 shown in B, 2D, and the accumulation amount of GFP protein in the NbGRP gene knockout lines is significantly higher than that in wild-type plants.

[0056] The embodiments described above are only descriptions of the preferred embodiments of the present invention and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. Application of Nicotiana benthamiana NbGRP gene in improving the expression level of exogenous protein mediated by plant viruses, characterized in that: The plant virus is tobacco mosaic virus or potato virus X, and the transcript sequence of the NbGRP gene is shown in SEQ ID NO:

1.

2. The use of the Nicotiana benthamiana NbGRP gene according to claim 1 in improving the expression level of exogenous proteins mediated by plant viruses, characterized in that: By constructing a Nicotiana benthamiana NbGRP gene knockout vector and introducing the gene knockout vector into a target plant, a Nicotiana benthamiana plant with a NbGRP gene mutation is obtained. The mutant plant can promote plant growth and significantly enhance the infection of tobacco mosaic virus and potato virus X, and improve the expression level of foreign proteins mediated by viral vectors.

3. The use of the Nicotiana benthamiana NbGRP gene in improving the expression level of exogenous proteins mediated by plant viruses according to claim 2, characterized in that: Transgenic plants with NbGRP mutations can increase the expression level of green fluorescent protein mediated by tobacco mosaic virus and potato virus X vectors.

4. A method for cultivating NbGRP transgenic plants, characterized in that: A Nicotiana benthamiana NbGRP gene knockout vector is constructed and introduced into a target plant to obtain a Nicotiana benthamiana plant with a NbGRP gene mutation.

5. The method for cultivating NbGRP transgenic plants according to claim 4, characterized in that: After the pretreated Nicotiana benthamiana leaves were cultured into callus on a culture medium, the gene knockout vector was introduced using the Agrobacterium-mediated T-DNA insertion method.

6. The method for cultivating NbGRP transgenic plants according to claim 5, characterized in that: A gRNA targeting NbGRP was designed at the PAM site near the coding region of the NbGRP gene of Nicotiana benthamiana, a pCambia1300-BKG-g1 vector was constructed, and the vector was introduced into plants using the Agrobacterium transformation method to obtain NbGRP gene mutant plants.

7. The method for cultivating NbGRP transgenic plants according to claim 6, characterized in that: The following steps are involved: (1) designing a gRNA targeting NbGRP at the PAM site near the coding region of the NbGRP gene of Nicotiana benthamiana to obtain a gRNA sequence as shown in SEQ ID NO: 2; using this sequence to design a complementary chain, synthesize primers, and form a complementary double chain after high temperature annealing; gRNA sequence: TGATTGCCCTCGGCACCCACCTCCG; (2) Digest the BKG vector with restriction endonuclease Eco31I and recover the fragment by gel excision; (3) Use T4 ligase to connect the double-stranded gRNA to the BKG vector; (4) Add the mixed product to 100 μL of competent E. coli, heat shock transformation, incubate at 37°C for 1 h, then spread on the corresponding resistance medium and incubate at 37°C overnight; (5) Using primers M13-F and NbGRP-BKG-R to screen positive single colonies, the positive clone plasmids were sequenced to confirm, and the positive recombinant plasmids were obtained; the sequences of M13-F and NbGRP-BKG-R are shown in SEQ ID NO: 3 and SEQ ID NO: 6; M13-F: GTAAAACGACGGCCAGT NbGRP-BKG-R: AAACCGGAGGTGGGTGCCGAGGGCA (6) Transform the recombinant plasmid into Agrobacterium competent cells, spread it on the corresponding resistance culture medium, and culture it at 28°C; (7) infecting pre-cultured Nicotiana benthamiana explants, obtaining callus tissue through differentiation culture, and then obtaining T0 generation seedlings through rooting culture, which were transferred to soil for further culture; (8) After the seedlings have grown stably, leaf samples are taken and DNA is extracted using the CTAB method; the extracted DNA is used as a template and PCR amplification is performed using primers M13-F and gRNA-R to determine whether the exogenous CRISPR-Cas9 sequence has been transferred into the plant; the gRNA-R sequence is shown in SEQ ID NO:4; gRNA-R sequence:TTGATATTTTTGGAGTAGACAAGTGTGTCG (9) DNA was extracted from the positive transgenic plants, and amplified using primers NbGRP-BKG-F and NbGRP-BKG-R. Whether the target gene was edited was detected by sequencing, the edited strains were kept as seeds, T1 generation seeds were screened on the corresponding resistance culture medium, and the positive seedlings were used for the experiment; wherein the sequences of NbGRP-BKG-F and NbGRP-BKG-R are shown in SEQ ID NO:5-6.

Images