Molecular marker linked to sex linkage of oyster, primer pair for detecting the molecular marker and application thereof

By providing the sex-linked molecular marker Chr9:8462525 and its primer pair for oysters, combined with PCR amplification and electrophoresis detection, the problem of detecting sex-linked markers in Fujian oysters was solved, enabling efficient and low-cost screening and cultivation of high-male oyster strains.

CN120060486BActive Publication Date: 2026-04-21FISHERIES RESEARCH INSTITURE OF FUJIAN +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
FISHERIES RESEARCH INSTITURE OF FUJIAN
Filing Date
2025-02-27
Publication Date
2026-04-21

AI Technical Summary

Technical Problem

Existing technologies are insufficient for effectively screening and cultivating Fujian oyster strains with a high male ratio, and there is a lack of rapid, low-cost methods for detecting sex-linked molecular markers.

Method used

A sex-linked molecular marker Chr9:8462525 for oysters and its detection primer pair are provided. The number and size of the amplified bands are detected by PCR amplification and electrophoresis, which enables the prediction of sex and screening of male-linked alleles in Fujian oysters.

Benefits of technology

It enables rapid and low-cost screening and aggregation of male-linked alleles, increasing the proportion of male individuals in the breeding population and promoting the development of high-male strains.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120060486B_ABST
    Figure CN120060486B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of molecular marker assisted breeding, and particularly relates to a molecular marker linked to the sex of oyster, a primer pair for detecting the molecular marker and application. The molecular marker is an InDel marker Chr9:8462525, the nucleic acid sequence of which is shown in SEQ ID NO:1, and the primer pair for detecting the molecular marker has nucleotide sequences shown in SEQ ID NO:2 and SEQ ID NO:3. The sex of oyster can be predicted by detecting the molecular marker, and male linkage alleles can be screened, which can be realized by PCR amplification and electrophoresis, and has important application value in breeding unisexual oyster varieties or strains.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular marker-assisted breeding technology, and in particular to a sex-linked molecular marker for oysters, primer pairs for detecting the molecular marker, and their applications. Background Technology

[0002] Oysters are the most widely farmed marine shellfish in my country, possessing significant edible and economic value. Among them, the Fujian oyster, due to its rapid growth and excellent edible value, has become one of the important economically farmed species. The growth and nutritional composition of Fujian oysters exhibit sexual dimorphism, with males showing significantly superior nutritional value and plumpness compared to females. Therefore, cultivating high-male strains has potential application value.

[0003] Since the 1970s, researchers have focused on the genetic factors regulating sex determination in oysters. In half-sib families of the American oyster and the Pacific oyster, the paternal effect of sex traits was observed, leading to the development of both the "three-locus model" and the "single-locus model" for sex determination. In two independent studies, one based on microsatellite markers and the other on GBS sequencing, single major sex QTLs were identified in the Pacific oyster. These preliminary studies all indicate that genetic factors play a crucial role in sex determination in oysters.

[0004] Therefore, developing a sex-linked marker and a simple method for detecting the genotype of this marker is key to aggregating male-linked alleles and breeding monosex oyster strains. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a sex-linked molecular marker for oysters, a primer pair for detecting the molecular marker, and its application.

[0006] This invention is implemented as follows:

[0007] The present invention first provides a sex-linked molecular marker for oysters, the molecular marker being the InDel marker Chr9:8462525; the nucleic acid sequence of the Chr9:8462525 molecular marker is shown in SEQ ID NO:1.

[0008] The present invention also provides primer pairs for detecting the molecular marker, the nucleotide sequences of which are shown in SEQ ID NO:2 and SEQ ID NO:3.

[0009] Finally, the present invention provides applications of the aforementioned molecular markers, namely the following a At least one of c:

[0010] a. Used for predicting the sex of oysters;

[0011] b. Used for screening individuals containing male-linked alleles;

[0012] c. Used for breeding monosex oyster strains or varieties.

[0013] Furthermore, the oyster is the Fujian oyster.

[0014] Further, the screening described in step b includes the following steps: (1) extraction of oyster DNA;

[0015] (2) PCR analysis was performed using primer pairs;

[0016] (3) Use electrophoresis to detect PCR amplification products to determine whether the oyster sample to be tested contains male-linked alleles.

[0017] Furthermore, the primer pair described in step (2) has nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:3.

[0018] Furthermore, using the genomic DNA of the Fujian oyster to be tested as a template, PCR amplification was performed using the primer pairs shown in SEQ ID NO:2 and SEQ ID NO:3. The amplification products were detected, and the results are as follows:

[0019] When the amplification product is a single 224bp band, the sample being tested contains homozygous individuals with 0 male-linked alleles, indicating a sex predominance towards females.

[0020] When the amplification product contains two bands, 224bp and 211bp, the Fujian oyster sample to be tested is a heterozygote containing one male-linked allele, and its sex is biased towards male.

[0021] When the amplification product is a single band of 211 bp, the sample to be tested is a homozygote containing two male-linked alleles, and the sex is biased towards male.

[0022] Furthermore, the PCR system for the PCR analysis described in step (2) is 10 μL, including 5 μL of 2 × PCR Mix, 0.4 μL each of forward and reverse primers, 0.5 μL of genomic DNA, and 3.7 μL of sterile double-distilled water; reaction conditions: pre-denaturation at 94℃ for 2 minutes; then denaturation at 94℃ for 30 seconds, annealing at Tm for 30 seconds, extension at 72℃ for 1 minute, for a total of 30 cycles, and finally extension at 72℃ for 5 minutes.

[0023] The present invention has the following advantages:

[0024] (1) This invention provides a molecular marker Chr9:8462525 that is closely linked to the sex phenotype of the Fujian oyster.

[0025] (2) By detecting the molecular markers of the present invention, heterozygotes or homozygotes containing male-linked alleles can be screened, thereby purposefully aggregating male-linked alleles, which can increase the proportion of male individuals in the culture population and has important application value for accelerating the breeding process of high-male oyster strains in Fujian.

[0026] (3) The molecular markers of the present invention can be detected by PCR amplification and electrophoresis. The number and size of the amplified bands can be detected. It can be operated with conventional instruments and has the characteristics of being fast, efficient and low cost. Attached Figure Description

[0027] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0028] Figure 1 Location of sex-associated loci in the Fujian oyster. A. Results of genome-wide association analysis of sex phenotype in Fujian oyster based on InDel, -log10(P) = 7.476; B. Genetic differentiation index (FST) of InDel in the whole genome of female and male Fujian oysters; C. Distribution map of InDel sex dimorphism in the whole genome, with a window size of 10kb.

[0029] Figure 2 The image shows the genotyping results for nine individuals with known genotypes, where 00 represents genotype 0 / 0, 01 represents genotype 0 / 1, and 11 represents genotype 1 / 1. Detailed Implementation

[0030] The technical solution of the present invention will now be clearly and completely described in conjunction with the accompanying drawings and specific embodiments. Unless otherwise specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all commercially available products. The following embodiments are merely illustrative of the present invention and are not intended to limit the scope of the invention in any way.

[0031] In the following examples, the molecular marker Chr9:8462525 was obtained in the following manner:

[0032] Sexually mature samples were randomly collected from a 1-year-old “Fuli No. 1” Fujian oyster farming population in Jiangkou Bay, Fujian Province, for the purpose of locating sex determination sites.

[0033] The phenotypic sex of the samples was determined by observing gamete morphology under a microscope. Fifty-seven female oysters and fifty-five male oysters were selected from one-year-old Fujian oysters and sent to the company for genome resequencing.

[0034] Three methods were used to identify InDel candidates with gender associations:

[0035] 1) Genome-wide association analysis (GWAS): A genome-wide association analysis (GWAS) was performed on 112 sex traits of the Fujian oyster, identifying 192 InDels significantly associated with sex, all located on chromosome 9. Figure 1 (A)

[0036] 2) Genome-wide sex-specific genetic differentiation index (FST) estimation: The samples were divided into female and male populations according to sex. The FST was calculated for the InDel loci across the entire genome. A total of 167 highly differentiated InDel loci (FST>0.25) were identified, all located on chromosome 9. Figure 1 (B)

[0037] 3) Genome-wide distribution of sex-dimorphic InDel loci: Based on the above resequencing data, InDel loci with sex-dimorphic genotypes were detected: that is, loci in female samples that were homozygous (0 / 0), while male samples were heterozygous (0 / 1 or 1 / 0) or another homozygous type (1 / 1). A total of 78 sex-dimorphic InDels were screened, all located on chromosome 9. Figure 1 (C)

[0038] Based on the combined screening results of GWAS significant loci, sex-differentiated loci, and sex-dimorphic InDel loci, a total of 4 candidate sex-associated InDels were selected.

[0039] Furthermore, by analyzing the correspondence between phenotype and genotype, the marker Chr9:8462525, which is closely linked to phenotype sex, was obtained.

[0040] Example 1

[0041] A molecular marker closely linked to sex in oysters, the molecular marker being Chr9:8462525. The nucleic acid sequence of Chr9:8462525 is shown in SEQ ID NO:1.

[0042] SEQ ID NO:1 (5'→3')

[0043] GTAGGTGCTTTAG

[0044] The nucleic acid sequences of the primers used to detect the above molecular markers are shown in SEQ ID NO:2 and SEQ ID NO:3.

[0045] Chr9: 8462525 F: 5' CAGTAATTAAGAGGGAATAACACAG 3' (SEQ ID NO:2);

[0046] Chr9: 8462525 R: 5' ACCCTTGCGTTAGAAATTCAT 3' (SEQ ID NO:3).

[0047] Using oyster genomic DNA as a template, amplification was performed using primers that detect the Chr9:8462525 molecular marker. When the amplification product is a single band of 224 bp (SEQ ID NO:4) and the genotype is recorded as 0 / 0, the genetic sex of the Fujian oyster sample to be tested is biased towards female.

[0048] When the amplification product has two bands, 224bp (SEQ ID NO:4) and 211bp (SEQ ID NO:5), the genotype is recorded as 0 / 1, indicating that the sex of the Fujian oyster sample being tested is male.

[0049] If the amplification product is a single band of 211bp (SEQ ID NO:5), the genotype is 1 / 1, and the sex of the Fujian oyster sample to be tested is biased towards male.

[0050] SEQ ID NO:4 (5'→3')

[0051] 5' ACCCTTGCGTTAGAAATTCATTTTTGACTTGCATTCTTTAAATATGATTTGTCTTCTCTGTATTCTAAGATTTCCCTTTCCTAAAGCACCTACTTGTTCCACTTTTTAAAGCACATAAATATATGCCACCGCATGGGAGTAGTAACGAATGTCTCTTCACTTTTCATTCGACACAAAAAACCAAAAACAGAGCTGTCTGTGTTATTCCCTCTTAATTACTG 3'

[0052] SEQ ID NO:5 (5'→3')

[0053] 5' ACCCTTGCGTTAGAAATTCATTTTTGACTTGCATTCTTTAAATATGATTTGTCTTCTCTGTATTCTAAGATTTCCCTTTTCTTGTTCCACTTTTTAAAGCACATAAATATATGCCACCGCATGGGAGTAGTAACGAATGTCTCTTCACTTTTCATTCGACACAAAAAACCAAAAACAGAGCTGTCTGTGTTATTCCCTCTTAATTACTG 3'

[0054] Example 2

[0055] (1) Extraction of genomic DNA from oyster samples:

[0056] Based on three oyster samples with known genotypes of 0 / 0, 0 / 1, and 1 / 1 obtained through resequencing, adductor muscle samples were taken, and oyster genomic DNA was extracted using the CTAB method or other existing methods. The DNA was dissolved in 50 μL of sterile water, and the concentration and quality of the DNA were detected by spectrophotometry and gel electrophoresis.

[0057] (2) Using the extracted genomic DNA as a template, PCR detection was performed using primers for detecting the Chr9:8462525 molecular marker; the nucleic acid sequences of the primers for detecting the Chr9:8462525 molecular marker are shown in SEQ ID NO:2 and SEQ ID NO:3.

[0058] The PCR system for PCR analysis was 10 μL, including 5 μL of 2 × PCR Mix, 0.4 μL each of forward and reverse primers, 0.5 μL of genomic DNA, and 3.7 μL of sterile double-distilled water;

[0059] The PCR reaction procedure was as follows: pre-denaturation at 94℃ for 2 minutes; then denaturation at 94℃ for 30 seconds, annealing at Tm for 30 seconds, extension at 72℃ for 1 minute, for a total of 30 cycles, and finally extension at 72℃ for 5 minutes.

[0060] (3) The PCR amplification products were subjected to 3% agarose gel electrophoresis containing DNA fluorescent dye. After the electrophoresis was completed, the detection results were photographed.

[0061] The amplification products of the three individuals with genotype 0 / 0 were all single bands of 224 bp (SEQ ID NO:5). Figure 2 The phenotypic sex is female.

[0062] The amplification products of the three individuals with genotypes 0 and 1 all contained two bands: 224 bp (SEQ ID NO:4) and 211 bp (SEQ ID NO:5). Figure 2 The phenotypic sex is male.

[0063] The amplification products of the three individuals with genotype 1 / 1 were all 211bp (SEQ ID NO:5) single bands. Figure 2 The phenotypic sex is male.

[0064] Example 3

[0065] Using 60 oysters as test samples, genomic DNA was extracted from the test samples. Using this DNA as a template, the Chr9:8462525 molecular marker of the test oyster samples was detected by the method in Example 2 to obtain the genotypes of different oyster samples.

[0066] When the amplification product is a single band of 224bp (SEQ ID NO:4), the genotype is recorded as 0 / 0.

[0067] When the amplification product has two bands, 224bp (SEQ ID NO:4) and 211bp (SEQ ID NO:5), the genotype is recorded as 0 / 1.

[0068] If the amplification product is a single band of 211bp (SEQ ID NO:5), the genotype is recorded as 1 / 1.

[0069] The phenotypic sex of the samples was determined by microscopic observation and gamete morphology. The genotypes and phenotypes are shown in Table 1 below. The χ² test showed that the association was significant (P = 8.35821 × 10⁻⁸).

[0070] Table 1 Comparison of Chr9:8462525 molecular marker genotypes and phenotypes

[0071]

[0072] Example 4

[0073] Samples were collected from the Fuli No. 1 Fujian oyster farming population and tested using the method described in Example 2. The molecular marker Chr9:8462525 was detected. Individuals with a male phenotype and a single 211bp band on electrophoresis were selected as the male parent (SEQ ID NO:5), and individuals with a female phenotype and two bands on electrophoresis, 224bp (SEQ ID NO:4) and 211bp (SEQ ID NO:5), were selected as the female parent. Five families were constructed, and the proportion of male individuals in the offspring was more than 85% in all cases.

[0074] While specific embodiments of the present invention have been described above, those skilled in the art should understand that the specific embodiments described are merely illustrative and not intended to limit the scope of the present invention. Equivalent modifications and variations made by those skilled in the art in accordance with the spirit of the present invention should be covered within the scope of protection of the claims of the present invention.

Claims

1. A primer pair for detecting a molecular marker linked to the sex of Crassostrea gigas, characterized in that: Its nucleotide sequence is shown in SEQ ID NO:2 and SEQ ID NO:3, and the molecular marker is an InDel marker; After amplification using primers for detecting molecular markers, if the amplification product is a single band of SEQ ID NO:4 and the genotype is recorded as 0 / 0, then the genetic sex of the Fujian oyster sample to be tested is biased towards female. When the amplification product consists of two bands, SEQ ID NO:4 and SEQ ID NO:5, the genotype is recorded as 0 / 1, indicating that the sex of the Fujian oyster sample being tested is predominantly male. When the amplification product is a single band of SEQ ID NO:5 and the genotype is 1 / 1, the sex of the Fujian oyster sample to be tested is biased towards male.

2. Use of a primer pair according to claim 1, characterized in that: Used to screen for individuals containing male-linked alleles; The screening process includes the following steps: (1) Extraction of oyster DNA; the oysters were Fujian oysters; (2) PCR analysis was performed using primer pairs; (3) Electrophoresis was used to detect the PCR amplification products to determine whether the oyster sample to be tested contained male-linked alleles. The result of the judgment in step (3) is as follows: When the amplification product is a single band of 224 bp, the sample to be tested contains homozygotes of 0 male-linked alleles, and the sex is biased towards female. When the amplification product consists of two bands, 224bp and 211bp, the Fujian oyster sample to be tested is a heterozygote containing one male-linked allele, and its sex is biased towards male. If the amplification product is a single 211bp band, the sample to be tested is a homozygous sample containing two male-linked alleles, and the sex is biased towards male.

3. Use according to claim 2, characterized in that: The PCR system for the PCR analysis in step (2) is 10 μL, including 5 μL of 2×PCR Mix, 0.4 μL each of forward and reverse primers, 0.5 μL of genomic DNA, and 3.7 μL of sterile double-distilled water; reaction conditions: 94℃ pre-denaturation for 2 minutes; then 94℃ denaturation for 30 seconds, Tm annealing for 30 seconds, 72℃ extension for 1 minute, for a total of 30 cycles, and finally 72℃ extension for 5 minutes.