Primer pair and kit for detecting Bursteobacterium trehalose

Abstract

The invention discloses a primer pair and a kit for detecting Bursteobacterium trehalose, and belongs to the technical field of pathogenic microorganism detection. The invention aims at solving the technical problem of improving the sensitivity and the specificity of detecting the Bursteobacterium trehalose. The invention provides a primer pair for detecting Bibersteinia trehalosi, and the primer pair is shown as SEQ ID NO. 1 and SEQ ID NO. 2. The invention also provides a kit for detecting the Bibersteinia trehalosi, and the kit for detecting the Bibersteinia trehalosi and the kit for detecting the Bibersteinia trehalosi. The detection method provided by the invention is very stable in inter-batch repetition and intra-batch repetition, and is suitable for clinical large-scale detection.

Description

Technical Field

[0001] The present invention belongs to the technical field of pathogenic microorganism detection, and particularly relates to a primer pair and a kit for detecting Bibersteinia trehalosi. Background Art

[0002] Bibersteinia trehalosi (B. trehalosi) is a Gram-negative pathogenic bacterium that causes respiratory diseases in ruminants, mainly infecting sheep, goats, and cattle. This bacterium was formerly classified in the genus Mannheimia of the family Pasteurellaceae, as biotype T. Later, based on phylogenetic studies, in 2007, this bacterium was reclassified as the genus Bibersteinia of the family Pasteurellaceae. In recent years, this bacterium has received extensive attention worldwide. It often colonizes the upper respiratory tract of healthy ruminants. When the body's immunity is low, this bacterium can cause severe respiratory diseases, and its clinical symptoms mainly include fever, loss of appetite, mental depression, repeated coughing, and often secretions from the eyes and nose. It is worth noting that Bibersteinia trehalosi can also be a zoonotic bacterium, which can cause brain abscesses, facial carbuncles, urinary tract infections, and lung infections in humans.

[0003] The conventional methods for detecting Bibersteinia trehalosi are using enzyme-linked immunosorbent assay or microbiological methods, but there are problems such as low detection sensitivity, low specificity, and long time. Summary of the Invention

[0004] The purpose of the present invention is to solve the technical problems of improving the sensitivity and specificity of detecting Bibersteinia trehalosi.

[0005] The present invention provides a primer pair for detecting Bibersteinia trehalosi, and the primer pair is shown as SEQ ID NO.1 and SEQ ID NO.2.

[0006] The present invention provides a kit for detecting Bibersteinia trehalosi, and the kit includes the primer pair according to claim 1 and a fluorescent probe shown as SEQ ID NO.3.

[0007] Further defined, the concentration of the primer pair is 10 μM.

[0008] Further defined, the concentration of the probe is 10 μM.

[0009] Further defined, the system of the kit further includes 2xOne Stepu Mix, One StepU EnzymeMIX, ROX II reference dye, positive control, and negative control.

[0010] Further defined, the positive control is a recombinant vector containing the nucleic acid molecule shown in SEQ ID NO.4, and the negative control is water.

[0011] Further defined, the fluorescence quantitative PCR system is 10 μL, including 2.7 μL of water, 5 μL of 2xOne Stepu Mix, 0.5 μL of One StepU Enzyme MIX, 0.2 μL each of Bt-F, Bt-R, and Bt-P, 0.2 μL of ROX II reference dye, and 1 μL of template.

[0012] The present invention provides an application of the above primer pair in the preparation of a kit for detecting Bibersteinia trehalosi.

[0013] The present invention provides an application of the nucleic acid molecule shown in SEQ ID NO.4 as a marker for detecting Bibersteinia trehalosi.

[0014] Further defined, the primer sequences for amplifying SEQ ID NO.4 are shown in SEQ ID NO.1 and SEQ ID NO.2.

[0015] Beneficial effects: (1) The detection primer set of the present invention is designed based on the conserved gene sequence of Bibersteinia trehalosi. Using this primer set to detect Pasteurella multocida, Mannheimia haemolytica, Haemophilus somnus, Mycoplasma ovipneumoniae, and Mycoplasma capricolum subsp. capripneumoniae, no bands were amplified, indicating that the primer set has strong specificity.

[0016] (2) The present invention has high detection sensitivity for Bibersteinia trehalosi, reaching 10 copies / μL of genome and 8.7 cfu / mL of Bibersteinia trehalosi.

[0017] (3) The detection method of the present invention is significantly better than the conventional PCR method, improving the detection sensitivity.

[0018] (4) The detection method of the present invention is very stable in both inter-batch and intra-batch repetitions, and is suitable for large-scale clinical detection. Description of the Drawings

[0019] Figure 1 It is a graph of the amplification curve results of fluorescence quantitative PCR for B. trehalosi;

[0020] Figure 2 It is a graph of the standard curve results of fluorescence quantitative PCR for B. trehalosi;

[0021] Figure 3 It is a graph of the specificity test results of fluorescence quantitative PCR for B. trehalosi. Detailed implementation manners

[0022] To make the objectives, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Apparently, the described embodiments are some but not all of the embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0023] Test materials used in the embodiments:

[0024] The plasmid extraction kit is Gene JET Plasmid Mini prep Kit (Thermo Scientific), the gel extraction kit is Gene JET Gel Extraction Kit (Thermo Scientific), the DNA extraction kit EasyPure Viral DNA / RNA Kit (ER201) is purchased from Beijing TransGen Biotech Co., Ltd., and the HiScript II OneStep qRT-PCR Probe Kit (Q223) is purchased from Novoprotein Scientific Inc.

[0025] Example 1: Establishment of fluorescence quantitative PCR for B. trehalosi

[0026] 1. Design of fluorescence quantitative PCR primers and probes for B. trehalosi.

[0027] The gene sequence is shown in SEQ ID NO.4. Then, according to the determined gene sequence, quantitative PCR amplification primers are designed, and probe primers are designed in the middle of the designed amplification primers. The sequences of the quantitative PCR primers and probes are as follows:

[0028] Table 1. Primer and probe sequences

[0029]

[0030] 2. Preparation of fluorescence quantitative PCR plasmid standard for B. trehalosi.

[0031] (1) Amplification of target fragment

[0032] Use the EasyPure Viral DNA / RNA Kit to extract the bacterial genome respectively. Using the bacterial genome as a template, with the above primers, according to a 10 μL PCR system (2×Taq PCR Mix 5 μL, 1 μL of 10 μM upstream and downstream primers each, 1 μL of bacterial DNA, and ddH 2The target fragment was amplified with 2.7 μL of O (the amplification conditions were: 95°C for 5 min; 95°C for 30 s, 53°C for 30 s, 72°C for 30 s, for 35 cycles; 72°C for 10 min; 4°C for 30 min). After amplification, the PCR products were detected and analyzed by 1% agarose gel electrophoresis, and the target fragment was purified using a gel extraction kit.

[0033] The amplified target fragment sequence of B. trehalosi was SEQ ID NO.4:

[0034] AGAAAGGTAATGAGCCAAGAATAACAAGAGTCAACTTCGGACTGTAATACCACAT CACGGCAAAGAAGATAAAAGAGAATAATAAATCTAGAACAGAAGTTAATGCTTGC.

[0035] (2) Ligation and transformation

[0036] The above gel-extracted product was ligated to the pMD18-T vector (TaKaRa), and the ligation product was added to DH5α competent cells (ice bath for 30 min; heat shock at 42°C for 90 s; ice bath for 2 min). The bacterial solution was transferred to a non-resistant LB medium and cultured with shaking at 37°C and 200 rpm for 45 min. 50 μL of the bacterial solution was evenly spread on an LB culture plate containing ampicillin and cultured overnight at 37°C.

[0037] (3) Screening and identification of positive clones

[0038] Single colonies on the LB culture plate were picked and added to 5 mL of LB medium with ampicillin resistance and cultured with shaking at 37°C and 200 rpm for 12 h. Using the corresponding primers, bacterial liquid PCR verification (amplifying the corresponding target fragment) and sequencing were performed, and the plasmid was extracted using a plasmid DNA miniprep kit for standby. The correctly identified positive recombinant plasmid was named pMD-Bt. The plasmid concentration was measured using a NanoDrop instrument, and the concentration of the pMD-Bt recombinant plasmid was 431 ng / μL. The copy number of the recombinant plasmid was calculated by the formula to be 1.40×10 11 copies / μL, and these were used as plasmid standards respectively.

[0039] The formula for calculating the copy number is as follows: Copy number = plasmid concentration × 6.02×10 23 / (660 × total plasmid length).

[0040] 3. Fluorescent quantitative PCR method for B. trehalosi.

[0041] Extract the sample DNA using the EasyPure Viral DNA / RNA Kit, and perform fluorescence quantitative PCR using the HiScripto II U OneStep qRT-PCR Probe Kit. The reaction system is 10 μL, including 2.7 μL of water, 5 μL of 2×One StepU Mix, 1 μL of One StepU Enzyme MIX, 0.2 μL of each upstream and downstream primer, 0.2 μL of the probe, 0.2 μL of ROX II reference dye, and 1 μL of the template. The fluorescence quantitative PCR reaction program is as follows: 95°C for 5 min; 95°C for 10 s, 53°C for 30 s, for 45 cycles.

[0042] To draw the standard curve of single fluorescence quantitative PCR amplification, serially dilute the plasmid standard 10-fold (take 10 1 、10 2 、10 3 、10 4 、10 5 、10 6 、10 7 copies / μL, 7 dilution factors) as the template for amplification. At the same time, set up a negative control, and perform the fluorescence quantitative PCR reaction on the Applied Biosystems QuantStudio 5 real-time fluorescence quantitative PCR instrument to obtain the amplification curve. The software analyzes its correlation coefficient R 2 is: 1.000, showing a good linear relationship and meeting the requirements of the standard curve (R 2 > 0.99). The established standard curve is shown in Figure 1 and Figure 2 as follows. B.trehalosi: Y = -3.256log(X) + 39.761 R 2 = 1.000 Eff% = 102.818%

[0043] (1) Sensitivity test:

[0044] Serial dilute the B.trehalosi bacterial solution 10-fold and perform fluorescence quantitative PCR. The lowest detectable amount of B.trehalosi is 8.7 cfu / mL. In contrast, conventional PCR can only detect 330.8 cfu / mL. The results show that the sensitivity of B.trehalosi fluorescence quantitative PCR is 38 times higher than that of conventional PCR and can be used for the detection of clinical samples.

[0045] (2) Specificity test:

[0046] Using the B. trehalosi standard as a positive control, DNA was extracted from Pasteurella multocida, Mannheimia haemolytica, Histophilus somni, Salmonella, Clostridium perfringens, Escherichia coli K99, and water as samples and used as templates for fluorescence quantitative PCR. According to the established optimal reaction conditions, fluorescence quantitative PCR amplification was performed. The results are as follows Figure 3 shown. The amplification curve could be detected for the standard, while no amplification curves appeared for the other pathogens and the negative control, indicating that this method has good specificity.

[0047] (3) Repeatability test:

[0048] The B. trehalosi recombinant plasmid was serially diluted 10-fold and mixed in equal proportions. Three concentration gradients (final concentrations of 10 6 copies / μL, 10 4 copies / μL, and 10 2 copies / μL) of the plasmid mixture were taken, and water was set as the negative control. The established fluorescence quantitative PCR method was used to repeat the detection 3 times for the within-group repeatability test; the standard products of the same concentration diluted at different time intervals were used for the between-group repeatability test. The test results were statistically analyzed to evaluate the repeatability of this method. The results are shown in Table 2. As can be seen from Table 2, the within-group coefficient of variation was less than 2%, and the between-group coefficient of variation was less than 2%, indicating that the single fluorescence quantitative detection method established in the present invention has good repeatability.

[0049] Table 2 Repeatability results of single fluorescence quantitative PCR

[0050]

[0051]

[0052] Example 2: Detection of clinical samples

[0053] Using the established fluorescence quantitative PCR method for B. trehalosi, a total of 393 clinical samples of sheep respiratory diseases collected from 6 regions were detected. The DNA of the samples was extracted using the EasyPure Viral DNA / RNA Kit, and fluorescence quantitative PCR was performed using the HiScript II One Step qRT-PCR Probe Kit. The reaction system was 10 μL, including 2.7 μL of water, 5 μL of 2×One StepU Mix, 1 μL of One StepU Enzyme MIX, 0.2 μL of each upstream and downstream primer, 0.2 μL of the probe, 0.2 μL of ROX II reference dye, and 1 μL of the sample template. The fluorescence quantitative PCR reaction program was: 95°C for 5 min; 95°C for 10 s, 53°C for 30 s, for 45 cycles. Analysis of the fluorescence quantitative PCR amplification curve and Ct value showed (Table 3) that B. trehalosi was prevalent in all 6 regions, with an overall positive rate of 9.67%. The positive rate in Heilongjiang was the highest, reaching 18.33%, indicating that B. trehalosi poses a serious threat to the aquaculture industry in China. A sensitive and specific detection method provides an important means for the prevention and control of the pathogen.

[0054] Table 3 Detection results of clinical samples from different regions

[0055] Province / Autonomous Region Total number of samples Number of positive samples Positive rate of B.trehalosi Heilongjiang 60 11 18.33％ Jiangsu 55 3 5.45％ Liaoning 80 6 7.50％ Shandong 70 6 8.57％ Hunan 50 8 16.00％ Xinjiang 78 4 5.13％ Total 393 38 9.67％

[0056] Example 3. Identification of markers for B. trehalosi

[0057] The target fragment sequence is SEQ ID NO.4: AGAAAGGTAATGAGCCAAGAATAACAAGAGTCAACTTCGGACTGTAATACCACATCAC GGCAAAGAAGATAAAAGAGAATAATAAATCTAGAACAGAAGTTAATGCTTGC; as a marker, detecting its presence or absence can obtain the result of identifying the presence or absence of B. trehalosi. If the sample to be identified contains SEQ ID NO.4, it proves that the sample contains B. trehalosi.

Claims

1. A primer pair for detecting Bibersteinia trehalosi, characterized in that: The primer pair is shown as SEQ ID NO.1 and SEQ ID NO.

2.

2. A kit for detecting Bacillus trehalose, characterized in that: The kit comprises the primer pair according to claim 1 and a fluorescent probe as shown in SEQ ID NO.

3.

3. The kit according to claim 2, characterized in that The concentration of the primer pair was 10 μM.

4. The kit according to claim 2, characterized in that The concentration of the probe was 10 μM.

5. The kit according to claim 2, characterized in that The system of the kit also includes 2xOne StepuMix, One StepU Enzyme MIX, ROX II reference dye, positive control and negative control.

6. The kit according to claim 5, characterized in that The positive control was a recombinant vector containing the nucleic acid molecule shown in SEQ ID NO.4, and the negative control was water.

7. The kit according to claim 2, characterized in that The fluorescence quantitative PCR system is 10 μL, including 2.7 μL of water, 5 μL of 2xOne Stepu Mix, 0.5 μL of One StepU Enzyme MIX, 0.2 μL each of Bt-F, Bt-R, and Bt-P, 0.2 μL of ROX II reference dye, and 1 μL of template.

8. Use of the primer pair according to claim 1 in preparing a kit for detecting Bacillus trehalose.

9. Use of the nucleic acid molecule represented by SEQ ID NO.4 as a marker for detecting Bibersteinia trehalosi.

10. The use according to claim 9, characterized in that: The primer sequences for amplifying SEQ ID NO.4 are shown in SEQ ID NO.1 and SEQ ID NO.2.

Images