Specific detection target of pythium deodarum, LAMP primer composition and application of LAMP primer composition
By discovering the specific detection of target genes of Pythium cedar and designing LAMP primer compositions, LAMP kits and methods for detecting Pythium cedar were developed, which solved the problem of difficulty in detecting Pythium cedar in the prior art and achieved rapid and accurate detection results.
Patent Information
- Application Number
- CN202510150415.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-11
- Publication Date
- 2025-05-30
- Estimated Expiration
- 2045-02-11
AI Technical Summary
There is a lack of effective detection methods in the prior art to quickly and accurately detect Pythium cedri, resulting in difficulties in early diagnosis and disease control.
By discovering specific detection of target genes, such as Pc_s135192, Pc_s460833, Pc_s103050, PcPL3_2 and Pc_s376271, and designing corresponding LAMP primer compositions, LAMP kits and methods for detecting Pythium cedaria were developed.
It has achieved rapid, efficient, strong specificity and high accuracy detection of Pythium cedar, and can identify Pythium cedar when the DNA concentration reaches 100pg·μL-1, which is suitable for basic testing and diagnosis.
Smart Images

Figure CN120060528A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to a specific detection target of Pythium cedarii, a LAMP primer composition and application thereof, and belongs to the field of biotechnology detection. Background Art
[0002] Pythium is a major plant pathogen belonging to the phylum Oomycota, order Peronosporales, and family Pythiaceae. It parasitizes freshwater algae and saprophytic species in moist garden and greenhouse soils, often causing root rot and damping-off in crop seedlings. Its mycelium reproduces in large numbers, forming a cottony, branched, unseptate, and multinucleate form. For example, the most common Pythium aphanidermatum infects approximately 100 cultivated plant species, including melons, beans, and cotton and linen, causing various rots and damping-off diseases, resulting in significant economic losses.
[0003] Pythium cedri, a species of the genus Pythium, was first isolated and reported in Jiangsu in 2017. It can infect cedar roots, causing symptoms such as root rot and damping-off. Currently, there are few detection technologies for Pythium cedri. Traditional plate isolation and identification methods are time-consuming and labor-intensive, requiring extensive identification experience on the part of the identification personnel, making them unsuitable for grassroots use. Loop-mediated isothermal amplification (LAMP), a new nucleic acid amplification technology proposed by Notomi et al. in 2000, has been widely used in the fields of pathogen detection and infectious disease diagnosis, showing promising application prospects. This technology has been widely used in the detection and research of oomycete pathogens. Its greatest advantages are its fast reaction speed, simple equipment, and easy identification results, making it particularly suitable for grassroots inspection and quarantine agencies and medical institutions. To date, there have been no reports on the use of LAMP technology for the detection of Pythium cedri at home and abroad.
[0004] The core of all current detection methods is the identification of target genes with high specificity. The specificity and sensitivity of different target sequences vary considerably, and results can vary significantly depending on the target sequence and fragment size. Target genes must be selected to ensure high conservedness across strains within a species, while exhibiting high interspecies variability.
[0005] In summary, discovering highly reliable and specific molecular detection targets and establishing a sensitive and accurate detection technology system based on new targets plays an important role in improving the rapid molecular detection research of cedar rot and the early diagnosis of diseases caused by it during detection. Summary of the Invention
[0006] Purpose of the invention: The purpose of the present invention is to provide a specific detection target for Pythium cedri, as well as a primer composition and application for detecting the target.
[0007] Technical solution: The present invention provides a specific detection target for Pythium cedri, which includes one or more of the nucleotide sequence Pc_s135192 shown in SEQ ID NO.1, the nucleotide sequence Pc_s460833 shown in SEQ ID NO.7, the nucleotide sequence Pc_s103050 shown in SEQ ID NO.13, the nucleotide sequence PcPL3_2 shown in SEQ ID NO.20, or the nucleotide sequence Pc_s376271 shown in SEQ ID NO.27.
[0008] SEQ ID NO.1: aacacgattggctgcaagaagggtggcgttggccacgtgacgcatgtcaaggctggtgcgaacatcccagtgcgttactaccg taacaaccacattggtggctttgtccgttggtcgatcatcaagcgtggtgaaccagagacgcgtgagaatttcgacaagaacatcttcttgtacacgtgccgcgaagtcggaaaggattgcatgcctcgcggtctcccttactcgcgttgggaacgtgc caacgacaatgtcgacgtgttcaacattatctgcggtgactacattacgattccaagctaccttgacgacggtgactacgtgcttcagttcaccaacttcggcacgggccacagcaacggtatccccggccaagctacgccaacctaccgatcgtgcg.
[0009] SEQ ID NO.7:atgtgccaagttcaaatcgccactcgaagctgccgtcttgccaagcctgcttctgccaagatgtcaccaggctacaagcata tgaaggtgacgacacgaagtgcaccagtcattacaatcaagaaggacacggtttgccgtatcgccaagcggataatgaccgaagcgtctggagaagacct ggacctcgaggtcaacctcctccgacatactgtgagcgagatgcagcaccaggtcaacgctgctgcgcggcagatccaggatatccgctccttactcaccca atacatggcaacccag。
[0010] SEQ ID NO.13:acgtgcgacgccatgtgccgctgactgccacggcggagcgctttggactctccaagagaccaggtacgtagctcgtgg gcgtggagcggagctgctcgtggggaccgacggattctgtgcattatcagctgcgtgggtgagtcagcatggtgcgtttgtgctctggatccatggcgcttc cgttggcgagtgtctctcggcattgcccattgtcgacatggtcttgtcctggtcctcgacgccgacgcaagtggtcatgaccaccacgacagcggcagcaaggcagctgttgcaacagcg。
[0011] SEQ ID NO.20:tttggtaagctctaccgttcgtgtggcaactgtaagacgcagtacgaacgccatgtggtagtgagcaacgtgttggcggt gaacccgaagaaggccgtgacgatgatcaacaccaacttgggtgacacggctaccatctccaacttgcacttgacgtcgagcaagggtgacaagacggt gtgcgtgtggtcgaagggtgtgacgagcggtgagccatcggagactggctacggtccatcgaagagctgcatctacacggccaaggacgtgatcttgagcaagcgattgttgcgtgcctaa。
[0012] SEQ ID NO.27: gatcgcaggcaatgacaaggtaggcgaggagtgtgcacggtgtatgagacgcagggtgtgacgtggtgagctacaggtg cgccatcgatgggagatcatcaatgcggggatcccagggagcttttcgcaagattggttattgaacgcgccgaccaaggtatgcacacaagatcctggcg acgtctcatgtagtggcgaatgattcagtgaaacgctgtgtctcccagtactttgagagcgtgatctcctccaacaaacgcacaagcgacgcggaaattgtaattgtcatgctcggctcga.
[0013] The present invention also provides a LAMP primer combination for detecting the above-mentioned cedar rot mold (Pythium cedri), the primer combination including a primer combination for detecting Pc_s135192 with a nucleotide sequence as shown in SEQ ID NOs. 2 to 6, a primer combination for detecting Pc_s460833 with a nucleotide sequence as shown in SEQ ID NOs. 8 to 12, a primer combination for detecting Pc_s103050 with a nucleotide sequence as shown in SEQ ID NOs. 14 to 19, a primer combination for detecting PcPL3_2 with a nucleotide sequence as shown in SEQ ID NOs. 21 to 26, or a primer combination for detecting Pc_s376271 with a nucleotide sequence as shown in SEQ ID NOs. 28 to 33.
[0014] The present invention also provides the use of the above-mentioned LAMP primer combination in preparing a kit for detecting Pythium cedri.
[0015] The present invention also provides a LAMP kit for detecting Pythium cedri, wherein the kit comprises the above-mentioned LAMP primer combination.
[0016] Furthermore, the kit also contains 10×ThermoPolBuffer, MgSO4, dNTPs, betaine, BstDNApolymerase, and hydroxynaphthol blue.
[0017] The present invention also provides the use of the LAMP primer composition and the LAMP kit in detecting Pythium cedri, wherein the detection is for non-disease diagnosis purposes.
[0018] The present invention also provides a LAMP method for detecting Pythium cedri, comprising the following steps: extracting DNA of the microorganism to be detected, taking the DNA solution as a reaction template, performing a LAMP reaction with the above-mentioned primer combination, and then observing the color change of the amplified product. If the amplified product is sky blue, it indicates that the test result is positive, indicating that Pythium cedri is present in the organism to be detected; if the amplified product is purple, it indicates that the test result is negative, indicating that Pythium cedri is not present in the organism to be detected.
[0019] Furthermore, the LAMP reaction system is: 2.5 μL 10×ThermoPol Buffer, 8 mmol·L - 1 MgSO4, 1.2mmol·L -1 dNTPs, inner primers FIP and BIP, 1.6 μmol·L each -1 , outer primers F3 and B3, 0.4 μmol·L each -1 , loop primers LB and / or LF, 0.8 μmol·L each -1 , 0.8 μmol·L -1 Betaine, 8 U·μL -1 BstDNA polymerase, 180mmol·L -1 Hydroxynaphthol blue, 2 μL template DNA, and sterile water to make up to 26 μL.
[0020] Furthermore, the LAMP reaction procedure is: amplification at 63° C. for 63 to 70 minutes.
[0021] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: the present invention discloses target genes Pc_s135192, Pc_s460833, Pc_s103050, PcPL3_2 and Pc_s376271 for specific detection of Pythium cedri, and the LAMP primer combination designed based on the above target genes can be used for rapid and efficient detection of Pythium cedri. The detection method has the advantages of strong specificity, high accuracy, good sensitivity, simple operation and the results can be observed with the naked eye. When the DNA reaches 100 pg·μL -1 The cedar mold can be identified at any time, which is very practical. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] Figure 1 The nucleic acid sequence and primer positions of the Pythium cedarii Pc_s135192 gene.
[0023] Figure 2The specificity verification results of Example 1 are shown, wherein 1-6 are different Pythium cedri strains, and 7-35 are P. acanthicum, P. aphanidermatum, P. deliense, P. myriotylum, P. hydnosporum, P. oligandrum, P. oopapillum, P. periilum, P. periplocum, P. rhizo-oryzae, P. xuzhouense, Globisporangium huanghuaiense, G. irregulare, G. middletonii, G. paroecandrum, G. pengfuense, G. recalcitrans, G. spinosum, G. splendens, G. ultimumvar. ultimum, Phytopythium helicoides, Phytopythora cactorum, Ph. cinnamomi, Ph. boehmeriae, Botrytis cinerea, Colletotrichum gloeosporioides, Fusarium graminearum, Saprolegnia parasitica and ddH2O (negative control).
[0024] Figure 3 This is the sensitivity verification result of Example 1.
[0025] Figure 4 The results of the field test of Example 1 are shown. 1 is Pythium cedarii (positive control), 2-8 are suspected diseased plants, and 9 is ddH2O (negative control).
[0026] Figure 5 The nucleic acid sequence and primer positions of the Pythium cedarii Pc_s460833 gene.
[0027] Figure 6The specificity verification results of Example 2, wherein 1-6 are different P. cedri, and 7-36 are P. acanthicum, P. aphanidermatum, P. deliense, P. myriotylum, P. hydnosporum, P. nunn, P. oopapillum, P. periilum, P. periplocum, P. rhizo-oryzae, P. xuzhouense, Globisporangium intermedium, G. huanghuaiense, G. irregulare, G. middletonii, G. nodosum, G. orthogonon, G. paroecandrum, G. spinosum, G. splendens, G. ultimum var. ultimum, Phytopythium helicoides, Pp. vexans, Phytophthora cactorum, Ph. Cinnamomi, Ph. boehmeriae, Botrytis cinerea, Colletotrichum gloeosporioides, Fusarium graminearum and ddH2O (negative control).
[0028] Figure 7 This is the sensitivity verification result of Example 2.
[0029] Figure 8 The nucleic acid sequence and primer positions of the Pythium cedarii Pc_s103050 gene.
[0030] Figure 9 These are the results of testing different Pythium cedri strains and negative controls in Example 3.
[0031] Figure 10The specificity verification results in Example 3 are as follows, wherein 1 is a P. cedri strain, and 2-33 are P. acanthicum, P. aphanidermatum, P. deliense, P. myriotylum, P. hydnosporum, P. nunn, P. oligandrum, P. oopapillum, P. periilum, P. periplocum, P. rhizo - oryzae, P. subinflatum, P. subutonaiense, P. xuzhouense, Globisporangium intermedium, G. irregulare, G. middletonii, G. nodosum, G. orthogonon, G. paroecandrum, G. spinosum, G. splendens, G. ultimum var. ultimum, Phytopythium helicoides, Phytophthoracactorum, Ph. cinnamomi, Ph. boehmeriae, and Botrytis cinerea. cinerea, Colletotrichum gloeosporioides, Fusarium graminearum, Saprolegnia parasitica and ddH2O (negative control).
[0032] Figure 11 This is the sensitivity verification result of Example 3.
[0033] Figure 12 This is the spore concentration verification result of Example 3.
[0034] Figure 13 The nucleic acid sequence and primer positions of the Pythium cedarii PcPL3_2 gene.
[0035] Figure 14This is the specificity verification result of Example 4, wherein 1-8 are different Pythium cedri, and 9-30 are P.acanthicum, P.aphanidermatum, P.deliense, P.myriotylum, P.oopapillum, P.periilum, P.periplocum, P.rhizo-oryzae, P.sukuiense, Globisporangiumirregulare, G.paroecandrum, G.spinosum, G.splendens, G.ultimum var.ultimum, Phytopythium helicoides, Phytophthora cactorum, Ph.cinnamomi, Ph.boehmeriae, Botrytis cinerea, Colletotrichum gloeosporioides, Fusarium graminearum and ddH2O (negative control), respectively.
[0036] Figure 15 Sensitivity verification results of Example 4.
[0037] Figure 16 The nucleic acid sequence and primer positions of the Pythium cedriPc_s376271 gene are shown in FIG.
[0038] Figure 17The specificity verification results of Example 5 are shown in Figure 5, wherein 1-7 are different Pythium cedri strains, and 8-32 are Pythium acanthicum, P.aphanidermatum, P.deliense, P.myriotylum, P.hydnosporum, P.oopapillum, P.periilum, P.periplocum, Globisporangiumhuanghuaiense, G.irregulare, G.middletonii, G.paroecandrum, G.spinosum, G.splendens, G.ultimum var.ultimum, Phytopythium helicoides, Ph.vexans, Phytophthora cactorum, Ph.cinnamomi, Ph.boehmeriae, Botrytis cinerea, Colletotrichumgloeosporioides, Fusarium graminearum, Saprolegniaparasitica and ddH2O (negative control), respectively.
[0039] Figure 18 This is the sensitivity verification result of Example 5. DETAILED DESCRIPTION
[0040] The technical solution of the present invention will be further described below with reference to the accompanying drawings.
[0041] Target Screening and Selection for Pythium cedarii Detection: This study explored detection targets for Pythium cedarii by mining large-scale genomic databases through Blast sequence searching, sequence extraction, alignment, and analysis. Through whole-genome alignment, over 1,000 Pythium cedarii-specific detection targets were identified. Genes were randomly selected from over 1,000 Pythium cedarii-specific genes (sequences alternating between evolutionary and conserved regions of the Pythium cedarii genome) as candidate genes. Specific primers were designed and screened, ultimately identifying five specific targets: Pc_s135192, Pc_s460833, Pc_s103050, PcPL3_2, and Pc_s376271.
[0042] Example 1 Detection of Pythium cedarii using Pc_s135192 as a specific target
[0043] 1. Specificity Verification
[0044] The LAMP primer composition for detecting Pythium cedarii is as follows: the forward inner primer FIP as shown in SEQ ID NO.2, the reverse inner primer BIP as shown in SEQ ID NO.3, the forward outer primer F3 as shown in SEQ ID NO.4, the reverse outer primer B3 as shown in SEQ ID NO.5, and the reverse loop primer LB as shown in SEQ ID NO.6 (the primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the detailed information is shown in Table 1. The Pc_s135192 gene sequence and primer positions are shown in Table 1. Figure 1 shown).
[0045] Table 1
[0046]
[0047] Detection method: Extract the DNA of the microorganism to be tested, take the DNA solution as the reaction template, add the reaction solution including the above primers to carry out LAMP reaction, the LAMP reaction system is: 2.5μL 10×ThermoPol Buffer, 8mmol·L - 1 MgSO4, 1.2mmol·L -1 dNTPs, inner primers FIP and BIP, 1.6 μmol·L each -1 , outer primers F3 and B3, 0.4 μmol·L each -1 , 0.8 μmol·L -1 Loop primer LB, 0.8 μmol·L -1 Betaine, 8 U·μL -1 BstDNA polymerase, 180mmol·L -1 Hydroxynaphthol blue, 2 μL template DNA, sterile water to 26 μL; LAMP reaction procedure is: 63 ° C reaction amplification for 70 minutes, and then observe the color change of the amplified product. If it is sky blue, it indicates a positive test result and Pythium cedarum is present. If it is purple, it indicates a negative test result and Pythium cedarum is not present.
[0048] In order to verify the specificity of the LAMP method, 6 different strains of Pythium cedarii and 28 other oomycete or fungal strains were used as test materials (Table 2). The LAMP test results showed that only the reaction tube solution with Pythium cedarii as the template showed a sky blue positive reaction, while the other test microbial strains and the negative control showed a purple negative reaction ( Figure 2 ).
[0049] Table 2
[0050]
[0051]
[0052] 2. Sensitivity verification
[0053] In order to determine the sensitivity of the LAMP detection method, the concentration of the extracted DNA of Pythium cedarii was measured by spectrophotometer and diluted in a 10-fold gradient to a mass concentration of 10 ng·μL. -1 , 1ng·μL -1 , 100pg·μL -1 , 10pg·μL -1 , 1pg·μL -1 、100fg·μL -1 and 10 fg·μL -1 2 μL of each sample was used as a template for LAMP reaction. The reaction procedure was 63°C for 70 min. The HNB color development results showed that when the DNA concentration of Pythium cedarii reached 100 pg·μL -1 When the solution in the reaction tube turns sky blue ( Figure 3 ).
[0054] 3. Field trials
[0055] To determine the applicability of the LAMP assay, seven plants suspected of being diseased were brought back to the laboratory. 2 μL of each of the DNA extracted from the diseased tissue samples, the positive control (Pythium cedarii DNA), and the negative control (ddH2O) were used as templates for LAMP reactions. The reaction was performed at 63°C for 70 minutes. Field test results showed that Pythium cedarii was detected in the diseased areas of five plants. Figure 4 ). Pathogens were isolated from the diseased root tissues of seven samples and identified based on their morphological characteristics and ITS sequences. Pythium cedarii was isolated from five samples that tested positive for LAMP, but not from the other two samples that tested negative for LAMP.
[0056] 4. Primer combination screening
[0057] A total of 20 LAMP primer pairs were designed for the P. cedri specific target, Pc_s135192. Ultimately, a single pair of primers with the highest specificity and sensitivity was selected, which is the primer sequence used in the specificity verification (SEQ ID NOs. 2-6). The remaining primer pairs (only one randomly selected from the remaining 20 primer pairs for illustration) served as controls. The specific primer sequences are as follows:
[0058] FIP1: 5'-AACGCCACCCTTCTTGCAGCTGAAGGTGGCAAGGAAATCG-3'; BIP1: 5'-ACGTG ACGCATGTCAAGGCTACCAAGTGTGGTTGTTACGGT-3'; F31: 5'-GCTTCTCGAGCCACTGTC-3'; B31: 5'-TGATCGACCAACGGACAAAG-3'; LF1: 5'-TCGTGTTTTGGACATCCTCCA-3'; LB1: 5'-GGTGCGAACATCCCAGTGCG-3'.
[0059] LAMP assays were performed using the strains listed in Table 2 (six different P. cedri strains and 28 other oomycete and fungal strains) and following the specificity validation method. The results showed that the selected control primer set had low specificity and poor sensitivity, indicating that the primer combination used in the present invention has high specificity and sensitivity.
[0060] Example 2 Detection of Pythium cedarii using Pc_s460833 as a specific target
[0061] 1. Specificity Verification
[0062] The LAMP primer composition for detecting P. cedri includes the forward inner primer FIP as shown in SEQ ID NO. 8, the reverse inner primer BIP as shown in SEQ ID NO. 9, the forward outer primer F3 as shown in SEQ ID NO. 10, the reverse outer primer B3 as shown in SEQ ID NO. 11, and the reverse loop primer LB as shown in SEQ ID NO. 12 (the primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and detailed information is shown in Table 3. The Pc_s460833 gene sequence and primer positions are shown in Table 3). Figure 5 shown).
[0063] Table 3
[0064]
[0065] Detection method: Extract the DNA of the microorganism to be tested, take the DNA solution as the reaction template, add the reaction solution including the above primers to carry out LAMP reaction, the LAMP reaction system is: 2.5μL 10×ThermoPol Buffer, 8mmol·L - 1 MgSO4, 1.2mmol·L -1 dNTPs, inner primers FIP and BIP, 1.6 μmol·L each -1 , outer primers F3 and B3, 0.4 μmol·L each -1, 0.8 μmol·L -1 Loop primer LB, 0.8 μmol·L -1 Betaine, 8 U·μL -1 BstDNA polymerase, 180mmol·L -1 Hydroxynaphthol blue, 2 μL template DNA, sterile water to 26 μL; LAMP reaction procedure is: 63 ° C reaction amplification for 68 minutes, and then observe the color change of the amplified product. If it is sky blue, it indicates a positive test result and P. cedri is present. If it is purple, it indicates a negative test result and P. cedri is not present.
[0066] To verify the specificity of the LAMP method, 6 different P. cedri strains and 29 other oomycete and fungal strains were used as test materials (Table 4). The LAMP test results showed that only the reaction tube solution with P. cedri as the template showed a sky blue positive reaction, while the other test microbial strains and the negative control showed a purple negative reaction ( Figure 6 ).
[0067] Table 4
[0068]
[0069] 2. Sensitivity verification
[0070] In order to determine the sensitivity of the LAMP detection method, the concentration of the extracted P. cedri DNA was measured by spectrophotometer and diluted in a 10-fold gradient to a mass concentration of 10 ng·μL. -1 , 1ng·μL -1 , 100pg·μL -1 , 10pg·μL -1 , 1pg·μL -1 、100fg·μL -1 and 10 fg·μL -1 2 μL of each was used as template for LAMP reaction. The reaction procedure was 63°C for 68 min. HNB color development results indicated that when the DNA concentration of P. cedri reached 100 pg·μL -1 When the solution in the reaction tube turns sky blue ( Figure 7 ).
[0071] 3. Primer combination screening
[0072] A total of 20 matching LAMP primer pairs were designed for the P. cedri specific target, Pc_s460833. Ultimately, a single pair of primers with the highest specificity and sensitivity was selected, which served as the primer sequence for specificity validation (SEQ ID NOs. 8-12). The remaining primer pairs (one randomly selected from the remaining 20 pairs) served as controls. The specific primer sequences are as follows:
[0073] FIP1: 5'-CGGCAAACCGTGTCCTTCTTGAGATGTCACCAGGCTACAAGC-3'; BIP1: 5'-ATG ACCGAAGCGTCTGGAAGGTGCTGCATCTCGCTCAC-3'; F31: 5'-CAAGCCTGCTTCTGCCAA-3'; B31: 5'-GCGGATATCCTGGATCTGC-3'; LF1: 5'-ACTTCGTGTCGTCACCTTCATAT-3'; LB1: 5'-ACCTGGACCTCGAGGTCAACC-3'.
[0074] LAMP assays were performed using the strains listed in Table 4 (six different P. cedri strains and 29 other oomycete and fungal strains) and following the specificity validation method. The results showed that the selected control primer set had low specificity and poor sensitivity. This suggests that the primer combination used in the present invention has high specificity and sensitivity.
[0075] Example 3 Detection of Pythium cedarii using Pc_s103050 as a specific target
[0076] 1. Specificity Verification
[0077] The LAMP primer composition for detecting Pythium cedarii (P. cedri) includes the forward inner primer FIP as shown in SEQ ID NO.14, the reverse inner primer BIP as shown in SEQ ID NO.15, the forward outer primer F3 as shown in SEQ ID NO.16, the reverse outer primer B3 as shown in SEQ ID NO.17, the reverse loop primer LF as shown in SEQ ID NO.18, and the reverse loop primer LB as shown in SEQ ID NO.19 (the primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and detailed information is shown in Table 5. The Pc_s103050 gene sequence and primer positions are shown in Table 5). Figure 8 shown).
[0078] Table 5
[0079]
[0080] Detection method: Extract the DNA of the microorganism to be tested, take the DNA solution as the reaction template, add the reaction solution including the above primers to carry out LAMP reaction, the LAMP reaction system is: 2.5μL 10×ThermoPol Buffer, 8mmol·L - 1 MgSO4, 1.2mmol·L -1 dNTPs, inner primers FIP and BIP, 1.6 μmol·L each -1 , outer primers F3 and B3, 0.4 μmol·L each -1 , loop primers LF and LB, 0.8 μmol·L each -1 , 0.8 μmol·L -1 Betaine, 8 U·μL -1 BstDNA polymerase, 180mmol·L -1 Hydroxynaphthol blue, 2 μL template DNA, sterile water to 26 μL; LAMP reaction procedure is: 63 ° C reaction amplification for 70 minutes, and then observe the color change of the amplified product. If it is sky blue, it indicates a positive test result and Pythium cedarum (P. cedri) is present; if it is purple, it indicates a negative test result and Pythium cedarum (P. cedri) is not present.
[0081] To verify the specificity of the LAMP method, 7 strains of Pythium cedri and 31 other oomycete or fungal strains were used as test materials (Table 6). The LAMP test results showed that only the reaction tube solution with Pythium cedri DNA as the template showed a sky blue positive reaction ( Figure 9 ), other tested microbial strains and negative controls all showed purple negative reactions ( Figure 10 ).
[0082] Table 6
[0083]
[0084]
[0085] 2. Sensitivity verification
[0086] In order to determine the sensitivity of the LAMP detection method, the concentration of the extracted Pythium cedri DNA was measured by spectrophotometer and diluted in 10-fold gradients to a concentration of 10 ng·μL. -1 , 1ng·μL -1 , 100pg·μL -1 , 10pg·μL -1 , 1pg·μL -1 、100fg·μL -1and 10 fg·μL -1 2 μL of each sample was used as a template for LAMP reaction. The reaction procedure was 63°C for 70 min. HNB color development results indicated that when the DNA concentration of P. cedri reached 100 pg·μL -1 When the solution in the reaction tube turns sky blue ( Figure 11 ).
[0087] 3. Primer combination screening
[0088] A total of 20 primer pairs were designed for the Pythium cedarii specific target, Pc_s103050. Ultimately, a single pair of primers with the highest specificity and sensitivity was selected, which is the primer sequence used in the specificity verification (SEQ ID NOs. 14-19). The remaining primer pairs (only one randomly selected from the remaining 20 primer pairs for illustration) served as controls. The specific primer sequences are as follows:
[0089] FIP1: 5'-CCAGCAGTCGGTGTGGGATGAAGATCATCATTGGCGTGGA-3'; BIP1: 5'-GCGTC GAGAGAACGTGGTGATGACTCGAGATGAGGTTCTGGT-3'; F31: 5'-CGCATCAAAGACCTCATT GC-3'; B31: 5'-GCCCATTGATGCGTCCAA-3'; LB1: 5'-CCAGATCGGTGTTCCATCGC-3'.
[0090] LAMP assays were performed using the strains listed in Table 6 (seven different Pythium cedri strains and 31 other oomycete and fungal strains) according to the specificity validation method. The results showed that the selected control primer set had low specificity and poor sensitivity. This suggests that the primer combination used in the present invention has high specificity and sensitivity.
[0091] 4. Verification of detected spore concentration
[0092] To determine the lower limit of LAMP detection of P. cedri spore concentration, suspensions containing 0, 10, 50, 100, 1000, and 10,000 P. cedri oospores were added to six 0.25g sterile soil samples. DNA was extracted from the treated soil samples according to the instructions of the soil DNA extraction kit (MO BIO), and DNA from a standard P. cedri strain was used as a positive control, and ddH2O was used as a negative control. When at least 10 P. cedri oospores were present in 0.25g of soil, the LAMP amplification reaction could detect the presence of P. cedri ( Figure 12 This result shows that the method has high sensitivity and can effectively detect whether soil samples carry Pythium cedri.
[0093] Example 4 Detection of Pythium cedarii using PcPL3_2 as a specific target
[0094] 1. Specificity Verification
[0095] The LAMP primer composition for detecting Pythium cedarii is as follows: the forward inner primer FIP as shown in SEQ ID NO.21, the reverse inner primer BIP as shown in SEQ ID NO.22, the forward outer primer F3 as shown in SEQ ID NO.23, the reverse outer primer B3 as shown in SEQ ID NO.24, the reverse loop primer LF as shown in SEQ ID NO.25, and the reverse loop primer LB as shown in SEQ ID NO.26 (the primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the detailed information is shown in Table 7. The PcPL3_2 gene sequence and primer positions are shown in Table 7. Figure 13 shown).
[0096] Table 7
[0097]
[0098] Detection method: Extract the DNA of the microorganism to be tested, take the DNA solution as the reaction template, add the reaction solution including the above primers to carry out LAMP reaction, the LAMP reaction system is: 2.5μL 10×ThermoPol Buffer, 8mmol·L - 1 MgSO4, 1.2mmol·L -1 dNTPs, inner primers FIP and BIP, 1.6 μmol·L each -1 , outer primers F3 and B3, 0.4 μmol·L each -1 , loop primers LF and LB, 0.8 μmol·L each -1 , 0.8 μmol·L-1 Betaine, 8 U·μL -1 BstDNA polymerase, 180mmol·L -1 Hydroxynaphthol blue, 2 μL template DNA, sterile water to 26 μL; LAMP reaction procedure is: 63 ° C reaction amplification for 63 minutes, and then observe the color change of the amplified product. If it is sky blue, it indicates a positive test result and Pythium cedarum is present. If it is purple, it indicates a negative test result and Pythium cedarum is not present.
[0099] In order to verify the specificity of the LAMP method, 8 different strains of Pythium cedarii and 21 other oomycete and fungal strains were used as test materials (Table 8). The LAMP test results showed that only the reaction tube solution with Pythium cedarii as the template showed a sky blue positive reaction, while the other test microbial strains and the negative control showed a purple negative reaction ( Figure 14 ).
[0100] Table 8
[0101]
[0102]
[0103] 2. Sensitivity verification
[0104] In order to determine the sensitivity of the LAMP detection method, the concentration of the extracted DNA of Pythium cedarii was measured by spectrophotometer and diluted in a 10-fold gradient to a mass concentration of 10 ng·μL. -1 , 1ng·μL -1 , 100pg·μL -1 , 10pg·μL -1 , 1pg·μL -1 、100fg·μL -1 and 10 fg·μL -1 2 μL of each sample was used as a template for LAMP reaction. The reaction procedure was 63°C for 63 min. The HNB color development results showed that when the DNA concentration of Pythium cedarii reached 100 pg·μL -1 When the solution in the reaction tube turns sky blue ( Figure 15 ).
[0105] 3. Primer combination screening
[0106] A total of 20 primer pairs were designed for the Pythium cedarii specific target, PcPL3_2. Ultimately, a single pair of primers with the highest specificity and sensitivity was selected, which is the primer sequence used in the specificity verification (SEQ ID NOs. 21-26). The remaining primer pairs (only one randomly selected from the remaining 20 primer pairs for illustration) served as controls. The specific primer sequences are as follows:
[0107] FIP1: 5'-ACGATGAAGACGGCGTCCGATTGCGCGCTAACGTCACC-3'; BIP1: 5'-GAGAGCAACGCCACGCTCCGTTGCAGTCGCTGGTTGG-3'; F31: 5'-TG CCCGCAACAAGTACGA-3'; B31: 5'-GCCACAGGCGTTGGTGA-3'; LF1: 5'-TTGAGCGAGCCGACACC-3'; LB1: 5'-CACGGAACAGAAACTCGGTGT-3'.
[0108] LAMP assays were performed using the strains listed in Table 8 (8 Pythium cedarii strains and 21 other oomycete and fungal strains) and specificity validation methods. The results showed that the selected control primer set had low specificity and poor sensitivity. This indicates that the primer combination used in the present invention has high specificity and sensitivity.
[0109] Example 5 Detection of Pythium cedarii using Pc_s376271 as a specific target
[0110] 1. Specificity Verification
[0111] The LAMP primer composition for detecting Pythium cedarii is as follows: the forward inner primer FIP as shown in SEQ ID NO.28, the reverse inner primer BIP as shown in SEQ ID NO.29, the forward outer primer F3 as shown in SEQ ID NO.30, the reverse outer primer B3 as shown in SEQ ID NO.31, the reverse loop primer LF as shown in SEQ ID NO.32, and the reverse loop primer LB as shown in SEQ ID NO.33 (the primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the detailed information is shown in Table 9. The Pc_s376271 gene sequence and primer positions are shown in Table 9. Figure 16 shown).
[0112] Table 9
[0113]
[0114] Detection method: Extract the DNA of the microorganism to be tested, take the DNA solution as the reaction template, add the reaction solution including the above primers to carry out LAMP reaction, the LAMP reaction system is: 2.5μL 10×ThermoPol Buffer, 8mmol·L - 1 MgSO4, 1.2mmol·L -1 dNTPs, inner primers FIP and BIP, 1.6 μmol·L each -1 , outer primers F3 and B3, 0.4 μmol·L each -1 , loop primers LB and LF, 0.8 μmol·L each -1 , 0.8 μmol·L -1 Betaine, 8 U·μL -1 BstDNA polymerase, 180mmol·L -1 Hydroxynaphthol blue, 2 μL template DNA, sterile water to 26 μL; LAMP reaction procedure is: 63 ° C reaction amplification for 63 minutes, and then observe the color change of the amplified product. If it is sky blue, it indicates a positive test result and Pythium cedri is present. If it is purple, it indicates a negative test result and Pythium cedri is not present.
[0115] To verify the specificity of the LAMP method, 7 different Pythium cedri strains and 24 other oomycete and fungal strains were used as test materials (Table 10). The LAMP test results with Pc_s376271 as the detection target showed that only the reaction tube solution with Pythium cedri as the template showed a sky blue positive reaction, while the other test microbial strains and the negative control showed a purple negative reaction ( Figure 17 ).
[0116] Table 10
[0117]
[0118]
[0119] 2. Sensitivity verification
[0120] In order to determine the sensitivity of the LAMP detection method, the concentration of the extracted Pythium cedri DNA was measured by spectrophotometer and diluted in a 10-fold gradient to a mass concentration of 10 ng·μL. -1 , 1ng·μL -1 , 100pg·μL -1 , 10pg·μL -1 , 1pg·μL -1 、100fg·μL-1 and 10 fg·μL -1 2 μL of each was used as template for LAMP reaction. The reaction procedure was 63°C for 63 min. HNB color development results indicated that when the DNA concentration of Pythium cedri reached 100 pg·μL -1 When the solution in the reaction tube turns sky blue ( Figure 18 ).
[0121] 3. Primer combination screening
[0122] A total of 20 primer pairs were designed for the Pythium cedarii specific target, Pc_s376271. Ultimately, a single pair of primers with the highest specificity and sensitivity was selected, which is the primer sequence used in the specificity verification (SEQ ID NOs. 28-33). The remaining primer pairs (one randomly selected from the remaining 20 primer pairs for illustration) served as controls. The specific primer sequences are as follows:
[0123] FIP1: 5'-CCTTCTTGCGCAGCGTGTCAAAAACGCCAAGGAGATCAGC-3'; BIP1: 5'-CAAGT ACGTGTGCCTCGCGACAGCATGGAGTTGAGTGGGA-3'; F31: 5'-CATGGCAAGGGCCAAGTC-3'; B31: 5'-CCTGGCACAAAAGTCCTCG-3'; LB1: 5'-GTGGCCAGTTCCACTCCACTTG-3'.
[0124] LAMP assays were performed using the strains listed in Table 10 (seven Pythium cedarii strains and 24 other oomycete and fungal strains) and specificity validation methods. The results showed that the selected control primer set had low specificity and poor sensitivity, indicating that the primer combination used in the present invention has high specificity and sensitivity.
Claims
1. A specific detection target for Pythium cedri, characterized in that: The specific detection target includes one or more of the nucleotide sequence Pc_s135192 shown in SEQ ID NO.1, the nucleotide sequence Pc_s460833 shown in SEQ ID NO.7, the nucleotide sequence Pc_s103050 shown in SEQ ID NO.13, the nucleotide sequence PcPL3_2 shown in SEQ ID NO.20, or the nucleotide sequence Pc_s376271 shown in SEQ ID NO.
27.
2. A LAMP primer composition for detecting the specific detection target of Pythium cedri according to claim 1, characterized in that: The primer composition includes a primer combination for detecting Pc_s135192 with a nucleotide sequence as shown in SEQ ID NOs. 2 to 6, a primer combination for detecting Pc_s460833 with a nucleotide sequence as shown in SEQ ID NOs. 8 to 12, a primer combination for detecting Pc_s103050 with a nucleotide sequence as shown in SEQ ID NOs. 14 to 19, a primer combination for detecting PcPL3_2 with a nucleotide sequence as shown in SEQ ID NOs. 21 to 26, or a primer combination for detecting Pc_s376271 with a nucleotide sequence as shown in SEQ ID NOs. 28 to 33.
3. Use of the LAMP primer combination according to claim 2 in preparing a kit for detecting Pythium cedri.
4. A LAMP kit for detecting Pythium cedri, characterized in that: The kit comprises the LAMP primer composition according to claim 2.
5. The LAMP kit for detecting Pythium cedri according to claim 4, characterized in that: The kit further comprises 10×ThermoPol Buffer, MgSO4, dNTPs, betaine, BstDNA polymerase, and hydroxynaphthol blue.
6. Use of the LAMP primer composition according to claim 2 and the LAMP kit according to any one of claims 4 to 5 in detecting Pythium cedri, characterized in that: The detection is not for the purpose of disease diagnosis.
7. A LAMP method for detecting Pythium cedri, characterized in that: The following steps are involved: Extract the DNA of the microorganism to be tested, take the DNA solution as a reaction template, perform LAMP reaction with the primer combination described in claim 2, and then observe the color change of the amplified product. If the amplified product is sky blue, it indicates that the test result is positive, which means that Pythium cedri is present in the organism to be tested; if the amplified product is purple, it indicates that the test result is negative, which means that Pythium cedri is not present in the organism to be tested.
8. The LAMP method for Pythium cedri according to claim 7, characterized in that: The LAMP reaction system is: 2.5 μL 10×ThermoPol Buffer, 8 mmol·L -1 MgSO4, 1.2mmol·L -1 dNTPs, inner primers FIP and BIP, 1.6 μmol·L each -1 , outer primers F3 and B3, 0.4 μmol·L -1 , loop primer LB and / or LF 0.8 μmol·L -1 , 0.8 μmol·L -1 Betaine, 8U·μL -1 Bst DNA polymerase, 180mmol·L -1 Hydroxynaphthol blue, 2 μL template DNA, and sterile water to make up to 26 μL.
9. The LAMP method for Pythium cedri according to claim 7, characterized in that: The procedure of the LAMP reaction is: amplification at 63° C. for 63 to 70 minutes.
Citation Information
Patent Citations
Molecular detection method for Edrus deodara (Roxb) Lobd blight and primers therefor
CN102424851A
Color determination-based loop-mediated isothermal amplification (LAMP) technology for detecting phytophthora sojae of cedar
CN106636371A
Application of Ypt1 gene as specific target in detection of pythium variabilis
CN118910310A