Salmonella typhimurium specific antigen fragment and application thereof in detection of salmonella typhimurium antibody

Abstract

The invention discloses a specific antigen fragment of salmonella typhimurium and application of the specific antigen fragment in detection of a salmonella typhimurium antibody. The amino acid sequence of the salmonella typhimurium specific antigen fragment is as shown in SEQ ID NO. 1. The invention discloses a method for detecting the indirect ELISA antibody of the salmonella typhimurium by taking the specific antigen fragment of the salmonella typhimurium as the coating antigen of the indirect ELISA for the first time, the specific antigen fragment of the salmonella typhimurium contains dominant B cell epitopes of the FliC protein of the salmonella typhimurium, and the specific antigen fragment of the salmonella typhimurium contains the dominant B cell epitopes of the FliC protein of the salmonella typhimurium. The salmonella typhimurium FliC protein antibody generated by induction can be specifically recognized, and the obvious synergistic effect is achieved in the aspect of improving the specific binding of the antigen and the antibody. The kit can be used for detecting the salmonella typhimurium antibody, and provides powerful technical support for epidemiological investigation of salmonella typhimurium and prevention and control of salmonella.

Description

Technical Field

[0001] The present invention relates to a specific antigen fragment of Salmonella typhimurium and its application in detecting antibodies against Salmonella typhimurium, belonging to the field of specific antigen fragments of Salmonella typhimurium. Background Art

[0002] Salmonella is an important zoonotic pathogen, which can widely infect a variety of animals, and can also be transmitted to humans through foods such as meat, eggs, and milk, causing diseases such as gastroenteritis and even death, and has great public health significance. There are more than 2,600 Salmonella serotypes, among which Salmonella typhimurium is one of the most common Salmonella serotypes causing foodborne diseases. In the past few decades, the detection rate of Salmonella typhimurium in animal foods and diarrhea patients has risen rapidly. It is a Salmonella serotype with a wide range of hosts and has become one of the most common Salmonella serotypes causing infections in animals and humans globally. It directly affects the productivity of the livestock and poultry breeding industry, causing huge economic losses, and is also a major threat to public health. Therefore, establishing effective methods for preventing and detecting Salmonella typhimurium has important economic and social significance.

[0003] Currently, most methods for detecting Salmonella typhimurium are traditional isolation methods and molecular biology techniques such as the PCR method, etc. The former takes a long time, is complicated to operate, and requires serotype identification to determine whether it is Salmonella typhimurium, and cannot achieve rapid detection. The latter has a short detection time, but requires professional personnel and special equipment, has high requirements for personnel operation and equipment, and is difficult to popularize and use at the grass-roots level. And the immunological technique - ELISA method for detecting Salmonella infection has the advantages of low cost, simple operation, high sensitivity, and strong specificity, and is especially suitable for high-throughput detection of a large number of samples in livestock and poultry breeding enterprises, etc.

[0004] Salmonella flagellin contains different H antigens, which are divided into phase I (FliC) and phase II (FljB). Among them, phase I (FliC) is a specific antigen, and the specific antigen epitope of Salmonella flagellin is one of the bases for serotype classification. From the perspective of the structural domain of flagellin, flagellin is composed of four structural domains: D0, D1, D2, and D3. Among them, the D0 and D1 structural domains are highly conserved, and the D2 and D3 structural domains not only determine the serotypes of different Salmonella but also are the key regions determining the immunogenicity of flagellin. The D3 structural domain is also located on the surface of flagellin and has high variability. Currently, there is no report on using specific antigen fragments of Salmonella typhimurium to establish an ELISA immunological detection method for Salmonella typhimurium. Summary of the Invention

[0005] Objective of the Invention: The technical problem to be solved by the present invention is to provide a specific antigen fragment of Salmonella typhimurium and its application in detecting Salmonella typhimurium antibodies. The purpose is to prepare an indirect ELISA antibody detection kit for Salmonella typhimurium using the specific antigen fragment of Salmonella typhimurium as the coating antigen, aiming to solve the problems of long detection time, low sensitivity and specificity of the existing methods for detecting Salmonella typhimurium.

[0006] Technical Solution: To solve the above technical problem, the present invention provides a specific antigen fragment P1 of Salmonella typhimurium, and its amino acid sequence is shown in SEQ ID NO.1: ALDNSTFKASATGLGGTDQKIDGDLKFDDT TGKYYAKVTVTGGTGKDGYYEVSVDKTNGEVTLAGGATSPLTGGLPATATEDVKN V.

[0007] Among them, the preparation method of the specific antigen fragment of Salmonella typhimurium is as follows:

[0008] Perform B-cell epitope prediction on the flagellin FliC of Salmonella typhimurium, screen out gene fragments with strong specificity and high immunogenicity, perform truncated expression, and send SEQ ID NO.1 to Sangon Biotech for plasmid construction; then transform the plasmid into the expression strain, induce expression and purification to obtain the specific antigen fragment of Salmonella typhimurium.

[0009] The present invention also provides a gene encoding the specific antigen fragment of Salmonella typhimurium.

[0010] Among them, the nucleotide sequence of the gene is shown in SEQ ID NO.2.

[0011] The present invention also provides the application of the specific antigen fragment of Salmonella typhimurium or its gene in the preparation of reagents or kits for detecting Salmonella typhimurium antibodies.

[0012] The present invention also provides a reagent or kit containing the specific antigen fragment of Salmonella typhimurium.

[0013] Among them, it includes an indirect ELISA kit.

[0014] Among them, the concentration of the specific antigen fragment of Salmonella typhimurium is 0.125 - 3 μg / mL.

[0015] Among them, it also contains an enzyme-labeled secondary antibody, a negative control serum, a positive control serum, a TMB chromogenic solution and a termination solution.

[0016] Among them, the enzyme-labeled secondary antibody is HRP-rabbit anti-chicken IgG antibody.

[0017] The present invention also provides the application of the specific antigen fragment or reagent or kit of Salmonella typhimurium in detecting Salmonella typhimurium antibodies for non-diagnostic purposes.

[0018] Among them, it includes the following steps:

[0019] (1) Coating: Coating with a solution of the specific antigen fragment of Salmonella typhimurium;

[0020] (2) Blocking: Blocking with a blocking solution;

[0021] (3) Adding the primary antibody: Adding the serum to be tested diluted with the blocking solution and incubating;

[0022] (4) Adding the enzyme-labeled secondary antibody: Adding the diluted enzyme-labeled secondary antibody and incubating;

[0023] (5) Substrate color development: Adding the TMB chromogenic solution and acting in the dark;

[0024] (6) Adding the termination solution: Immediately measuring the OD 450 value after adding the termination solution;

[0025] (7) Judgment: When the OD 450 value ≥ 0.56, it is judged as positive, indicating the presence of Salmonella typhimurium antibodies in the serum; when the OD 450 value ≤ 0.47, it can be judged as negative, indicating the absence of Salmonella typhimurium antibodies in the serum; when 0.56 ≥ OD 450 value ≥ 0.47, the sample is judged as suspicious.

[0026] Among them, the concentration of the specific antigen fragment of Salmonella typhimurium in step (1) is 0.125 - 3 μg / mL.

[0027] Preferably, the concentration of the specific antigen fragment of Salmonella typhimurium in step (1) is 0.25 - 3 μg / mL.

[0028] Preferably, the concentration of the specific antigen fragment of Salmonella typhimurium in step (1) is 0.5 - 3 μg / mL.

[0029] Preferably, the concentration of the specific antigen fragment of Salmonella typhimurium in step (1) is 1 - 3 μg / mL.

[0030] Preferably, the concentration of the specific antigen fragment of Salmonella typhimurium in step (1) is 2 - 3 μg / mL.

[0031] Among them, the coating conditions in step (1) are 4 - 37 °C, 1 - 16 h.

[0032] Preferably, the coating conditions in step (1) are 4 °C, 12 - 16 h.

[0033] Preferably, the conditions for coating in step (1) are 4°C for 14 - 16 h.

[0034] Among them, the blocking solution in step (2) includes 1 - 5% BSA or 1 - 5% non-fat milk.

[0035] Preferably, the blocking solution in step (2) includes 1 - 5% BSA or 1 - 2% non-fat milk.

[0036] Preferably, the blocking solution in step (2) includes 1 - 5% BSA or 1% non-fat milk.

[0037] Preferably, the blocking solution in step (2) includes 1 - 2% BSA.

[0038] Among them, the time for blocking in step (2) is 1 - 3 h.

[0039] Among them, the dilution of the serum to be tested in step (3) is 1:50 - 6400.

[0040] Preferably, the dilution of the serum to be tested in step (3) is 1:50 - 800.

[0041] Preferably, the dilution of the serum to be tested in step (3) is 1:50 - 400.

[0042] Among them, the incubation time in step (3) is 0.5 - 2.5 h.

[0043] Preferably, the incubation time in step (3) is 1 - 2.5 h.

[0044] Preferably, the incubation time in step (3) is 1.5 - 2.5 h.

[0045] Preferably, the incubation time in step (3) is 2 - 2.5 h.

[0046] Among them, the dilution of the enzyme-labeled secondary antibody in step (4) is 1:1000 - 10000.

[0047] Preferably, the dilution of the enzyme-labeled secondary antibody in step (4) is 1:2000 - 5000.

[0048] Preferably, the dilution of the enzyme-labeled secondary antibody in step (4) is 1:4000 - 5000.

[0049] Among them, the incubation time in step (4) is 30 - 75 min.

[0050] Among them, the time for light avoidance in step (5) is 6 - 18 min.

[0051] Preferably, the time for the light-shielding effect in step (5) is 8 to 18 min.

[0052] Preferably, the time for the light-shielding effect in step (5) is 10 to 18 min.

[0053] Preferably, the time for the light-shielding effect in step (5) is 15 to 18 min.

[0054] Preferably, the coated antigen uses 0.05 M bicarbonate (pH 9.6) as the coating solution, and the coating concentration of the specific antigen fragment of Salmonella typhimurium is 3 μg / mL.

[0055] The present invention also provides the application of the detection kit in the epidemiological investigation of Salmonella typhimurium.

[0056] Based on the specificity and high variability of the flagellin phase I D2 and D3 domains of Salmonella and combined with bioinformatics technology, the present invention screens a specific antigenic epitope for detecting Salmonella typhimurium and expresses it through the Escherichia coli prokaryotic system. The aim is to establish a specific immunological detection method for Salmonella typhimurium and lay a foundation for the detection and prevention and control of Salmonella typhimurium.

[0057] Beneficial effects: Compared with the prior art, the present invention has the following remarkable advantages: 1. The present invention firstly discloses using the specific antigen fragment of Salmonella typhimurium as the coated antigen for indirect ELISA and establishes an indirect ELISA antibody detection method for Salmonella typhimurium. The specific antigen fragment of Salmonella typhimurium contains the dominant B cell epitope of the FliC protein of Salmonella typhimurium and can specifically recognize and induce the production of antibodies against the FliC protein of Salmonella typhimurium, having a significant synergistic effect in improving the specific binding of antigen and antibody; 2. The present invention can be used for the detection of Salmonella typhimurium antibodies and provides strong technical support for the epidemiological investigation of Salmonella typhimurium and the prevention and control of Salmonella; 3. The indirect ELISA method described in the present invention has high sensitivity, strong specificity, high throughput, simplifies the detection steps, and shortens the detection time; 4. By strictly screening each step of the indirect ELISA detection method, this detection method can detect Salmonella typhimurium antibodies in chicken serum. This method has not been reported before, indicating that the detection method established by the present invention fills the blank of the detection of Salmonella typhimurium in chickens. It can be seen that this method can effectively prevent the spread and prevalence of Salmonella in chickens and has important social and economic significance. Description of the Drawings

[0058] Figure 1 SDS-PAGE analysis of P1 protein, where M: protein marker; 1: purified P1 recombinant protein;

[0059] Figure 2Western blot analysis of P1 protein, where M: protein marker; 1: BL21(DE3)-pGEX-4T-1 empty vector control; 2: purified recombinant P1 protein;

[0060] Figure 3 Optimization of the indirect ELISA method: A: Determination of the optimal coating concentration and serum dilution (OD 450 ); B: Determination of the optimal coating concentration and serum dilution (P / N); C: Determination of the optimal coating conditions; D: Determination of the optimal blocking solution; E: Determination of the optimal blocking duration; F: Determination of the optimal serum incubation duration; G: Determination of the optimal secondary antibody dilution; H: Determination of the optimal secondary antibody incubation duration; I: Determination of the optimal substrate reaction duration;

[0061] Figure 4 Determination of the cut-off value of the indirect ELISA method;

[0062] Figure 5 Analysis of the specificity of the indirect ELISA method, where Positive control is the positive serum of Salmonella typhimurium, and Negative control is the negative serum of non-immunized SPF chickens;

[0063] Figure 6 Analysis of the detection limit of the indirect ELISA method; Specific embodiments

[0064] The technical solutions of the present invention will be further described below with reference to the accompanying drawings.

[0065] Unless otherwise specified, the experimental methods, detection methods, and preparation methods disclosed in the present invention all adopt the conventional molecular biology, biochemistry, immunology, recombinant DNA technology and related conventional technologies in the technical field.

[0066] For those not indicating specific experimental conditions and methods in the examples of the present invention, they are usually carried out under conventional conditions, such as Molecular Cloning: A Laboratory Manual (Fourth Edition) edited by J. Sambrook et al., Science Press, 2017; or according to the conditions recommended by the manufacturer.

[0067] Example 1: Preparation of Salmonella typhimurium-specific antigen fragment

[0068] 1. Expression and purification of Salmonella typhimurium-specific antigen fragment:

[0069] (1) Construction of recombinant plasmid pGEX-4T-1-P1

[0070] The nucleotide sequence of the specific antigen fragment P1 of Salmonella typhimurium synthesized by Sangon Biotech (Shanghai) Co., Ltd.: SEQ ID NO.2: GGATCCATGGCTTTAGACAATAGTACTTTTAAAGCCTCG GCTACTGGTCTTGGTGGTACTGACCAGAAAATTGATGGCGATTTAAAATTTGATGATACGACTGGAAAATATTACGCCAAAGTTACCGTTACGGGGGGAACTGGTAAAGATGGCTATTATGAAGTTTCCGTTGATAAGACGAACGGTGAGGTGACTCTTGCTGGCGGTGCGACTTCCCCGCTTACAGGTGGACTACCTGCGACAGCAACTGAGGATGTGAAAAATGTATAACTCGAG. Restriction enzyme cleavage sites BamHⅠ and Xho I were added to both ends of the sequence for ligation with the pGEX-4T-1 vector (Sangon Biotech, catalog number: ZB04814). The sequence after adding the restriction enzyme cleavage sites was commissioned to be synthesized by Sangon Biotech (Shanghai) Co., Ltd. and cloned into the expression vector respectively to form the recombinant expression plasmid pGEX-4T-1-P1.

[0071] (2) Expression and purification of the target protein

[0072] The recombinant expression plasmid pGEX-4T-1-P1 constructed by Sangon Biotech (Shanghai) Co., Ltd. was transformed into E. coli BL21(DE3) competent cells. Positive colonies were picked and cultured in LB medium containing carbenicillin (50 μg / mL) on a shaker at 37°C for 12 h. On the next day, it was subcultured 1:100 to the logarithmic growth phase (OD 600 was approximately 0.6 - 0.8), and then induced with IPTG at 15°C for 24 h (adding IPTG with a final concentration of 0.5 mM). The bacteria were collected, lysed by high pressure, and the supernatant was collected to purify the target protein according to the instructions of the GST Fusion Protein Purification kit. It was dialyzed in sterile PBS at 4°C for 24 h, and the concentration was determined by the BCA method. It was aliquoted in small amounts and stored at -70°C for later use.

[0073] 2. Identification of the specific antigen fragment of Salmonella typhimurium:

[0074] Take the above purified target protein, first separate it by SDS-PAGE, then transfer the protein from the SDS polyacrylamide gel to a PVDF membrane, and block it with PBST containing 5% skim milk at room temperature with shaking for 2 h; wash it 3 times with PBST with shaking, 5 min each time; add GST monoclonal antibody (Beyotime Institute of Biotechnology, product number: AF2888) diluted 1:1000 and incubate overnight at 4 °C; wash it 5 times with PBST as above; add HRP-goat anti-mouse IgG secondary antibody (ABClone, product number: AS003) diluted 1:5000, and incubate at room temperature with shaking for 1 h; wash it 7 times with PBST as above, develop the color with the chromogenic solution in the dark for 30 s, and take a picture using a hypersensitive multifunctional imager. The results are as Figure 1 、 2 shown. A specific band appears at the expected position, indicating that the specific antigen fragment of Salmonella typhimurium has good immunoreactivity.

[0075] Example 2: Establishment of an indirect ELISA detection method

[0076] 1. Test method:

[0077] Determination of the optimal antigen coating concentration and serum dilution: Using the checkerboard method, coat the antigen (specific antigen fragment P1 of Salmonella typhimurium) diluted to 3, 2, 1, 0.5, 0.25, 0.125 μg / mL respectively with 0.05 M bicarbonate coating buffer in a 96-well enzyme-linked immunosorbent assay (ELISA) plate, 100 μL / well, and coat at 4 °C for 12 h; wash 3 times with PBST, 3 min each time; block with PBS containing 1% BSA at 37 °C for 3 h, then serially dilute the positive serum and negative serum of chicken-derived Salmonella typhimurium (prepare the positive serum by injecting 5×10 6 CFU of Salmonella typhimurium SL1344 into the leg muscle of SPF chickens, and collect the serum of non-immunized SPF chickens as the negative serum) from 1:50 in 8-fold serial dilutions up to 1:6400, 100 μL / well, and react at 37 °C for 1 h; wash 5 times with PBST, 3 min each time; dilute HRP-rabbit anti-chicken IgG (Sigam, product number: A9046) 1:5000 and add 100 μL to each well, and incubate at 37 °C for 1 h; wash 7 times with PBST, 3 min each time; add 100 μL of TMB chromogenic solution to each well and develop the color at 37 °C for 8 min; add 0.5 M H 2 SO 4 termination solution, 50 μL / well to terminate the reaction, and detect the absorbance in the wells at OD 450 nm absorbance, and calculate the P / N value (P / N value = sample OD value / negative control OD value). The closer the OD 450 nm of the positive serum is to about 1.0, and the OD 450nm The closer it is to about 0.1 and the antigen coating concentration and serum dilution at the maximum P / N value are the optimal antigen coating concentration and serum dilution.

[0078] Determination of the optimal antigen coating conditions: According to the determined optimal coating concentration and serum dilution, the antigen is coated at 37°C for 1 and 2 hours respectively, and at 4°C for 12, 14, and 16 hours respectively. The antigen coating conditions at the maximum P / N value are the optimal antigen coating conditions.

[0079] Selection of the optimal blocking solution; According to the above-determined optimal conditions, block with PBS containing 1%, 2%, 5% BSA or PBS with 1%, 2%, 5% skim milk respectively. The blocking solution at the maximum P / N value is the optimal blocking solution.

[0080] Determination of the optimal blocking time: According to the above-determined optimal conditions, block at 37°C for 1 hour, 2 hours, and 3 hours respectively. The blocking time at the maximum P / N value is the optimal blocking time.

[0081] Determination of the optimal serum incubation time: According to the above-determined optimal conditions, incubate the serum for 0.5, 1, 1.5, 2, and 2.5 hours respectively. The serum incubation time at the maximum P / N value is the optimal serum incubation time.

[0082] Determination of the optimal secondary antibody incubation time: According to the above-determined optimal conditions, incubate the secondary antibody for 30, 45, 60, and 75 minutes respectively. The secondary antibody incubation time at the maximum P / N value is the optimal secondary antibody incubation time.

[0083] Determination of the optimal TMB color development time; According to the above-determined optimal conditions, incubate the TBM color development solution for 6, 8, 10, 12, 15, and 18 minutes respectively. The TMB color development time at the maximum P / N value is the optimal TMB color development time.

[0084] Determination of the Cut-off value: According to the above-measured optimal reaction conditions, detect 47 negative sera, measure the absorbance in the detection wells at the OD 450 nm absorbance, and calculate the overall average value (X) and standard deviation (S) based on the obtained OD 450 nm value. According to statistical principles, when the OD 450 value ≥ X + 3S, it is determined to be positive; when the OD 450 value ≤ X + 2S, it can be determined to be negative; when X + 3S ≥ OD 450 value ≥ X + 2S, the sample is determined to be suspicious.

[0085] 2. Test results:

[0086] The optimal coating concentration of the antigen was determined to be 3 μg / mL by the checkerboard method, and the optimal serum dilution was 1:400( Figure 3 A and Figure 3 B). In addition, through repeated experiments on various conditions, the present invention finally obtained the optimal conditions for this detection method as follows: the antigen was coated at a concentration of 3 μg / mL at 4 °C for 14 h( Figure 3 C), using PBS with 1% BSA as the blocking solution and blocking at 37 °C for 3 h( Figure 3 D and Figure 3 E), the serum was diluted at a ratio of 1:400 with the blocking solution and reacted at 37 °C for 2.5 h( Figure 3 F), the HRP-rabbit anti-chicken IgG antibody was diluted at a ratio of 1:5000 and reacted at 37 °C for 0.5 h( Figure 3 G and Figure 3 H), then developed color for 8 min( Figure 3 I), and read the OD 450 value in an enzyme-linked immunosorbent assay reader.

[0087] According to the selected optimal reaction conditions, 47 negative sera were detected, and the measured average value was 0.280 and the standard deviation was 0.093. The cut-off value of this detection method was calculated to be 0.56. According to the above statistical calculation principle: when the OD 450 value ≥ 0.56, it was determined to be positive, indicating the presence of Salmonella typhimurium antibodies in the serum; when the OD 450 value ≤ 0.47, it could be determined to be negative, indicating the absence of Salmonella typhimurium antibodies in the serum; when 0.56 ≥ OD 450 value ≥ 0.47, the sample was determined to be suspicious( Figure 4 ).

[0088] Example 3: Methodology investigation

[0089] The indirect ELISA detection method established in Example 2 was investigated for its methodology, as follows:

[0090] 1. Specificity test:

[0091] According to the established indirect ELISA detection method, the positive sera of strains of Salmonella infantis (Meng Chuang, Wang Fan, Xu Chen, Liu Bowen, Kang Xilong, Zhang Yunzeng, Jiao Xin'an, Pan Zhiming. Prevalence and transmission of Salmonella collected from farming to eggprocessing of layer production chain in Jiangsu Province, China. Poultry Science, 2025, 104(2): 104714.), Salmonella pullorum S06004, Salmonella enteritidis C50041, Escherichia coli E058, and Salmonella typhimurium SL1344 were detected respectively under the selected optimal reaction conditions to determine whether there was intra-genus specificity, and the positive serum of Escherichia coli was detected for serological cross-reaction (the above positive sera were all obtained by injecting 5×10 6 CFU of the corresponding bacterial suspension into SPF chickens).

[0092] The results showed that the positive sera of Salmonella infantis, Salmonella pullorum, Salmonella enteritidis, and Escherichia coli were negative in the detection, and only the positive serum of Salmonella typhimurium was positive, indicating that this detection method has species specificity ( Figure 5 ).

[0093] 2. Sensitivity test:

[0094] The positive serum of Salmonella typhimurium was diluted by different multiples, respectively diluted to 1:100 - 1:12800. Detection was carried out according to the established indirect ELISA detection method to verify its sensitivity.

[0095] The results showed that the positive result could still be determined after dilution by 1:800 times. Thus, it can be seen that this method has good sensitivity ( Figure 6 ).

[0096] 3. Intra-batch and inter-batch repeatability test:

[0097] Six positive sera of Salmonella typhimurium and two negative sera were selected for detection on the same ELISA coated plate, and each serum was repeated 3 times for the intra-batch repeatability test; the same six positive sera of Salmonella typhimurium and two negative sera were selected for detection on ELISA plates coated in 3 different batches, and the OD of the sera was calculated respectively 450The mean value, standard deviation and coefficient of variation.

[0098] The results showed that the coefficients of variation were all less than 10% (Table 1), indicating that this detection method had good repeatability.

[0099] Table 1 Repeatability test

[0100]

[0101]

[0102] Example 4: Clinical serum detection

[0103] The established indirect ELISA kit in Example 2 was used for detection, and 92 clinical sera (from a chicken farm, and all animal experiment operations were carried out in accordance with the relevant regulations of the Laboratory Animal Ethics Committee of Yangzhou University) were detected.

[0104] When 92 sera were detected, the positive rate of Salmonella typhimurium was 11.7%.

Claims

1. A Salmonella typhimurium-specific antigen fragment, characterized in that: Its amino acid sequence is shown in SEQ ID NO.

1.

2. A gene encoding the Salmonella typhimurium-specific antigen fragment according to claim 1.

3. The gene according to claim 2, characterized in that Its nucleotide sequence is shown in SEQ ID NO.

2.

4. Use of the Salmonella typhimurium specific antigen fragment according to claim 1 or the gene according to claim 2 or 3 in the preparation of a reagent or a kit for detecting Salmonella typhimurium antibodies.

5. A reagent or a kit, characterized in that: It contains the Salmonella typhimurium specific antigen fragment as claimed in claim 1.

6. The kit according to claim 5, characterized in that Includes indirect ELISA kits.

7. The kit according to claim 5 or 6, characterized in that The concentration of the Salmonella typhimurium specific antigen fragment is 0.125-3 μg / mL.

8. The kit according to claim 5 or 6, characterized in that: It also contains HRP-rabbit anti-chicken IgG antibody, negative control serum, positive control serum, TMB colorimetric solution and stop solution.

9. Use of the Salmonella typhimurium specific antigen fragment according to claim 1 or the reagent or kit according to claim 3 in detecting Salmonella typhimurium antibodies for non-diagnostic purposes.

10. The use according to claim 9, characterized in that: The following steps are involved: (1) Coating: Coat with a solution of Salmonella typhimurium-specific antigen fragments at a concentration of 0.125 to 3 μg / mL at 4 to 37°C for 1 to 16 hours; (2) Blocking: Blocking with a blocking solution; the blocking solution includes 1-5% BSA or 1-5% skim milk; (3) Adding primary antibody: Add the serum to be tested diluted with blocking solution and incubate; (4) Adding enzyme-labeled secondary antibody: Add diluted enzyme-labeled secondary antibody and incubate; (5) Substrate color development: Add TMB color development solution and incubate in the dark for 6 to 18 minutes; (6) Add stop solution: Measure OD immediately after adding the stop solution 450 value; (7) Judgment: When OD 450 When the value is ≥0.56, it is judged as positive, indicating the presence of Salmonella typhimurium antibodies in the serum; OD 450 When the value is ≤0.47, it can be judged as negative, indicating that there is no Salmonella typhimurium antibody in the serum; 0.56≥OD 450 When the value is ≥0.47, the sample is judged to be suspicious.

Images