An antimicrobial peptide Magainin 2-hEGF fusion protein and its preparation method and application
The antimicrobial peptide Magainin 2-hEGF fusion protein prepared by genetic engineering solves the problems of stability and production efficiency, achieves effective inhibition of bacteria and repair of intestinal damage, and has broad prospects for biomedical applications.
Patent Information
- Application Number
- CN202510263462.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-06
- Publication Date
- 2025-09-30
- Estimated Expiration
- 2045-03-06
AI Technical Summary
Existing antimicrobial peptides have insufficient stability and bioavailability under different conditions (such as pH), and their large-scale production costs and efficiency are low, which limits their clinical application.
The antimicrobial peptide Magainin 2-hEGF fusion protein was prepared by genetic engineering technology. The hEGF amino acid sequence and the Magainin 2 amino acid sequence were connected, and a recombinant vector was constructed after codon optimization. The recombinant vector was transformed into host cells for non-induced expression to obtain a stable antimicrobial peptide fusion protein.
The antimicrobial peptide Magainin 2-hEGF has good stability in different pH and bile salt environments, has significant inhibitory effects on Escherichia coli and Staphylococcus aureus, and can repair intestinal mucosal damage caused by bacterial infection.
Smart Images
Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The present application relates to the technical field of antimicrobial peptides, and in particular to an antimicrobial peptide Magainin 2-hEGF fusion protein and a preparation method and application thereof. Background Art
[0002] Antimicrobial peptides, as a class of short peptides with antimicrobial activity, have received widespread attention in the biomedical field in recent years.
[0003] Antimicrobial peptides primarily act by disrupting the integrity of bacterial cell membranes, leading to leakage of cellular contents and subsequent cell death. In addition to their antimicrobial activity, antimicrobial peptides also exhibit multifunctional properties, including antiviral, antiparasitic, and antitumor properties. This holds great promise for their broad biopharmaceutical applications, particularly in combating drug-resistant bacteria and emerging viruses.
[0004] With the continuous development of genetic engineering technology, research on gene cloning and expression of antimicrobial peptides, modified synthesis, and antimicrobial peptide genetic engineering in plants and animals has gradually become a hot topic. Producing antimicrobial peptides through genetic engineering technology can not only increase production but also modify them to optimize their antimicrobial and other biological activities.
[0005] Despite their impressive performance in laboratory studies, antimicrobial peptides face numerous challenges in clinical application. Chief among these is ensuring their stability and bioavailability under varying conditions, such as pH. Furthermore, the cost and efficiency of large-scale production are significant constraints on their clinical application.
[0006] Therefore, it is necessary to provide a new antimicrobial peptide with good stability. Summary of the Invention
[0007] In order to solve the above technical problems, the present application provides an antimicrobial peptide Magainin 2-hEGF fusion protein and its preparation method and application.
[0008] In a first aspect, the present application provides an antimicrobial peptide Magainin 2-hEGF fusion protein, the amino acid sequence of the antimicrobial peptide Magainin 2-hEGF fusion protein is shown in SEQ ID NO.1.
[0009] In a second aspect, the present application provides a gene encoding the above-mentioned antimicrobial peptide Magainin 2-hEGF fusion protein.
[0010] Preferably, the nucleotide sequence of the gene is shown as SEQ ID NO.2.
[0011] In a third aspect, the present application provides the above-mentioned preparation method, which specifically comprises the following steps:
[0012] The hEGF amino acid sequence and the antimicrobial peptide Magainin 2 amino acid sequence are connected using the enterokinase amino acid sequence, and DNA is synthesized after codon optimization to obtain the gene.
[0013] In a fourth aspect, the present application provides a recombinant vector, characterized in that it is constructed by connecting the above-mentioned gene and an expression vector.
[0014] In a fifth aspect, the present application provides a transformant, characterized in that it is obtained by transforming the above-mentioned recombinant vector into a host cell.
[0015] In a sixth aspect, the present application provides a method for preparing the above-mentioned antimicrobial peptide Magainin 2-hEGF fusion protein.
[0016] The hEGF amino acid sequence and the antimicrobial peptide Magainin 2 amino acid sequence were linked using the enterokinase amino acid sequence;
[0017] or prepared using the above genes;
[0018] or prepared using the above-mentioned recombinant vector;
[0019] Or it can be prepared using the above transformants.
[0020] This application discloses an antimicrobial peptide Magainin 2-hEGF fusion protein, its eukaryotic expression product, and a preparation method. The invention relates to the genetically engineered expression of the antimicrobial peptide Magainin 2 and human epidermal growth factor (hEGF). The amino acid sequence of the fusion protein is shown in SEQ ID NO.1, and the encoding gene sequence is shown in SEQ ID NO.2. After codon optimization, a gene fragment for the fusion protein is constructed, and a recombinant expression vector is further constructed. The recombinant expression vector is transferred into host cells, and the host cells are subjected to non-induced expression to obtain an expression product. The expression product is then isolated and purified to obtain the recombinant protein, namely, the Magainin 2-hEGF fusion protein.
[0021] The antimicrobial peptide Magainin 2-hEGF fusion protein of the present application has a significant inhibitory effect on Escherichia coli and Staphylococcus aureus, has resistance to artificial gastric juice, and repairs intestinal mucosal damage caused by bacterial infection.
[0022] In a seventh aspect, the present application provides an antimicrobial peptide derivative, which is a chemically modified product of the amino acid sequence of the above-mentioned antimicrobial peptide Magainin 2-hEGF fusion protein, wherein the chemical modification includes acetylation, amination, methylation, phosphorylation, glycosylation, lipidation, ubiquitination, biotin labeling or fluorescent protein labeling.
[0023] In an eighth aspect, the present application provides an antimicrobial drug, which includes the above-mentioned antimicrobial peptide Magainin2-hEGF fusion protein, or the above-mentioned antimicrobial peptide derivative; the antimicrobial drug also includes one or more of an adjuvant, a carrier, a diluent, and an excipient.
[0024] In a ninth aspect, the present application provides the use of the above-mentioned antimicrobial peptide Magainin 2-hEGF fusion protein, or the above-mentioned antimicrobial peptide derivative, or the above-mentioned antimicrobial drug in the preparation of a drug for preventing or treating bacterial infection.
[0025] In summary, the technical solution of this application has the following effects:
[0026] The antimicrobial peptide Magainin 2-hEGF fusion protein of the present application has a significant inhibitory effect on Escherichia coli and Staphylococcus aureus, and has good stability in environments with different pH and different bile salt concentrations, and can repair intestinal mucosal damage caused by bacterial infection. BRIEF DESCRIPTION OF THE DRAWINGS
[0027] Figure 1 This is a map of the pGAPZαA-Magainin 2-hEGF recombinant vector in Example 1 of this application.
[0028] Figure 2 This is the linearized electrophoresis diagram of the pGAPZαA-Magainin 2-hEGF recombinant vector in Example 1 of the present application (M: DNA Marker).
[0029] Figure 3 Figure 1 shows the results of colony PCR identification of Magainin 2-hEGF transformants in Example 1 of this application (M: DNA Marker; 1-3: PCR products of three parallel sample yeast monoclonal colonies)
[0030] Figure 4 This is a Coomassie Brilliant Blue staining result of the transformants of the Magainin 2-hEGF fusion protein in Example 1 of the present application (M: protein marker; NC: empty strain control; 1-6: supernatants of 6 parallel samples of positive transformants).
[0031] Figure 5 This is a protein expression detection chart of the transformant of Magainin 2-hEGF fusion protein in Example 1 of the present application (M: protein marker; NC: empty strain control; 1-6: supernatants of 6 parallel samples of positive transformants).
[0032] Figure 6This is a protein expression detection diagram of the transformant of Magainin 2-hEGF fusion protein in Example 1 of the present application (M: protein marker; NC: empty strain control; 7-12: supernatant of 6 parallel samples of positive transformants).
[0033] Figure 7 This is the minimum inhibitory concentration method used in Example 2 of the present application to analyze the inhibitory effects of different concentrations of the antimicrobial peptide Magainin 2-hEGF on Escherichia coli and Staphylococcus aureus (MH: blank MH broth culture medium).
[0034] Figure 8 The inhibition zone method in Example 2 of the present application was used to detect the inhibitory effect of the antimicrobial peptide Magainin 2-hEGF on Escherichia coli and Staphylococcus aureus (Amp is ampicillin, a positive control; ddH2O is water, a negative control; Magainin 2-hEGF: two parallel samples of antimicrobial peptide).
[0035] Figure 9 The results of the PAGE method in Example 3 of this application to detect the effect of different pH on the stability of antimicrobial peptides
[0036] Figure 10 These are the results of the BCA method used in Example 3 of this application to detect the effect of different pH values on the stability of antimicrobial peptides.
[0037] Figure 11 This is the result of the PAGE method used in Example 4 of this application to detect the effect of pig bile salts on the stability of antimicrobial peptides (Blank is a blank test).
[0038] Figure 12 This is the result of the BCA method in Example 4 of this application to detect the effect of pig bile salts on the stability of antimicrobial peptides (Blank is a blank test). DETAILED DESCRIPTION
[0039] The present application is further described in detail below with reference to the embodiments. These embodiments should not be construed as limiting the scope of protection claimed in the present application. Example Example 1
[0040] Example 1 provides an antimicrobial peptide Magainin 2-hEGF fusion protein.
[0041] The specific method for constructing the genetically engineered bacteria that secrete and express the antimicrobial peptide Magainin 2-hEGF fusion protein without induction in Example 1 is as follows.
[0042] (1) Construction of the Pichia pastoris recombinant expression vector pGAPZαA-Magainin 2-hEGF
[0043] The hEGF amino acid sequence and the antimicrobial peptide Magainin 2 amino acid sequence were connected using the enterokinase amino acid sequence, and the amino acid sequence is shown in SEQ ID NO.1.
[0044] After codon optimization, DNA was synthesized and connected at both ends using EcoR I and Sal I restriction sites, respectively. The DNA sequence (5'-3') is shown in SEQ ID NO.2. The synthesized DNA fragment was then subcloned into the pGAPZαA vector to construct a recombinant constitutive secretory expression vector (such as Figure 1 The map of the pGAPZαA-Magainin 2-hEGF recombinant vector is shown). The DNA sequence was verified by sequencing and enzyme digestion. Synthesis was completed by Nanjing GenScript Biotechnology Co., Ltd.
[0045] (2) Preparation of competent cells
[0046] Before transformation, prepare competent Pichia pastoris cells as follows: Pick a single yeast colony and inoculate it into 4 mL of YPD liquid medium. Cultivate overnight at 30°C, 250-300 rpm. Inoculate 300 µL of this culture into 300 mL of YPD liquid medium. Cultivate overnight at 30°C, 250-300 rpm, to an OD600 of 1.3-1.5. Harvest the cells: Centrifuge 50 mL of each tube of culture at 1500 g for 5 minutes at 4°C. Resuspend the pellet in 50 mL of ice-cold sterile water and repeat the centrifugation. Repeat the wash and centrifugation steps. Resuspend the pellet in 4 mL of ice-cold 1 M sorbitol solution and repeat the centrifugation. Resuspend the pellet in 200 µL of ice-cold 1 M sorbitol solution. Aliquot 80 µL of this aliquot for use the same day and store the remaining aliquot at -80°C. Prolonged storage may affect transformation efficiency and is valid for two weeks.
[0047] (3) Vector linearization
[0048] The pGAPZαA-Magainin 2-hEGF recombinant vector was linearized using Avr Ⅱ restriction endonuclease (electrophoresis is shown in Figure 2). Figure 2 The reaction system is as follows: 10×QuickCut Buffer: 1-5 µL; carrier DNA: 1 µg; Avr II: 1 µL; sterile water: 10-50 µL.
[0049] Mix gently, then centrifuge briefly. Incubate in a PCR machine at 37°C for 5 minutes. Run an aliquot of DNA on an agarose gel to ensure complete linearization of the vector. Inactivate the enzyme using heat inactivation or EDTA, extract once with phenol / chloroform, and precipitate the DNA with 1 / 10 volume of 3 M sodium acetate and 2.5 volumes of absolute ethanol. After centrifugation, wash the pellet with 80% ethanol, air dry, and dissolve the DNA in 10 µL of DEPC-treated water. The DNA can be used directly for electroporation or stored at -20°C.
[0050] (4) Electrotransformation of Pichia pastoris
[0051] The linearized pGAPZαA-Magainin 2-hEGF plasmid was transformed into prepared Pichia pastoris competent cells by electroporation using the BIO-RAD Gene Pulser Xcell Total Electroporation System (Cat. No. 165-2660). The time constant should be approximately 5 milliseconds and the voltage should be approximately 2.0 kV. Immediately incubate the transformed cells at 30°C for 1 hour. Add 1 mL of 1 M sorbitol and continue incubating for another hour. Then, plate various cell volumes onto two to three YPD agar plates containing zeocin and incubate the plates inverted at 30°C for 72-96 hours.
[0052] (5) Screening and identification of positive transformants
[0053] Individual colonies were picked from the incubated plates and identified by PCR. After picking, 10 µL of sterile water and 5 µL of lytic enzyme were added and incubated at 30°C for 10 min, followed by -80°C for 10 min. PCR reactions were then performed using this colony as a template. The upstream primer sequence was GTCCCTATTTCAATCAATTGAA, and the downstream primer sequence was GCAAATGGCATTCTGACATCC. The PCR reaction system consisted of 5 µL of 10× Reaction Buffer, 5 µL of 25 mM MgCl₂, 1 µL of 25 mM dNTPs, 1 µL of the upstream primer, 1 µL of the downstream primer, 27 µL of sterile water, and 5 µL of Cell Lysate in a total volume of 45 µL. After incubation at 95°C for 5 min, 5 µL of Taq enzyme was added. The PCR program was as follows: denaturation at 95°C for 1 min, annealing at 54°C for 1 min, annealing at 72°C for 7 min, 30 cycles, and extension at 72°C for 7 min. The results of colony PCR identification of Magainin 2-hEGF transformants are as follows Figure 3 As shown, the results showed that two Magainin 2-hEGF positive transformants were obtained and the size of the PCR product fragment was consistent with the expectation.
[0054] (6) Expression test and product testing
[0055] Positive transformants were shaken briefly and re-plated. Twelve single colonies were selected and shaken briefly and then medium shaken. The medium shake supernatant was collected and total protein was extracted from the supernatant as follows: 800 µL of fermentation broth was centrifuged at 12,000 rpm / min for 1 minute. The supernatant was collected and 400 µL of methanol was added. Mix thoroughly, then 140 µL of chloroform was added. Mix again and place on ice for 5 minutes. Centrifuge at 12,000 rpm / min for 5 minutes, discard the supernatant, and wash the protein precipitate with 400 µL of methanol. Centrifuge at 12,000 rpm / min for 5 minutes, discard the supernatant, and dry at 55°C.
[0056] Coomassie Brilliant Blue staining and immunoblotting were used to detect the expression of target protein. Figure 4 The protein expression test results of Magainin 2-hEGF transformants are shown in Figure 5-6 The results showed that all 12 transformants expressed the target protein, with monoclonal strains 2 and 8 expressing higher levels than the other transformants. The differences in the positions of the target bands may be due to sample loading and electrophoresis conditions.
[0057] (7) Optimization of fermentation conditions
[0058] A three-factor, three-level orthogonal experiment was designed using carbon source (glycerol), initial pH, and inoculum size as single factors. The optimal fermentation conditions were determined using orthogonal experiments. The optimal fermentation time was determined by fermenting the strains under these optimal conditions for 24, 48, 72, and 96 h. The results of the orthogonal experiments are shown in Table 1. The strain grew most actively when the glycerol concentration in the shake flasks was 2%, the pH was 5, and the inoculum size was 0.5%. Subsequent experiments confirmed that the optimal fermentation time was 72 h.
[0059] Table 1 Optimization results of orthogonal experiment of fermentation conditions
[0060] Example 2
[0061] This example provides the inhibitory effect of the antimicrobial peptide Magainin 2-hEGF on Escherichia coli and Staphylococcus aureus.
[0062] To determine the inhibitory activity of the antimicrobial peptide Magainin 2-hEGF against Gram-negative and Gram-positive bacteria, the inhibitory zone assay and minimum inhibitory concentration assay were used to analyze the inhibitory activity of the antimicrobial peptide against Escherichia coli and Staphylococcus aureus, respectively. Magainin 2-hEGF was synthesized using solid-phase synthesis and purified by HPLC to a purity greater than 95%. The peptide was dissolved in saline and stored in aliquots at -20°C until further use.
[0063] In the minimum inhibitory concentration method, different concentrations of the antimicrobial peptide Magainin 2-hEGF were used to treat Escherichia coli and Staphylococcus aureus respectively, and the antibacterial efficiency of the peptide was observed after 18 hours of culture. Figure 7 The results showed that the minimum inhibitory concentration of the antimicrobial peptide Magainin 2-hEG against Escherichia coli was about 640 μg / mL, and the minimum inhibitory concentration against Staphylococcus aureus was about 80 μg / mL.
[0064] Subsequently, the inhibition zone method was used to further analyze the inhibitory effects of antimicrobial peptides on these two bacteria; the results were as follows: Figure 8 The results showed that the antibacterial Magainin 2-hEG has the effect of inhibiting Escherichia coli and Staphylococcus aureus. Example 3
[0065] This example provides information on the effect of pH on the stability of the antimicrobial peptide Magainin 2-hEGF.
[0066] To clarify the effect of different pH on the stability of the antimicrobial peptide Magainin 2-hEGF, the antimicrobial peptide was placed in solutions with pH values of 2, 3, 4, 5, 6, 7, 8, and 9. After 4 h, the amount of the antimicrobial peptide was detected by PAGE and BCA methods, respectively.
[0067] The results are as follows Figure 9 、 10 As shown in the results, it was found that the stability of the antimicrobial peptide Magainin 2-hEGF was not significantly affected in the pH range of 2-9. Example 4
[0068] This example provides the effect of bile salts on the stability of the antimicrobial peptide Magainin 2-hEGF.
[0069] To analyze the effect of bile salts on the stability of the antimicrobial peptide Magainin 2-hEGF, the antimicrobial peptide was treated with porcine bile salts at concentrations ranging from 0.03% to 1% for 4 hours. The amount of the antimicrobial peptide Magainin 2-hEGF was determined using PAGE and BCA assays, respectively. A solution without porcine bile salts was used as a blank test.
[0070] The results are as follows Figure 11-12 As shown in the results, the effect of porcine bile salt on the stability of antimicrobial peptide Magainin 2-hEGF was not significant.
[0071] Although the present invention has been described in detail above using general descriptions and specific embodiments, it will be apparent to those skilled in the art that modifications and improvements may be made based on the present invention. Therefore, such modifications and improvements, which do not depart from the spirit of the present invention, are intended to be within the scope of protection claimed herein.
Claims
1. An antimicrobial peptide Magainin 2-hEGF fusion protein, the amino acid sequence of the antimicrobial peptide Magainin 2-hEGF fusion protein is shown in SEQ ID NO.
1.
2. A gene, characterized in that The gene is a gene encoding the antimicrobial peptide Magainin 2-hEGF fusion protein according to claim 1.
3. The gene according to claim 2, characterized in that The nucleotide sequence of the gene is shown in SEQ ID NO.
2.
4. The method for preparing a gene according to claim 2, wherein: The specific steps include: The hEGF amino acid sequence and the antimicrobial peptide Magainin 2 amino acid sequence are connected using the enterokinase amino acid sequence, and DNA is synthesized after codon optimization to obtain the gene.
5. A recombinant vector, characterized in that The gene is constructed by connecting the gene according to any one of claims 2 to 3 with an expression vector.
6. A transformant, characterized in that The method is obtained by transforming the recombinant vector according to claim 5 into a host cell.
7. The method for preparing the antimicrobial peptide Magainin 2-hEGF fusion protein according to claim 1, wherein: The hEGF amino acid sequence and the antimicrobial peptide Magainin 2 amino acid sequence were linked using the enterokinase amino acid sequence; or prepared using the gene according to any one of claims 2-3; Or prepared using the recombinant vector according to claim 5; Or it can be prepared using the transformant according to claim 6.
8. An antibacterial drug, characterized in that The antimicrobial drug comprises the antimicrobial peptide Magainin2-hEGF fusion protein according to claim 1; the antimicrobial drug further comprises one or more of an adjuvant and a carrier.
9. Use of the antimicrobial peptide Magainin 2-hEGF fusion protein according to claim 1 or the antimicrobial drug according to claim 8 in the preparation of a drug for preventing or treating bacterial infection; the bacteria is Escherichia coli or Staphylococcus aureus.