Rice negative regulation of cold tolerance gene wrky51 and application thereof

Abstract

The present application relates to a kind of rice negative regulation cold tolerance gene WRKY51, the gene has as (a) as shown in SEQ ID No:1 Nucleotide sequence composition;(b) the nucleotide sequence shown in SEQ ID No:1 It is generated by adding, substituting or deleting one or several bases, and the nucleotide sequence of rice bud stage cold tolerance functional protein is encoded.The present application belongs to the technical field of genetic engineering.The present application improves the cold tolerance of rice bud stage by knocking down the expression level of the gene.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to the rice negative regulatory cold tolerance gene WRKY51 and its applications. Background Technology

[0002] Rice originated in tropical regions and is a low-temperature sensitive crop; low temperatures severely limit its cultivation in high-latitude, high-altitude areas. The rice germination stage refers to the period from seed germination to the unfolding of the first true leaf, lasting approximately 7 to 10 days. During this stage, the seedling primarily relies on nutrients stored within the seed for growth, while the root system begins to develop to absorb water and nutrients from the soil. Suitable temperature and humidity conditions are required for rice seed germination. After absorbing water, the embryo begins to grow, breaking through the seed coat to form a seedling. The length of the germination period is affected by environmental conditions; excessively low temperatures can lead to low germination rates and negatively impact rice growth.

[0003] Furthermore, abundant rice resources contain many cold-resistant genes. Discovering and identifying superior genes can broaden the gene sources and enrich the genetic background for rice breeding. Discovering and utilizing cold-resistant genes in rice is a pressing practical problem. However, these genes require verification through transgenic methods or by constructing populations and near-isogenic lines. Discovering cold-resistant genes from natural variations obtained from rice plants presents significant challenges. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings of the prior art and provide a cold-resistant gene for rice during the booting stage and its application.

[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0006] In a first aspect, the present invention provides a rice negative regulatory cold tolerance gene WRKY51, said gene having the following nucleotide sequence (a) or (b):

[0007] (a) The nucleotide sequence as shown in SEQ ID No:1;

[0008] (b) The nucleotide sequence shown in SEQ ID No:1 is generated by adding, substituting or deleting one or more bases and encodes a nucleotide sequence that encodes a cold-resistant functional protein in rice bud stage.

[0009] Secondly, the present invention provides the application of the WRKY51 gene described in the first aspect in regulating cold tolerance during rice budding stage.

[0010] As a preferred embodiment of the second aspect, the WRKY51 gene improves the cold tolerance of rice during the germination stage by reducing its expression level.

[0011] Thirdly, the present invention provides a cold-resistant protein for rice budding stage, the protein being encoded by the gene described in the first aspect.

[0012] Fourthly, the present invention provides the application of the protein described in the third aspect in regulating the cold tolerance of rice during the germination stage.

[0013] Fifthly, the present invention provides a recombinant vector containing nucleotides as shown in SEQ ID No:2-5, wherein the recombinant vector can reduce the expression level of the gene described in claim 1.

[0014] In a sixth aspect, the present invention provides a biomaterial comprising the recombinant vector described in the fifth aspect.

[0015] As a preferred embodiment of the sixth aspect, the biological material is a recombinant microorganism, a transgenic plant cell line, or a transgenic plant tissue; the recombinant microorganism is a bacterium, yeast, algae, or fungus; the bacterium is one of Escherichia coli, Erwinia spp., Agrobacterium tumefaciens, Flavobacterium, Alcaligenes, Pseudomonas, or Bacillus.

[0016] In a seventh aspect, the present invention provides the application of the recombinant vector described in the fifth aspect or the recombinant microorganism described in the sixth aspect in regulating the cold tolerance of rice during the germination stage.

[0017] Eighthly, the present invention provides a method for cultivating cold-resistant transgenic rice during the germination stage. The method utilizes a gene knockout tool to knock out the WRKY51 gene in the recipient rice, thereby reducing the expression level of the WRKY51 gene in the recipient rice and obtaining cold-resistant transgenic rice during the germination stage.

[0018] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0019] This invention identified the gene WRKY51, which is associated with cold tolerance during rice budding. The loss of function of WRKY51 yields cold-tolerant rice, demonstrating that the protein encoding this gene or its protein plays a crucial role in controlling cold tolerance during rice budding. This invention not only provides a foundation for further elucidating the molecular mechanisms of rice cold tolerance but also offers new gene and breeding resources for rice breeding. The transgenic rice with the WRKY51 gene loss obtained in this invention, as a new rice germplasm material, can be used to study the mechanisms of cold tolerance during rice budding and to discover more genes regulating cold tolerance during this period. It has significant application value for effectively regulating rice grain shape using this gene resource through genetic breeding and genetic engineering methods. Attached Figure Description

[0020] Figure 1 A schematic diagram of sequencing results for WRKY51 gene knockout rice;

[0021] Figure 2 A schematic diagram showing the germination rate of rice after different cold treatments;

[0022] Figure 3 This is a schematic diagram comparing the germination rates of different rice varieties. Detailed Implementation

[0023] To better illustrate the purpose, technical solution, and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.

[0024] Example 1

[0025] The technical scheme for constructing the WRKY51 gene knockout vector, which is related to rice grain shape growth and development, is as follows:

[0026] Using reverse transcribed cDNA from the Nipponbare rice variety as a template, PCR amplification was performed using the following primers to obtain the target genes Target1 and Target2:

[0027] MT1-BsF: ATATATGGTCTCTGGCGAGTTCAAGAAGGTGATCTCGTT (SEQ ID No: 2)

[0028] MT1-F0:GAGTTCAAGAAGGTGATCTCGTTTTAGAGCTAGAAATAGC(SEQ ID No:3)

[0029] MT2-R0:AACCGCCGGAACCGCGCGTGGCCCGCTTCTTGGTGCC(SEQ IDNo:4)

[0030] MT2-BsR:ATTATTGGTCTCTAAACCGCCGGAACCGCGCGTGGCC(SEQ ID No:5)

[0031] Target1: CCNAGTTCAAGAAGGTGATCTCC (SEQ ID No: 6)

[0032] Target2: GGCCACGCGCGGTTCCGGCNGGG (SEQ ID No: 7)

[0033] T2-reverse:CCNCGCCGGAACCGCGCGTGGCC(SEQ ID No:8)

[0034] WRKY51 gene nucleotide sequence:

[0035] ATGATTACCATGGATCTGATGGGTGGGTACGGGCGGGTGGACGAGCAGGTGGCCATCCAGGAGGCGGCGGCGGCGGGGCTAAGGGGGATGGAGCATCTTATTCTGCAGCTGTCCCAGACTGGGACGAGCGAGAGGTCGCCGGCGCCGGCGCAGGAGCAGCAGCAACAGGTGGACTGCAGGGAGATCACGGACATGACGGTGTCCAAGTTCAAGAAGGTGATCTCCATGCTGAACCGCACCGGCCACGCGCGGTTCCGGCGGGGCCCGGTGGTGGCGCAGTCGTCGGGCCCGGCGGCGTCCGAGCCGGCGCCGGTGAGGTCGTCCCCGTCGGCGGTGTCGAGGCCCATGACGCTCGACTTCACCAAGGCGGCGTCCGGGTACGGCAAGGACGCCGGGTTCAGCGTCTCCGGCATCTCCGCCGCGAGCTCGTCCTTCCTCTCGTCGGTCACCGGCGACGGCAGCGTGTCCAACGGGCGCGGCGGCGGGTCATCCTCCCTGATGCTTCCCCCGCCGCCGGCGACCAGCTGCGGCAAGCCACCGCTGTCCTCCGCCGCCGCCGCCATGTCAGCCGGCGCAGGCCACAAGCGCAAGTGCCACGACCACGCGCACTCCGAGAACGTCGCCGGCGGCAAGTACGGATCCACCGGCGGCCGCTGCCACTGCTCCAAGCGCCGGAAGCATCGGGTGAAGAGGACGATCCGCGTGCCGGCGATAAGCTCGAAGGTGGCGGACATCCCCGCCGACGACTTCTCGTGGCGGAAGTACGGGCAGAAGCCCATCAAGGGCTCCCCCTTCCCACGAGGATACTACAAGTGTAGCACGCTGCGCGGTTGCCCGGCGAGGAAGCACGTGGAGCGCGACCCGACCGACCCGTCCATGCTCATCGTCACCTACGAGGGCGAGCACCGCCACTCCCCCTCCGCCGCCGGCCAGGACCACCCGCCGGCGCCGCCTCCGCCGCTGGCGCTGCCGCTCGCCTGA(SEQ ID No:1)

[0036] 1. Construction of CRISPR / Cas9 vectors

[0037] (1) Primer design: Two target sites were screened on the first exon of OsRT1 in IL153 using an online website (http: / / crispor.tefor.net / ). Based on the target sites, primers were designed: Target 1: MT1-BsF / BsR, Target 2: MT2-F0 / R0 (Note: Replace the 19-nt in primer F0 / BsF with one 19-nt target sequence; replace the 19-nt in -R0 / BsR with the inverted complementary sequence of the other 19-nt target).

[0038] (2) Obtaining the target fragment: The intermediate vector pCBC-MT1T2 (from Shanghai Shizhi Biotechnology) diluted 100 times was used as a template for four-primer PCR amplification (MT1-BsF / MT2-BsR primers were at normal primer concentrations; MT1-F0 / MT2-R0 primers were diluted 20 times). The Tks Gflex DNA polymerase PCR amplification system and program were used.

[0039] (3) The target PCR product was extracted by agarose gel electrophoresis according to the DNA gel extraction kit.

[0040] (4) Establish an enzyme digestion-ligation system

[0041] Enzyme digestion-ligation system (15 μL): 2 μL PCR-recovered fragment (964 bp), 2 μL pBUE411 plasmid, 1.5 μL 10×T4 buffer, 1.5 μL T4 ligase, 1 μL BsaI, 1 μL 10×Cutsmart buffer, and bring the volume to 15 μL. Reaction conditions: 37℃ for 5 hours; 50℃ for 5 minutes; 80℃ for 10 minutes.

[0042] (5) Heat shock method for transforming Escherichia coli

[0043] Take 5 μL of the ligation product from (4) and transform it into E. coli using the heat shock method. Refer to the Tiangen Transformation Kit for specific steps.

[0044] (6) PCR verification of bacterial culture

[0045] Single colonies were picked from the clean bench and used as templates for PCR amplification, employing the Taq DNA polymerase PCR amplification system and procedure.

[0046] (7) Plasmid mini-extraction: In this experiment, plasmids were extracted and their concentrations were detected in accordance with the instructions of the Tiangen plasmid mini-extraction kit to obtain the CRISPR / Cas9-WRKY51 gene editing CRISPR / Cas9 plasmid vector.

[0047] II. PCR identification and extraction of CRISPR / Cas9-WRKY51 transgenic plants with the WRKY51 gene knocked out, which is related to cold tolerance during rice germination.

[0048] Cultivation of CRISPR / Cas9-WRKY51 transgenic plants: The recombinant vector CRISPR / Cas9-WRKY51 was transformed into Nipponbare japonica rice via Agrobacterium tumefaciens EHA105 to obtain T0 generation seedlings of CRISPR / Cas9-WRKY51 transgenic plants (hereinafter referred to as KO1 and KO2 in the attached diagram). Genomic DNA was extracted from the T0 generation seedlings of KO1 and KO2 plants and the seedlings of the recipient parent rice, Nipponbare japonica rice (hereinafter referred to as Nip in the attached diagram). Positive seedlings were identified by PCR molecular detection using the following primers, and sequence verification was performed. Homozygous plants with sequence mutations, namely KO-1 and KO-2 mentioned above, were identified. Figure 1 );

[0049] WRKY51-Detection F: GTGGACTGCAGGGAGATCAC (SEQ ID No: 9)

[0050] WRKY51-Detection R: GTCATGGGCCTCGACACC (SEQ ID No: 10)

[0051] PCR system:

[0052] PCR SuperMix (+dye) 5μl, primer 3 (100ng / ml) 1μl, primer 4 1μl, DNA 1μl, ddH2O 2μl amplification program:

[0053] 94℃ for 2 minutes;

[0054] ↓

[0055] 98℃ for 10 seconds;

[0056] 55℃ for 30 seconds;

[0057] 68℃ 1min. / kb 25~40cycles.

[0058] III. Identification of WRKY51 sequencing results in transgenic plants with the WRKY51 gene knocked out, which is related to cold tolerance during rice germination:

[0059] DNA was extracted from the leaves of KO1 and KO2 plants and the recipient parent rice Nipponbare (NIP) obtained in the above-mentioned "II. PCR Identification of Transgenic Plants with Knockout of the Rice Germination Cold Tolerance-Related Gene WRKY51". PCR reactions were performed using the WRKY51 gene detection primers WRKY51-detection F and WRKY51-detection R, followed by sequencing to detect the loss of the WRKY51 gene in different transgenic plants. The results showed that ( Figure 1 In positive plants transformed with the recombinant vector Cas9-WRKY51, a fragment of the WRKY51 gene was deleted compared to the control group (Nip). The primers used are as follows:

[0060] Actin-F: 5'-ATTTGGCACCACACATTCTAC-3' (SEQ ID No: 11)

[0061] Actin-R:5'-ATAACCTTCGTAGATTGGGACT-3'(SEQ ID No:12)

[0062] WRKY51-Detection F: 5'-GTGGACTGCAGGGAGATCAC-3' (SEQ ID No: 13)

[0063] WRKY51-Detection R: 5'-GTCATGGGCCTCGACACC-3' (SEQ ID No: 14)

[0064] IV. Phenotypic Identification of Transgenic Plants with WRKY51 Knockout, a Gene Encoding Cold Tolerance During Rice Germination Stage

[0065] The KO1 and KO2 transgenic plants obtained from the above-mentioned "II. PCR identification and extraction of rice KO1 and KO2 transgenic plants with WRKY51 knocked out during germination" and the recipient parent rice Nipponbare were planted at the Hainan experimental base. After harvesting pure lines, the seeds of Nipponbare and the transgenic lines were germinated in a laboratory artificial climate chamber at a ratio of 30 seeds / petrel, with 3 replicates for each line. After the sprouts reached 5 mm in length, they were placed in moist filter paper and petri dishes and subjected to a low-temperature treatment at 4℃ for 12 days. After treatment, they were placed at room temperature, and the survival rate was investigated after 7 days. The measurement and observation results are as follows: Figure 3 Table 1 shows that, compared with the recipient parent rice Nipponbare (Nip) plants, the WRKY51 knockout plants (KO1, KO2) all showed a higher survival rate of rice seedlings under low temperature during the germination stage than the control, thus proving that the WRKY51 gene is involved in controlling rice germination stage cold tolerance, that is, the WRKY51 gene is a gene related to rice germination stage cold tolerance.

[0066] Table 1: Cold tolerance at the bud stage in rice plants with the WRKY51 gene knockout.

[0067]

[0068] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. The application of the WRKY51 gene in regulating cold tolerance during rice budding stage, characterized by: The cold tolerance of rice during the germination stage is improved by reducing the expression level of the WRKY51 gene; the nucleotide sequence of the WRKY51 gene is shown in SEQ ID No:

1.

2. The application of the protein encoded by the WRKY51 gene in regulating cold tolerance during rice germination, characterized by: The cold tolerance of rice during the germination stage is improved by reducing the expression level of the protein encoded by the WRKY51 gene, the nucleotide sequence of which is shown in SEQ ID No:

1.

3. A method for improving the cold tolerance of rice during the germination stage, characterized in that, The method utilizes a gene knockout tool to knock out the WRKY51 gene in recipient rice, thereby reducing the expression level of the WRKY51 gene in recipient rice and obtaining transgenic rice with improved cold tolerance during the germination stage; the nucleotide sequence of the WRKY51 gene is shown in SEQ ID No:1.

Images