Application of Vitellogenin Gene in Regulating Lipid Metabolism and Crawling Behavior of Bees

Through mixed siRNA microinjection of yolkin protein genes, the Vg gene expression in the brain of bees is significantly inhibited, and the lipid metabolism and crawling behavior of bees is regulated, which solves the problems of siRNA instability and complexity in the existing technology, and achieves efficient and accurate bee behavior regulation.

CN120092756BActive Publication Date: 2025-08-01INST OF QUALITY STANDARD & TESTING TECH FOR AGRO PROD OF CAAS
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510197301.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-21
Publication Date
2025-08-01
Estimated Expiration
2045-02-21

AI Technical Summary

Technical Problem

In the prior art, siRNA has problems such as unstable knockdown effect and complex screening work in the regulation of bee behavior, and it is difficult to efficiently regulate bee crawling behavior and lipid metabolism.

Method used

Mixed siRNAs with specific sequences of yolkin genes are used to inject them into the brain of bees to regulate lipid metabolism and crawling behaviors by overexpressing or inhibiting yolkin gene expression.

Benefits of technology

Microinjection of mixed siRNA significantly inhibited the expression of Vg gene in bee brain, regulated bee lipid metabolism, significantly inhibited bee crawling behavior, and did not affect bee survival.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120092756B_ABST
    Figure CN120092756B_ABST
Patent Text Reader

Abstract

The present invention discloses the application of the vitellogenin gene in regulating lipid metabolism and crawling behavior of bees. The present invention is a new technology for regulating lipid metabolism and crawling behavior of bees by knocking down the expression of the vitellogenin gene. Specifically, a mixture of siRNAs with three specific sequences is microinjected into the bee brain to inhibit the expression of the vitellogenin (Vg) gene. Thereby, to explore its possible role in regulating lipid metabolism and crawling behavior of bees. The results show that after microinjecting the mixed siRNAs, the expression of the Vg gene in the bee brain is significantly inhibited, the lipid metabolism of bees is significantly regulated, and the crawling behavior of bees is inhibited. At the same time, the behavior regulation technology involved in the present invention is friendly to bees.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to the application of the vitellogenin gene in regulating lipid metabolism and crawling behavior of bees. Background Art

[0002] As important pollinating insects, bees play an indispensable role in agricultural production. As social insects, the various behaviors of bees are crucial for the highly organized bee colony. In the bee colony, bees have behaviors such as crawling, flying, nest building, nursing, and foraging. The special behaviors of bees are closely related to the expression levels of specific genes in the brain.

[0003] With the development of molecular biology techniques, the gene knockdown technique provides a new idea for bee behavior regulation. Small interfering RNA (siRNA) is about 22 nt in length and silences the expression of target genes by hybridizing with complementary mRNA molecules. This interference triggers mRNA degradation, thereby inhibiting the gene expression of specific genes. siRNA has high efficiency and simplicity in gene silencing, but single siRNA often has problems such as poor stability of knockdown effect and complex screening work; while mixing multiple siRNAs can reduce the screening workload and improve the stability of the knockdown effect. Summary of the Invention

[0004] The present invention relates to the application of the vitellogenin gene in regulating lipid metabolism and / or crawling behavior of bees.

[0005] Preferably, it is the application of a preparation for regulating the expression level of the vitellogenin gene in preparing a preparation for regulating the crawling speed of bees.

[0006] Preferably, the bees are Apis mellifera ligustica.

[0007] Preferably, the preparation for regulating the expression level of the vitellogenin gene is an overexpression agent or an inhibitor of the vitellogenin gene.

[0008] Preferably, the inhibitor of the vitellogenin gene is siRNA, which is Vg_3408, Vg_2276 or Vg_2641 or a mixture thereof. The 5'→3' sequence sense strand of Vg_3408 is GCAGAAAGAUCCUGUGAUAdT dT, and the antisense strand is UAUCACAGGAUCUUUCUGCdTdT; the 5'→3' sequence sense strand of Vg_2276 is GGAAAGAUCUCGCGAAGAAdTdT, and the antisense strand is UUCUUCGCGAGAUCUUUCCdTdT; the 5'→3' sequence sense strand of Vg_2641 is GAAGGAAACUUGAUGAUAAdTdT, and the antisense strand is UUAUCAUCAAGUUUC CUUCdTdT.

[0009] The second object of the present invention is to provide a preparation for regulating the crawling speed of bees, which contains a preparation for regulating the expression level of the vitellogenin gene.

[0010] Preferably, the bees are Apis mellifera ligustica.

[0011] Preferably, the preparation for regulating the vitellogenin gene is an overexpression agent of the vitellogenin gene or an inhibitor of the vitellogenin gene.

[0012] Preferably, the regulation of bee lipid metabolism is such that the levels of 13 lipids, namely PE P-18:3_16:0, PC O-18:5_22:6, PC 20:0_18:3, TG 18:2_18:2_19:3;O, Cer 14:1;O2 / 18:0, SM 14:1;O2 / 21:0, SM 16:1;O2 / 24:1, PCO-16:0_14:0, SM 16:1;O2 / 20:0, TG 16:0_20:3_18:3;O3, PC O-18:3_18:0, SM 21:0;O2 / 21:1, PC 20:0_20:0, are significantly increased; while the levels of 11 lipids, namely PC 18:1_18:3, PC 16:1_18:2, PC 18:0_18:3, PC 18:0_18:1, PC O-18:0_18:3, PC 18:1_18:1, PC 16:0_18:3, NAE 20:1, SM 14:0;O2 / 20:0, SM 14:1;O2 / 20:0, PC 16:0_18:1, are significantly decreased.

[0013] Preferably, the inhibitor of the vitellogenin gene is siRNA.

[0014] The present invention also provides a method for suppressing the crawling speed of bees, which is to inject an inhibitor of the vitellogenin gene into the bee brain. Preferably, the inhibitor of the vitellogenin gene is siRNA of the vitellogenin gene.

[0015] In the present invention, the expression of the vitellogenin gene is knocked down by microinjecting a mixed siRNA into the bee brain to regulate the crawling behavior of bees, aiming to provide a more efficient and precise bee behavior regulation strategy.

[0016] The present invention is a new technology for regulating the crawling behavior of bees by knocking down the expression of the vitellogenin gene. Specifically, a mixed siRNA with three specific sequences is microinjected into the bee brain to inhibit the expression of the vitellogenin (Vg) gene. Thus, its possible role in regulating the crawling behavior of bees is explored. The results show that after microinjecting the mixed siRNA, the expression of the Vg gene in the bee brain is significantly inhibited, the lipid metabolism of bees is significantly regulated, and the crawling behavior of bees is inhibited. At the same time, the behavior regulation technology involved in the present invention is friendly to bees.

[0017] The beneficial effects of the present invention are as follows:

[0018] (1) Microinjecting the mixed siRNA into the bee brain significantly inhibits the expression of the Vg gene.

[0019] (2) Microinjecting the mixed siRNA into the bee brain regulates the lipid metabolism of bees (24 lipid levels in the experimental group change significantly, and 3 lipid metabolic pathways are significantly enriched).

[0020] (3) Microinjecting the mixed siRNA into the bee brain effectively inhibits the crawling behavior of bees (the crawling trajectory of the experimental group is disordered, the crawling speed is extremely significantly slowed down, and the crawling distance is extremely significantly shortened).

[0021] (4) Microinjecting the mixed siRNA is a bee-friendly behavior regulation technology (it does not affect the survival rate of bees). Description of the Drawings

[0022] Figure 1 is the expression level of the Vg gene in the bee brain. After microinjecting the mixed siRNA, the expression level of the Vg gene in the bee brain is significantly lower than that of the negative control group, the control group, and the blank group (p = 0.031 < 0.05).

[0023] Figure 2 is the PCA model of the lipids in the bee brain. The quality control points are aggregated, and the data collection is stable and reliable. After microinjecting the mixed siRNA, the lipid composition in the bee brain is significantly different from that of the control group.

[0024] Figure 3It is a heatmap of the content levels of significantly different lipids in the bee brain. After microinjecting the mixed siRNA, there are 24 significantly different lipids in the bee brain compared with the control group, among which the levels of 13 lipids increase significantly and the levels of 11 lipids decrease significantly (p<0.05).

[0025] Figure 4 It is the KEGG enrichment pathway of 24 significantly different lipids in the bee brain. After microinjecting the mixed siRNA, the significantly different lipids in the bee brain are significantly enriched in sphingolipid metabolism: integrated pathway, sphingolipid pathway and Kennedy pathway of sphingolipids (p<0.05).

[0026] Figure 5 It is a schematic diagram of the crawling behavior test device for bees.

[0027] Figure 6 It is the crawling track of bees. After microinjecting the mixed siRNA, the crawling track of bees is more disordered than that of the control group.

[0028] Figure 7 It is the crawling distance of bees. Microinjecting the mixed siRNA significantly inhibits the crawling distance of bees.

[0029] Figure 8 It is the crawling speed of bees. Microinjecting the mixed siRNA significantly inhibits the crawling speed of bees.

[0030] Figure 9 It is the survival curve of bees. There is no significant difference in the survival curve of bees among the groups microinjected with the mixed siRNA, the control group and the blank group. Specific implementation manners

[0031] The following examples are further descriptions of the present invention, rather than limitations on the present invention.

[0032] Example 1:

[0033] 1 Knock down the expression of the Vg gene in the bee brain by microinjecting the mixed siRNA

[0034] 1.1 Experimental materials

[0035] 1.1.1 Samples: The bees are from the experimental apiary of the Institute of Apicultural Research, Chinese Academy of Agricultural Sciences, and the variety is Italian bees. The bees are collected when they bury their heads into the comb with larvae for at least 10 s to nurse.

[0036] 1.1.2 Reagents: Three siRNA preparations targeting the Vg gene synthesized by Yaoyuan Biotechnology (Shanghai) Co., Ltd. (Shanghai, China), including Vg_3408, Vg_2276, Vg_2641, as well as nonsense RNA (negative control), reference gene (B-Action), and Vg gene. The 5’→3’ sequence of the sense strand of Vg_3408 is GCAGAAAGAUCCUGUGAUAdTdT, and the antisense strand is UAUCACAGGAUCUUUCUGCdTdT. The 5’→3’ sequence of the sense strand of Vg_2276 is GGAAAGAUCUCGCGAAGAAdTdT, and the antisense strand is UUCUUCGCGAGAUCUUUCCdTdT. The 5’→3’ sequence of the sense strand of Vg_2641 is GAAGGAAACUUGAUGAUAAdTdT, and the antisense strand is UUAUCAUCAAGUUUCCUUCdTdT. The 5’→3’ sequence of the F-primer of the nonsense RNA is UUCUCCGAACGUGUCACGUTT, and the R-primer is ACGUGACACGUUCGGAGAATT. The 5’→3’ sequence of the F-primer of the reference gene is TGCCAACACTGTCCTTTCTG, and the R-primer is AGAATTGACCCACCAATCCA. The 5’→3’ sequence of the F-primer of the Vg gene (GeneID: 406088) is CTTCGAGACCAACATGCAGA, and the R-primer is TCGATCCATTCCTTGATGGT. The PBS reagent was purchased from Shanghai Beyotime Biotechnology Co., Ltd. (Shanghai, China).

[0037] 1.2 Methods

[0038] 1.2.1 Microinjection

[0039] Catch the bees. First, use forceps and an insect scalpel to make an opening at the ocellus part of the bee's head, and then use a microinjector (Ultra micro pump (model: UMP3), World Precision Instruments, Inc., USA) to inject 10 mmol / L PBS (control group) or 500 ng / μL mixed siRNA prepared with 10 mmol / L PBS (experimental group, where each siRNA is mixed at a mass ratio of 1:1:1 and the concentration of each single siRNA is 500 ng / μL) or 500 ng / μL nonsense siRNA prepared with 10 mmol / L PBS (negative control group) into the bee's brain. The volume of the injected reagent is 1 μL for all groups. The blank group does not undergo microinjection.

[0040] 1.2.2 Bee feeding and sample collection

[0041] Each group of bees was placed in an incubator at a constant temperature of 33 °C and a humidity of 40%, fed with an equal amount of sugar water (1:1, v:v), and samples were collected after 5 days. After the bees were euthanized with liquid nitrogen, they were placed on ice for dissection, the glands were removed, and the bee brain samples were collected.

[0042] 1.2.3 Extraction of bee brain RNA

[0043] The extraction of bee brain RNA was carried out according to the extraction steps of the column-type total RNA extraction and purification kit for animal tissues (Sangon Biotech (Shanghai) Co., Ltd. (Shanghai, China)).

[0044] 1.2.4 Reverse transcription

[0045] Reverse transcription was carried out according to the PrimeScript TM RT Master Mix (Perfect Real Time) kit (Beijing Baori Medical Biotechnology (Beijing) (Beijing, China)). The total input amount of bee brain RNA was controlled at 500 ng. The reverse transcription reaction was carried out at 37 °C for 15 min, and the reverse transcriptase was inactivated at 85 °C for 5 s.

[0046] 1.2.5 Fluorescent quantitative PCR

[0047] After the cDNA obtained by reverse transcription of bee brain RNA, internal reference gene and Vg gene was diluted 10 times, 2 μL was taken for qPCR, and the operation steps were carried out according to the TB Premix Ex Taq TM II FAST qPCR kit (Beijing Baori Medical Biotechnology (Beijing) (Beijing, China)). After pre-denaturation at 95 °C for 30 s in a Roche 480II real-time fluorescence quantitative PCR system (Roche, Switzerland), 45 cycles were carried out at 95 °C, 5 s → 60 °C, 30 s (fluorescence detection).

[0048] 1.2.6 Statistical analysis

[0049] The expression level of the Vg gene was calculated by the 2-△△Ct method. One-way ANOVA combined with Waller-Duncan test was used for significant difference analysis.

[0050] 1.2.7 Experimental results

[0051] The results are as Figure 1As shown, there were no significant differences among the negative control group, the control group, and the blank group, indicating that the nonsense RNA and PBS did not interfere with the expression of the Vg gene. There were significant differences between the negative control group, the control group, the blank group and the experimental group (p = 0.031 < 0.05), indicating that the mixed siRNA interfered with the expression of the Vg gene in the bee brain. This proved that microinjection of the mixed siRNA could achieve knockdown of the Vg gene in the bee brain.

[0052] 2 Microinjection of the mixed siRNA significantly regulated lipid metabolism in bees

[0053] 2.1 Experimental materials

[0054] The samples were the same as in 1.1.1. The mixed siRNA and PBS were the same as in 1.1.2. Methanol, dichloromethane, and ammonium formate were purchased from Tianjin Aladdin Reagent Co., Ltd. Acetonitrile, isopropanol, and formic acid were all of mass spectrometry grade and were purchased from Thermo Fisher Scientific (UK) Co., Ltd.

[0055] 2.2 Methods

[0056] 2.2.1 Microinjection, bee feeding, and sample collection

[0057] Microinjection of the mixed siRNA referred to 1.2.1, and at the same time, a blank group was added, and no microinjection operation was performed on the bees in this group. Bee feeding and sample collection referred to 1.2.2. 60 bees were collected in each group, and every 10 bees were randomly combined into a sample, and 6 parallel samples were set in each group.

[0058] 2.2.2 Lipid extraction from bee brain samples

[0059] To extract the lipid substances in the bee brain, first add 160 μL of methanol and 320 μL of dichloromethane to each bee brain sample. After vortex mixing, homogenize at 4 °C with an ultrasonic disruptor with the parameter of ultrasonic for 5 s and stop for 10 s for 10 min. Then add 150 μL of ultrapure water, incubate on ice for 10 min, and then centrifuge at 4 °C and 10,000 r / min for 10 min to collect the lower organic phase. Then add 250 μL of dichloromethane:methanol (2:1, V / V) mixed solution to the remaining aqueous phase and solid sample, repeat the above ultrasonic homogenization, incubation, and centrifugation operations, and collect the lower organic phase again. Combine the organic phases obtained twice, dry them under nitrogen at room temperature, filter through a 0.22 μm membrane, re-dissolve with 100 μL of dichloromethane:methanol (1:1, V / V), and finally analyze by machine. 10 μL of each sample was taken and mixed to form a quality control sample.

[0060] 2.2.3 Lipidomics method for bee brain samples

[0061] Lipidomics analysis was performed using a 1290 Infinity II high-performance liquid chromatography system combined with a 6545 LC-ESI-QTOF mass spectrometer (Agilent Technologies, USA). The lipid extract (injection volume: 2 μL) was separated on a Waters Xbridge C18 column (2.1 × 100 mm, 3.5 μm) at a temperature of 50 °C. The mobile phase used a binary solvent system, including mobile phase A (acetonitrile: water = 6:4, V / V) and mobile phase B (isopropanol: acetonitrile = 9:1, V / V), both containing 10 mmol of ammonium formate and 0.1% formic acid. The separation process was carried out at a flow rate of 0.3 mL / min for a total duration of 30 min, and the gradient elution program was as follows: at 0 min, mobile phase A accounted for 60%; at 4 min, mobile phase A accounted for 50%; at 25 min, mobile phase A increased to 100%; at 27 min, mobile phase A remained at 100%; at 27.1 min, mobile phase A decreased to 60%; at 30 min, mobile phase A remained at 60%. Data acquisition was performed in data-dependent acquisition (DDA) mode, including positive ion mode and negative ion mode, and the acquisition mass range was set to 100 to 2000 m / z. All samples were analyzed in the same batch, and at least one quality control sample was inserted every six samples. The raw data obtained from mass spectrometry analysis was processed using MS-DIAL software.

[0062] 2.3 Statistical analysis

[0063] PCA model and KEGG pathway enrichment were constructed using Metaboanalyst (https: / / www.metaboanalyst.ca / ). Lipids with significant differences were screened by combining VIP > 1, Fold change ≥ 2 or ≤ 0.5, and p value (p < 0.05). The KEGG enrichment pathways of significantly different lipids were annotated with reference to the RaMP-DB database.

[0064] 2.4 Experimental results

[0065] The results are as Figure 2 shown. In the PCA model, the quality control samples were clustered, indicating that the collected data was stable and reliable. The principal component PC1 explained 98.7% of the variability, and the control group and the experimental group were clearly separated, indicating that there were significant differences in the lipid compositions between the control group and the experimental group. From Figure 3It can be seen that there are a total of 24 significantly different lipids between the experimental group and the control group. After injecting the mixed siRNA, the levels of 13 lipids, namely PE P-18:3_16:0, PC O-18:5_22:6, PC 20:0_18:3, TG 18:2_18:2_19:3;O, Cer14:1;O2 / 18:0, SM 14:1;O2 / 21:0, SM 16:1;O2 / 24:1, PC O-16:0_14:0, SM 16:1;O2 / 20:0, TG 16:0_20:3_18:3;O3, PC O-18:3_18:0, SM 21:0;O2 / 21:1, PC 20:0_20:0, increased significantly; while the levels of 11 lipids, namely PC 18:1_18:3, PC 16:1_18:2, PC 18:0_18:3, PC 18:0_18:1, PC O-18:0_18:3, PC 18:1_18:1, PC 16:0_18:3, NAE 20:1, SM 14:0;O2 / 20:0, SM 14:1;O2 / 20:0, PC16:0_18:1, decreased significantly, indicating that microinjection of the mixed siRNA significantly regulated the lipid levels in bees. As Figure 4 shown, these 24 significantly different lipids were mainly enriched in sphingolipid metabolism: integrated pathway, and were also significantly enriched in sphingolipid pathway and Kennedy pathway of sphingolipids, indicating that microinjection of the mixed siRNA significantly regulated the sphingolipid metabolism in bees. These results suggest that after injecting the mixed siRNA, the lipid composition, lipid levels and related metabolism in the bee brain were significantly changed, indicating that microinjection of the mixed siRNA significantly regulated the lipid metabolism in bees.

[0066] 3 Microinjection of mixed siRNA inhibits the crawling behavior of bees

[0067] 3.1 Experimental materials

[0068] The combs with larvae were all from the experimental apiary of the Institute of Apicultural Research, Chinese Academy of Agricultural Sciences. The bee samples were the same as those in 1.1.1. The mixed siRNA and PBS were the same as those in 1.1.2.

[0069] 3.2 Methods

[0070] Microinjection of the mixed siRNA, feeding and sample collection of bees were respectively carried out with reference to 1.2.1 and 1.2.2, with 20 bees in each group. The bees were placed in a crawling device, and the crawling behavior of the bees was recorded using a camera device with the assistance of a supplementary lighting device ( Figure 5 ), and each bee was recorded for 20 minutes.

[0071] 3.3 Statistical analysis

[0072] Use the idTracker software to count the crawling trajectories of bees ( Figure 6 ), crawling distances ( Figure 7 ), and crawling speeds ( Figure 8 ). Unpaired sample t-tests were used for significance analysis.

[0073] 3.4 Experimental results

[0074] The results are as Figure 6 shown. The crawling trajectories of the experimental group were disordered and irregular, while the control group still had normal crawling trajectories, indicating that microinjection of mixed siRNA interfered with the crawling trajectories of bees. The results are as Figure 7 shown. The crawling distance of the experimental group was extremely significantly shorter than that of the control group (p = 0.002 < 0.025), indicating that microinjection of mixed siRNA extremely significantly inhibited the crawling distance of bees. The results are as Figure 8 shown. The crawling speed of the experimental group was extremely significantly slower than that of the control group (p = 0.0028 < 0.025), indicating that microinjection of mixed siRNA extremely significantly inhibited the crawling speed of bees. This proves that microinjection of mixed siRNA effectively inhibits the crawling behavior of bees.

[0075] 4 Microinjection of mixed siRNA is a bee-friendly behavior regulation technique

[0076] 4.1 Experimental materials

[0077] The samples were the same as those in 1.1.1. The mixed siRNA and PBS were the same as those in 1.1.2.

[0078] 4.2 Methods

[0079] Microinjection of mixed siRNA referred to 1.2.1, and at the same time, a blank group was added, and no microinjection operation was performed on the bees in this group. The feeding and sample collection of bees were the same as those in 1.2.2. During the feeding period, the daily death numbers of bees were recorded.

[0080] 4.3 Statistical analysis

[0081] Kaplan-Meier survival curves were made based on the death numbers of bees, and the log-rank test statistic was used for significance analysis of differences.

[0082] 4.4 Experimental results

[0083] The results are as Figure 9As shown, there was no significant difference in the survival curves between the experimental group and the blank group (p = 0.843 > 0.05), and there was no significant difference in the survival curves between the control group and the blank group (p = 0.567 > 0.05), indicating that microinjection is friendly to bees. There was no significant difference in the survival curves between the experimental group and the control group (p = 0.707 > 0.05), indicating that the mixed siRNA is friendly to bees. Thus, it is proved that knocking down the expression of the Vg gene in the bee brain by microinjecting the mixed siRNA is a bee-friendly technology.

Claims

1. Use of an inhibitor of the vitellogenin gene in regulating lipid metabolism in bees, wherein regulating lipid metabolism in bees means that the levels of 13 lipids, namely PE P-18:3_16:0, PC O-18:5_22:6, PC 20:0_18:3, TG 18:2_18:2_19:3;O, Cer 14:1;O2 / 18:0, SM 14:1;O2 / 21:0, SM 16:1;O2 / 24:1, PC O-16:0_14:0, SM 16:1;O2 / 20:0, TG 16:0_20:3_18:3;O3, PC O-18:3_18:0, SM 21:0;O2 / 21:1, PC 20:0_20:0, are significantly increased; while the levels of 11 lipids, namely PC 18:1_18:3, PC 16:1_18:2, PC 18:0_18:3, PC 18:0_18:1, PC O-18:0_18:3, PC18:1_18:1, PC 16:0_18:3, NAE 20:1, SM 14:0;O2 / 20:0, SM 14:1;O2 / 20:0, PC 16:0_18:1, are significantly decreased; The inhibitor of the vitellogenin gene is siRNA, which is Vg_3408, Vg_2276 or Vg_2641 or a mixture thereof. The 5’→3’ sequence of the sense strand of Vg_3408 is GCAGAAAGAUCCUGUGAUAdTdT, and the antisense strand is UAUCACAGGAUCUUUCUGCdTdT; the 5’→3’ sequence of the sense strand of Vg_2276 is GGAAAGAUCUCGCGAAGAAdTdT, and the antisense strand is UUCUUCGCGAGAUCUUUCCdTdT; the 5’→3’ sequence of the sense strand of Vg_2641 is GAAGGAAACUUGAUGAUAAdTdT, and the antisense strand is UUAUCAUCAAGUUUCCUUCdTdT.

2. The application according to claim 1, characterized in that The bees are Apis mellifera ligustica.

3. A preparation for regulating the crawling speed of bees, characterized in that, A preparation containing an agent for regulating the expression level of the vitellogenin gene, wherein the inhibitor of the vitellogenin gene is siRNA, which is Vg_3408, Vg_2276 or Vg_2641 or a mixture thereof. The 5’→3’ sequence of the sense strand of Vg_3408 is GCAGAAAGAUCCUGUGAUAdTdT, and the antisense strand is UAUCACAGGAUCUUUCUGCdTdT; the 5’→3’ sequence of the sense strand of Vg_2276 is GGAAAGAUCUCGCGAAGAAdTdT, and the antisense strand is UUCUUCGCGAGAUCUUUCCdTdT; the 5’→3’ sequence of the sense strand of Vg_2641 is GAAGGAAACUUGAUGAUAAdTdT, and the antisense strand is UUAUCAUCAAGUUUCCUUCdTdT.

4. The preparation according to claim 3, characterized in that, The honeybees described above are Apis mellifera ligustica.