Vector for protein expression and protein purification method

Abstract

The invention belongs to the technical field of protein purification, and particularly relates to a carrier for protein expression and a protein preparation method. The construction mode of the vector is as follows: a sequence for coding a 6His-Twin StrepII-MBP tag, a sequence for coding a TEV restriction enzyme cutting site, a sequence for coding a linker and a sequence for coding a target protein are sequentially inserted between polynucleotide restriction enzyme cutting sites of a vector plasmid according to a sequence. Efficient purification of the target protein can be realized by utilizing the carrier and a series of column chromatography separation (including a nickel column, an MBP column and a Strep II column). The preparation method of the protein has the advantages of easiness in purification of the protein, wide application range, easiness in mass production and the like, and has a very good application prospect.

Description

Technical Field

[0001] The invention belongs to the technical field of protein purification, and particularly relates to a vector for protein expression and a protein purification method. Background Art

[0002] Structural and protein-based drug research requires large amounts of protein. For example, crystallographic studies require at least milligrams of protein. It is almost impossible to obtain sufficient quantities of high-purity target proteins from natural organic sources or through chemical synthesis; protein libraries used for drug discovery also require careful analysis of the tertiary structure of proteins through X-ray crystallography and nuclear magnetic resonance, and these techniques require purified protein samples. Therefore, in protein structural biology research, "recombinant" methods that can produce large amounts of recombinant target proteins are indispensable. Spending as little as possible and getting as much high-purity recombinant protein as possible have become the main contradictions we face.

[0003] Column separation protein purification method is a commonly used bioengineering method, which separates the target protein from other impurities through a specific chromatographic column. According to the different fillers in the chromatographic column, it can be divided into gel column, ion exchange column, affinity chromatography column, etc. Among them, the gel column mainly uses the pore size of the gel particles for separation, the ion exchange column uses ion exchangers for separation, and the affinity chromatography column uses the specific binding of the target protein to the immobilized ligand for separation.

[0004] In the process of protein purification using affinity chromatography columns, the target protein and other impurity proteins may have very similar affinities for the chromatographic column. Therefore, how to design the separation process and control the binding and dissociation of the target protein and other impurity proteins by using different buffers and elution conditions, and finally achieve high-purity separation, is an urgent problem to be solved in this field. Summary of the invention

[0005] In view of the problems in the prior art, the present invention provides a vector for protein expression and a protein purification method.

[0006] An expression vector is a recombinant plasmid in which a sequence encoding a 6His-Twin StrepⅡ-MBP tag, a sequence encoding a TEV restriction site and a sequence encoding a linker are sequentially inserted between polynucleotide restriction sites of the plasmid.

[0007] Preferably, the sequence of the linker is GSGSGSG.

[0008] Preferably, the nucleotide sequence of the recombinant plasmid is as shown in SEQ ID NO.1.

[0009] The present invention also provides a vector for expressing a target protein, which is a recombinant plasmid in which a sequence encoding the target protein is inserted after a sequence encoding a linker of the above expression vector.

[0010] Preferably, the vector is a sequence obtained by replacing positions 6379 to 6405 in the nucleotide sequence shown in SEQ ID NO.1 with a sequence encoding a target protein.

[0011] Preferably, the target protein is a protein with an isoelectric point of 6.2-9.4; and / or, the recombinant plasmid is a recombinant PET28 plasmid or a recombinant PET21 plasmid.

[0012] The present invention also provides a method for preparing a target protein, comprising the following steps:

[0013] Step 1, expressing the above-mentioned vector in an engineered bacterium to prepare a product solution, wherein the product solution includes a target protein with an MBP tag;

[0014] Step 2, purifying the product solution by nickel column affinity chromatography to obtain target protein eluate A;

[0015] Step 3, purifying the target protein eluate A for a second time using an MBP column to obtain the target protein eluate B;

[0016] Step 4, using TEV enzyme to perform enzymatic digestion to remove the MBP tag from the target protein to obtain a mixture of the MBP tag and the target protein;

[0017] Step 5, separating the mixed solution using a StrepⅡ column to remove the MBP tag and obtain a flow-through containing the target protein.

[0018] Preferably, in step 2, eluent A, eluent B, eluent C and eluent D are used in sequence for elution, and the target protein eluent A is obtained after elution with the eluent D;

[0019] in,

[0020] The eluent A is prepared by mixing buffer-A and buffer-B in a volume ratio of 49:1, and 10 mM imidazole is added to the eluent A;

[0021] The eluent B is prepared by mixing buffer-A and buffer-B in a volume ratio of 24:1, and the eluent A is added with 20 mM imidazole;

[0022] The eluent C is prepared by mixing buffer-A and buffer-B in a volume ratio of 47:3, and the eluent A is added with 30 mM imidazole;

[0023] The eluent D is prepared by mixing buffer-A and buffer-B in a volume ratio of 1:1, and the eluent A is added with 250 mM imidazole;

[0024] The buffer-A is a buffer solution comprising the following components: 20 mM Tris, 250 mM NaCl, 10% v / v glycerol, and the pH of the buffer-A is 8.0;

[0025] The buffer-B is a buffer solution including the following components: 20 mM Tris, 250 mM NaCl, 500 mM Mimidazole, and 10% v / v glycerol. The pH of the buffer-B is 8.0.

[0026] Preferably, step 3 includes:

[0027] Step 3.1, adding the target protein eluate A to the MBP column;

[0028] Step 3.2, use buffer-A to elute the impurities;

[0029] Step 3.3, eluting with MBP-Elution buffer to obtain target protein eluate B;

[0030] in,

[0031] The buffer-A is a buffer solution comprising the following components: 20 mM Tris, 250 mM NaCl, 10% v / v glycerol, and the pH of the buffer-A is 8.0;

[0032] The MBP-Elution buffer is a buffer solution comprising the following components: 20 mM Tris, 250 mM NaCl, 10 mM maltose, 1 mM EDTA, and 1 mM DTT, and the pH of the MBP-Elution buffer is 8.0.

[0033] Preferably, step 5 includes:

[0034] Step 5.1, incubate the mixture with StrepⅡ column filler at 4°C for 1-3h;

[0035] In step 5.2, the flow-through containing the target protein is collected through the gravity chromatography column.

[0036] In order to purify the protein, the present invention constructs a new vector, transforms the traditional PET28, PET21, and other vector plasmids, inserts a sequence encoding a 6His-Twin StrepⅡ-MBP tag between the polynucleotide restriction sites, and adds a sequence encoding a TEV restriction site and a GSGSGSG linker after the MBP tag. The nucleic acid sequence of the target protein is inserted between the polynucleotide restriction sites after the GSGSGSG linker, and the restriction site to be inserted can be selected according to specific experimental requirements. After the target protein is expressed and prepared by the above-mentioned vector, a series of column chromatography separations (including nickel column, MBP column and StrepⅡ column) can be performed using the label and restriction site carried by it, and finally a high-purity target protein can be obtained.

[0037] Based on the design of the above-mentioned carrier and method flow, the advantages of the present invention are:

[0038] 1. The preparation method of the present invention is easy to purify the target protein, and almost all impurities can be removed by MBP column, so that high-purity protein can be easily obtained;

[0039] 2. GSGSGSG linker was added after the TEV site to make the enzyme cleavage more complete;

[0040] 3. The addition of Twin StrepⅡ can effectively remove the MBP tag, and has no requirements for the isoelectric point and molecular weight of the target protein, so it can be used more widely;

[0041] 4. It is convenient for mass production and helpful for commercial production.

[0042] Obviously, according to the above contents of the present invention, in accordance with common technical knowledge and customary means in the art, without departing from the above basic technical ideas of the present invention, other various forms of modification, replacement or change may be made.

[0043] The following is a further detailed description of the above contents of the present invention through specific implementation methods in the form of embodiments. However, this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples. All technologies implemented based on the above contents of the present invention belong to the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 This is a schematic diagram of the construction of the vector in Example 1;

[0045] Figure 2 is the map of the carrier in Example 1;

[0046] Figure 3 The purification result of ARG2 recombinant protein in Example 2;

[0047] Figure 4 The purification result of ENOA recombinant protein in Example 2;

[0048] Figure 5 This is the purification result of Cas1 recombinant protein in Example 2. DETAILED DESCRIPTION

[0049] In the following examples and experimental examples, all reagents and raw materials not specifically described are commercially available.

[0050] Example 1 Vectors for protein expression

[0051] The vector of this embodiment is a plasmid (for example, PET28 or PET21, PET28a is selected in this embodiment), and a sequence encoding a 6His-Twin StrepⅡ-MBP tag, a sequence encoding a TEV restriction site, a sequence encoding a linker, and a sequence encoding a target protein are inserted in sequence between the polynucleotide restriction sites of the vector plasmid.

[0052] The vector of this example is specifically constructed as follows Figure 1 , 2 As shown, the sequence of the linker is GSGSGSG. The vector of this embodiment can be used for the expression of any target protein. The sequence of the vector containing the target protein is a recombinant plasmid obtained by replacing positions 6379 to 6405 in the nucleotide sequence shown in the empty plasmid sequence (SEQ ID NO.1) with a sequence encoding the target protein, and the sequence of SEQ ID NO.1 is as follows: TGGCGAATGGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGC

[0053] TTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGGTGATGGTTCACGT

[0054] AGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGT

[0055] CCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAA

[0056] CCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGC

[0057] CTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTA

[0058] ACAAAATATTAACGTTTACAATTTCAGGTGGCACTTTTCGGGGAAATGT

[0059] GCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCC

[0060] GCTCATGAATTAATTCTTAGAAAAACTCATCGAGCATCAAATGAAACTG

[0061] CAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTT

[0062] CTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAG

[0063] ATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTA

[0064] TTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATG

[0065] AGTGACGACTGAATCCGGTGAGAATGGCAAAAGTTTATGCATTTCTTTC

[0066] CAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATCACTCG

[0067] CATCAACCAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAGACGAAA

[0068] TACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAA

[0069] CCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCA

[0070] GGATATTCTTCTAATACCTGGAATGCTGTTTTCCCGGGGATCGCAGTGGT

[0071] GAGTAACCATGCATCATCAGGAGTACGGATAAAATGCTTGATGGTCGGA

[0072] AGAGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTAA

[0073] CATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGC

[0074] ATCGGGCTTCCCATACAATCGATAGATTGTCGCACCTGATTGCCCGACAT

[0075] TATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATTTA

[0076] ATCGCGGCCTAGAGCAAGACGTTTCCCGTTGAATATGGCTCATAACACC

[0077] CCTTGTATTACTGTTTATTGTAAGCAGACAGTTTTATTGTTCATGACCAAA

[0078] ATCCCTTAACGTGAGTTTTCGTTCCCACTGAGCGTCAGACCCCGTAGAAA

[0079] AGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGC

[0080] TTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGAT

[0081] CAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCG

[0082] CAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACT

[0083] TCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTA

[0084] CCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGAC

[0085] TCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGG

[0086] GGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTG

[0087] AGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGG

[0088] AGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGA

[0089] GCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCC

[0090] TGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCG

[0091] TCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTA

[0092] CGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTT

[0093] ATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATA

[0094] CCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAG

[0095] GAAGCGGAAGAGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCG

[0096] GTATTTCACACCGCATATATGGTGCACTCTCAGTACAATCTGCTCTGATG

[0097] CCGCATAGTTAAGCCAGTATACACTCCGCTATCGCTACGTGACTGGGTC

[0098] ATGGCTGCGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGG

[0099] GCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCG

[0100] GGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGA

[0101] GGCAGCTGCGGTAAAGCTCATCAGCGTGGTCGTGAAGCGATTCACAGA

[0102] TGTCTGCCTGTTCATCCGCGTCCAGCTCGTTGAGTTTCTCCAGAAGCGT

[0103] TAATGTCTGGCTTCTGATAAAGCGGGCCATGTTAAGGGCGGTTTTTTCC

[0104] TGTTTGGTCACTGATGCCTCCGTGTAAGGGGGATTTCTGTTCATGGGGG

[0105] TAATGATACCGATGAAACGAGAGAGGATGCTCACGATACGGGTTACTGA

[0106] TGATGAACATGCCCGGTTACTGGAACGTTGTGAGGGTAAACAACTGGC

[0107] GGTATGGATGCGGCGGGACCAGAGAAAAATCACTCAGGGTCAATGCCA

[0108] GCGCTTCGTTAATACAGATGTAGGTGTTCCACAGGGTAGCCAGCAGCAT

[0109] CCTGCGATGCAGATCCGGAACATAATGGTGCAGGGCGCTGACTTCCGC

[0110] GTTTCCAGACTTTACGAAACACGGAAACCGAAGACCATTCATGTTGTT

[0111] GCTCAGGTCGCAGACGTTTTGCAGCAGCAGTCGCTTCACGTTCGCTCG

[0112] CGTATCGGTGATTCATTCTGCTAACCAGTAAGGCAACCCCGCCAGCCTA

[0113] GCCGGGTCCTCAACGACAGGAGCACGATCATGCGCACCCGTGGGGCCG

[0114] CCATGCCGGCGATAATGGCCTGCTTCTCGCCGAAACGTTTGGTGGCGGG

[0115] ACCAGTGACGAAGGCTTGAGCGAGGGCGTGCAAGATTCCGAATACCGC

[0116] AAGCGACAGGCCGATCATCGTCGCGCTCCAGCGAAAGCGGTCCTCGCC

[0117] GAAAATGACCCAGAGCGCTGCCGGCACCTGTCCTACGAGTTGCATGAT

[0118] AAAGAAGACAGTCATAAGTGCGGCGACGATAGTCATGCCCCGCGCCCA

[0119] CCGGAAGGAGCTGACTGGGTTGAAGGCTCTCAAGGGCATCGGTCGAGA

[0120] TCCCGGTGCCTAATGAGTGAGCTAACTTACATTAATTGCGTTGCGCTCA

[0121] CTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAA

[0122] TCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCCAGGGTG

[0123] GTTTTTCTTTTCACCAGTGAGACGGGCAACAGCTGATTGCCCTTCACCG

[0124] CCTGGCCCTGAGAGAGTTGCAGCAAGCGGTCCACGCTGGTTTGCCCCA

[0125] GCAGGCGAAAATCCTGTTTGATGGTGGTTAACGGCGGGATATAACATGA

[0126] GCTGTCTTCGGTATCGTCGTATCCCACTACCGAGATATCCGCACCAACG

[0127] CGCAGCCCGGACTCGGTAATGGCGCGCATTGCGCCCAGCGCCATCTGAT

[0128] CGTTGGCAACCAGCATCGCAGTGGGAACGATGCCCTCATTCAGCATTTG

[0129] CATGGTTTGTTGAAAACCGGACATGGCACTCCAGTCGCCTTCCCGTTCC

[0130] GCTATCGGCTGAATTTGATTGCGAGTGAGATATTTATGCCAGCCAGCCA

[0131] GACGCAGACGCGCCGAGACAGAACTTAATGGGCCCGCTAACAGCGCG

[0132] ATTTGCTGGTGACCCAATGCGACCAGATGCTCCACGCCCAGTCGCGTAC

[0133] CGTCTTCATGGGAGAAAATAATACTGTTGATGGGTGTCTGGTCAGAGAC

[0134] ATCAAGAAATAACGCCGGAACATTAGTGCAGGCAGCTTCCACAGCAAT

[0135] GGCATCCTGGTCATCCAGCGGATAGTTAATGATCAGCCCACTGACGCGT

[0136] TGCGCGAGAAGATTGTGCACCGCCGCTTTACAGGCTTCGACGCCGCTT

[0137] CGTTCTACCATCGACACCACCACGCTGGCACCCAGTTGATCGGCGCGA

[0138] GATTTAATCGCCGCGACAATTTGCGACGGCGCGTGCAGGGCCAGACTG

[0139] GAGGTGGCAACGCCAATCAGCAACGACTGTTTGCCCGCCAGTTGTTGT

[0140] GCCACGCGGTTGGGAATGTAATTCAGCTCCGCCATCGCCGCTTCCACTT

[0141] TTTCCCGCGTTTTCGCAGAAACGTGGCTGGCCTGGTTCACCACGCGGG

[0142] AAACGGTCTGATAAGAGACACCGGCATACTCTGCGACATCGTATAACGT

[0143] TACTGGTTTCACATTCACCACCCTGAATTGACTCTCTTCCGGGCGCTATC

[0144] ATGCCATACCGCGAAAGGTTTTGCGCCATTCGATGGTGTCCGGGATCTC

[0145] GACGCTCTCCCTTATGCGACTCCTGCATTAGGAAGCAGCCCAGTAGTAG

[0146] GTTGAGGCCGTTGAGCACCGCCGCCGCAAGGAATGGTGCATGCAAGGA

[0147] GATGGCGCCCAACAGTCCCCCGGCCACGGGGCCTGCCACCATACCCAC

[0148] GCCGAAACAAGCGCTCATGAGCCCGAAGTGGCGAGCCCGATCTTCCCC

[0149] ATCGGTGATGTCGGCGATATAGGCGCCAGCAACCGCACCTGTGGCGCC

[0150] GGTGATGCCGGCCACGATGCGTCCGGCGTAGAGGATCGAGATCTCGAT

[0151] CCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACA

[0152] ATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCAT

[0153] GGgcCATCACCACCACCACCACTGGAGCCACCCGCAGTTCGAAAAAGG

[0154] CGGCGGTTCCGGCGGTGGTTCTGGTGGCTCTAGCGCATGGAGCCATCC

[0155] GCAGTTTGAAAAAATGAAAATTGAAGAAGGCAAACTGGTGATCTGGAT

[0156] CAACGGTGATAAAGGCTACAACGGCCTGGCGGAAGTTGGTAAAAAATT

[0157] CGAAAAAGATACCGGTATCAAAGTTACCGTTGAACACCCGGACAAACT

[0158] GGAAGAAAAATTCCCGCAGGTTGCGGCGACCGGTGATGGTCCGGATAT

[0159] CATCTTCTGGGCGCACGATCGTTTCGGTGGCTACGCGCAGAGCGGTCTG

[0160] CTGGCAGAAATTACCCCGGATAAAGCGTTCCAGGATAAACTGTACCCGT

[0161] TCACCTGGGACGCGGTTCGTTATAACGGTAAACTGATTGCTTATCCGAT

[0162] CGCTGTTGAAGCGCTGTCTCTGATCTACAACAAAGATCTGCTGCCGAAC

[0163] CCGCCGAAAACCTGGGAAGAAATTCCGGCGCTGGATAAAGAACTGAA

[0164] AGCTAAAGGTAAATCTGCTCTGATGTTCAACCTGCAGGAACCGTATTTC

[0165] ACCTGGCCGCTGATTGCGGCTGATGGCGGCTACGCGTTCAAATACGAA

[0166] AACGGCAAATATGATATCAAAGATGTTGGTGTTGATAACGCGGGCGCGA

[0167] AAGCGGGCCTGACCTTTCTGGTGGATCTGATCAAAAACAAACATATGA

[0168] ACGCTGATACCGATTATAGCATCGCTGAAGCAGCGTTTAACAAAGGCGA

[0169] AACCGCGATGACCATCAACGGCCCGTGGGCGTGGTCTAACATTGATACC

[0170] TCTAAAGTTAACTACGGCGTTACCGTTCTGCCGACCTTTAAAGGTCAGC

[0171] CGTCTAAACCGTTCGTTGGCGTTCTGTCTGCAGGTATCAACGCGGCTAG

[0172] CCCGAACAAAGAACTGGCGAAAGAATTTCTGGAAAACTACCTGCTGAC

[0173] CGACGAAGGTCTGGAAGCGGTTAACAAAGATAAACCGCTGGGCGCGG

[0174] TTGCGCTGAAATCCTATGAAGAAGAACTGGTTAAAGATCCGCGTATCGC

[0175] GGCTACTATGGAAAACGCACAGAAAGGTGAAATCATGCCGAACATCCC

[0176] GCAGATGTCTGCATTCTGGTACGCGGTTCGTACCGCGGTTATCAACGCT

[0177] GCGTCTGGCCGTCAGACCGTTGATGAAGCGCTGAAAGATGCGCAGACC

[0178] AACTCCAGCAGCAACAACAACAAATAACAACAACAACAATAACCTGGGT

[0179] GAAAACCTGTACTTCCAGGGCGGTAGTGGTAGTGGTAGTccGAATTCGA

[0180] GCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCACCACCACCACCACC

[0181] ACTGAGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTG

[0182] CTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACTATATCCGGAT.

[0183] This example is used as an example of a specific solution, and the specific choice of the target protein is ARG2. The sequence encoding ARG2 (SEQ ID NO.2) is:

[0184] CATAGCGTTGCTGTTATCGGTGCGCCGTTCTCCCAGGGCCAGAAACGTAAAGGTGTTGAACACGGTCCGGCGGCGATCCGTGAAGCTGGTCTGATGAAACGTCTGTCTAGCCTGGGTTGCCACCTGAAAGATTTCGGTGATCTGAGCTTCACCCCGGTTCCGAAAGATGATCTGTATAACAACCTGATCGTTAACCCGCGTAGCGTTGGCCTGGCGAACCAGGAACTGGCGGAAGTTGTGTCCCGTGCGGTTAGCGATGGCTACAGCTGCGTTACCCTGGGCGGTGATCACTCCCTGGCGATCGGTACCATCAGCGGCCACGCGCGTCACTGCCCGGATCTGTGCGTTGTTTGGGTTGATGCGCACGCGGATATCAACACCCCGCTGACCACCTCTAGCGGTAACCTGCACGGCCAGCCGGTTAGCTTCCTGCTGCGTGAACTGCAGGACAAAGTGCCGCAGCTGCCGGGTTTCAGCTGGATCAAACCGTGCATCAGCAGCGCGAGCATCGTTTACATCGGCCTGCGTGATGTTGATCCGCCGGAACACTTCATCCTGAAAAACTATGATATCCAGTACTTCAGCATGCGTGATATTGATCGTCTGGGTATCCAGAAAGTGATGGAACGCACCTTCGACCTGCTGATCGGCAAACGTCAGCGTCCGATCCATCTGAGCTTCGATATCGACGCGTTCGACCCGACTCTGGCGCCGGCGACCGGCACCCCGGTTGTGGGTGGTCTGACCTACCGTGAAGGTATGTACATCGCAGAAGAAATCCACAACACCGGCCTGCTGAGCGCGCTGGATCTGGTGGAAGTGAACCCGCAGCTGGCGACCTCTGAAGAAGAAGCGAAAACCACCGCGAACCTGGCGGTTGATGTTATCGCGAGCTCTTTCGGTCAGACCCGTGAAGGTTAA。

[0185] The recombinant plasmid of this embodiment can be prepared according to the method of the prior art and transferred into E. coli BL21 (DE3) competent cells. Specifically, the steps include:

[0186] 1. Prepare kanamycin sulfate solution: Take 2.5 g of kanamycin, add ultrapure water to dissolve, dilute to 50 mL (final concentration is 50 mg / mL), and then filter with a 0.22 μm filter membrane on an ultra-clean workbench to sterilize.

[0187] 2. Prepare chloramphenicol solution: Take 1.7 g of kanamycin, dissolve it in ultrapure water, and make up to 50 mL (final concentration is 34 mg / mL), then filter and sterilize it with a 0.22 μm filter membrane on a clean bench.

[0188] 3. Preparation of solid culture medium containing antibiotics: Add 0.1% kanamycin and 0.1% chloramphenicol to the sterilized culture medium to prepare a solid culture medium resistant to kanamycin.

[0189] 4. Add 1 μl of the recombinant plasmid into 100 μl of E. coli Transetta (DE3) competent cells and incubate on ice for 30 minutes.

[0190] 5. Heat shock the E. coli Transetta (DE3) competent cells at 42°C for 60 seconds, and then place them in an ice bath for 2 minutes (do not shake).

[0191] 6. Add 450 μl of sterilized LB medium to the clean bench and then shake and culture at 37°C for 60 minutes.

[0192] 7. In a clean bench, take 100 μl of the culture and drop it onto a solid LB culture dish. Spread it evenly with a sterile coating rod and place it in a 37°C constant temperature incubator for overnight culture to obtain E. coli Transetta (DE3) competent cells containing the above-mentioned recombinant plasmid.

[0193] After further inducing expression in the E. coli Transetta (DE3) competent cells, a bacterial solution containing the target protein with an MBP tag can be obtained.

[0194] Example 2 ARG2 protein preparation method

[0195] This example uses the E. coli Transetta (DE3) competent cells prepared in Example 1 to induce expression and prepare the target protein, which specifically includes the following steps:

[0196] (1) Shake: Incubate the competent cells of E. coli Transetta (DE3) overnight in a 37°C constant temperature incubator. Many monoclonal bacteria will grow the next day. Pick a single clone of E. coli Transetta (DE3) and place it in 100 mL of sterile liquid LB medium (add 0.1% chloramphenicol and 0.1% kanamycin) on a clean bench.

[0197] (2) Expansion culture: Take 10-20 mL of overnight cultured E. coli Transetta (DE3) and add it to 1 L of sterile LB medium. Then add 1 mL of chloramphenicol and 1 mL of ampicillin. Incubate the culture in a shaking incubator at 37°C and 220 rpm.

[0198] (3) Induction: After the OD600 value of the expanded culture reaches 0.6-0.8, the shaking temperature is lowered to 18°C. After the shaking temperature is constant, 100 μl of IPTG solution (final concentration 0.1 mM) is added to the culture to induce the expression of the target gene. The expression is induced overnight (16-20 hours).

[0199] (4) Preparation of buffer for purifying target protein

[0200] In order to increase the solubility of the target protein, 10% v / v glycerol was added to the buffer.

[0201] Buffer-A:

[0202] 20 mM Tris, 250 mM NaCl, 10% v / v glycerol, pH = 8.0;

[0203] Buffer-B:

[0204] 20 mM Tris, 250 mM NaCl, 500 mM imidazole, 10% v / v glycerol, pH = 8.0;

[0205] MBP-elution buffer:

[0206] 20 mM Tris, 250 mM NaCl, 10 mM maltose, 1 mM EDTA, 1 mM DTT, pH = 8.0;

[0207] StrepⅡbuffer:

[0208] 100mM Tris-HCl, 150mM NaCl, 1mM EDTA, pH=8.0;

[0209] StrepⅡ-elution buffer:

[0210] 50mM d-Biotin, 100mM Tris-HCl, 150mM NaCl, 1mM EDTA, pH=8.0;

[0211] StrepⅡ-regeneration buffer:

[0212] 50 mM NaOH.

[0213] After preparation, filter with a 0.22 μm filter membrane to remove impurities and set aside.

[0214] (5) Harvesting bacteria: Add the bacterial solution after overnight induction into a centrifuge bucket and centrifuge at 3500 rpm for 15 min. Discard the supernatant and resuspend the precipitate in buffer-A (1 L of bacterial solution should be resuspended in 15-20 mL of buffer-A).

[0215] (6) Bacterial disruption: The collected bacterial resuspension is disrupted with a low-temperature high-pressure cell disruptor. Specifically, after cooling the disruptor to below 8°C, it is first washed with pure water, and then washed with buffer-A to ensure that the liquid in the flow path of the disruptor is buffer-A. Then, a resuspension without bacterial lumps is added. When the flow path is stable, the pressure is slowly increased to disrupt the bacteria. After the first disruption, the bacterial liquid becomes particularly viscous, after the second disruption, it becomes slightly clear, and after the third disruption, it becomes relatively clear and no longer viscous. After the bacteria are disrupted, the protein is exposed, so the subsequent steps are performed on ice to prevent protein denaturation.

[0216] (7) High-speed centrifugation: Add the disrupted bacterial solution into an ultracentrifuge tube, strictly balance it, and centrifuge it at 15,000 rpm for 30 min.

[0217] (8) Equilibration of the nickel column: First, wash the nickel column with buffer-B (approximately 20 column volumes) to ensure that any impurities remaining on the nickel column are washed away, then wash with pure water (approximately 20 column volumes) to flush out buffer-B, then incubate the nickel column packing with three column volumes of 0.1 M nickel chloride, then flush out the nickel chloride with pure water, and then equilibrate the nickel column with buffer-A (approximately 20 column volumes).

[0218] (9) Equilibration of the MBP column: First, wash the MBP column with MBP-Elution buffer (5 column volumes) to ensure that the impurities remaining on the MBP column are removed. Then wash it with pure water (10 column volumes) to ensure that the MBP-Elution buffer is rinsed clean. Otherwise, the residual maltose will affect the binding of the target protein to the MBP filler. Finally, equilibrate the MBP column with Buffer A (5 column volumes).

[0219] (10) Equilibration of StrepⅡ column: Load an appropriate amount of StrepⅡ agarose gel into a suitable chromatography column, wash 5 column volumes with pure water to remove the storage solution, and then equilibrate 5 column volumes with StrepⅡ buffer.

[0220] (11) Protein purification:

[0221] ① Nickel column affinity chromatography: Pour the supernatant protein solution after centrifugation into the nickel column (pour slowly, along the column wall, do not flush the filler), and discard the precipitate. After all the supernatant protein solution flows out, wash it with a mixed solution of buffer-A:buffer-B=49:1 (10mM imidazole) to obtain the W1 eluate eluted with 10mM imidazole, then wash it with a mixed solution of buffer-A:buffer-B=24:1 (20mM imidazole) to obtain the W2 eluate, and then wash it with a mixed solution of buffer-A:buffer-B=47:3 (30mM imidazole) to obtain the W3 eluate. The above elution is used to flush away the non-specifically adsorbed impurities. Finally, use buffer-A:buffer-B=1:1 (250mM imidazole) to elute the target protein to obtain the target protein eluate Elution. Then measure the protein concentration of the elution solution and roughly calculate its mass. Then, the purity of the obtained target protein was detected by SDS-PAGE protein gel electrophoresis.

[0222] ② Use MBP column for secondary purification: The efficiency of MBP filler binding protein is 6-8mg per 1mL filler (too much filler affects the recovery efficiency of the target protein, and the expected impurity removal effect may not be achieved; too little filler cannot bind all the target proteins, resulting in unnecessary loss of the target protein). Use nickel column affinity chromatography to elute the target protein to estimate the amount of MBP filler required, and take appropriate MBP filler for the second purification of the target protein. First, pass the target protein solution eluted by nickel column affinity chromatography through the MBP column. After all the liquid has passed, add Buffer-A (5-10 column volumes) to the column to elute the impurity proteins that cannot specifically bind to the MBP filler. Because the affinity of MBP filler is very high (much higher than that of nickel column), it is difficult for impurity proteins that are not fused with MBP tags to bind to the MBP filler through nonspecific adsorption, and almost all of them are eluted by Buffer-A. After elution with Buffer-A, the target protein was eluted with MBP-Elution buffer. The concentration of the target protein eluate was collected and the amount of the recovered target protein was estimated.

[0223] ③ Add 0.1% DTT to prevent the protein from forming aggregates, and then use TEV enzyme at a mass ratio of 1:100 (TEV: target protein) in a 4°C refrigerator overnight (because a GSGSGS linker is added between the target protein and the TEV cleavage site, a 1:100 TEV enzyme is sufficient to cut off the label on the target protein).

[0224] ④ Use StrepⅡ column to remove the cut MBP tag: After overnight enzyme digestion, the MBP tag and the target protein are cut by TEV enzyme. At this time, the MBP tag becomes a foreign protein and needs to be removed. The affinity of StrepⅡ column is higher than that of nickel column, but non-specific adsorption is also prone to occur when purifying the target protein directly from the cell lysate, resulting in low protein purity. Removing the cut MBP tag with StrepⅡ column will not be affected by other foreign proteins. Incubate the sample obtained by enzyme digestion in the previous step with StrepⅡ filler at 4℃ for 1-3h to allow the Twin StrepⅡ tag to completely bind to the filler, and then pass through the gravity chromatography column to collect the flow-through. At this time, the target protein is in the flow-through.

[0225] Then wash the MBP on the column with elution buffer for 10-20 column volumes. After elution, wash the column with distilled water for 3-5 column volumes, regenerate 10-20 ml with 50 mM NaOH, immediately wash it with distilled water for 3-5 column volumes, and wash it with binding buffer for 5-10 column volumes. Then it can be used for next purification or storage.

[0226] Figure 3 The SDS-PAGE electrophoresis diagram of the high-purity protein sample of ARG2 prepared according to the method of this example shows that the high-purity ARG2 sample can be prepared according to the method of this example.

[0227] Example 3 ENOA protein preparation method

[0228] The preparation method of this example is the same as that of Example 2, except that the coding sequence of the target protein in the vector is replaced with the coding sequence of ENOA, as shown in SEQ ID NO.3:

[0229]

[0230] Figure 4 The SDS-PAGE electrophoresis diagram of the high-purity protein sample of ENOA prepared according to the method of this example shows that the high-purity ENOA sample can be prepared according to the method of this example.

[0231] Example 4 Cas1 protein preparation method

[0232] The preparation method of this embodiment is the same as that of Example 2, except that the coding sequence of the target protein in the vector is replaced with the coding sequence of Cas1, as shown in SEQ ID NO.4:

[0233]

[0234] Figure 5 The ultra-high purity protein sample obtained by purifying Cas1 using the MBP-strong cation exchange column protein purification system, wherein the SDS-PAGE diagram is the electrophoresis diagram of the eluted target protein in the orange box. The results show that a high-purity Cas1 sample can be prepared according to the method of this embodiment.

[0235] In the above examples, the three recombinant proteins have different isoelectric points, the isoelectric point of ARG2 is 6.2, the isoelectric point of ENOA is 7.0, and the isoelectric point of Cas1 is 9.4. It can be seen that for proteins with isoelectric points in the range of 6.2-9.4, the method of the present invention can obtain good high-purity samples. In addition, the above three proteins are only examples, and the method of the present invention is also applicable to proteins with isoelectric points outside the range of 6.2-9.4. That is, the method of the present invention has a wide range of applicability to protein types.

[0236] It can be seen from the above examples that the present invention constructs a new vector and protein purification method, which can separate and purify proteins, has the advantages of good purification effect, wide application range and easy mass production, and has good application prospects.

Claims

1. An expression vector, Features: It is a recombinant plasmid in which a sequence encoding a 6His-Twin StrepⅡ-MBP tag, a sequence encoding a TEV restriction site and a sequence encoding a linker are sequentially inserted between the polynucleotide restriction sites of the plasmid.

2. The vector according to claim 1, Features: The sequence of the linker is GSGSGSG.

3. The vector according to claim 1, Features: The nucleotide sequence of the recombinant plasmid is shown in SEQ ID NO.

1.

4. A vector for expressing a target protein, Features: It is a recombinant plasmid in which a sequence encoding a target protein is inserted after a sequence encoding a linker of the expression vector described in any one of claims 1 to 3.

5. The vector according to claim 4, Features: The vector is a sequence obtained by replacing positions 6379 to 6405 in the nucleotide sequence shown in SEQ ID NO.1 with a sequence encoding a target protein.

6. The vector according to claim 4, Features: The target protein is a protein with an isoelectric point of 6.2-9.4; and / or, the recombinant plasmid is a recombinant PET28 plasmid or a recombinant PET21 plasmid.

7. A method for preparing a target protein, It is characterized in that The steps include: Step 1, expressing the vector according to any one of claims 4 to 6 in an engineered bacterium to prepare a product solution, wherein the product solution includes a target protein with an MBP tag; Step 2, purifying the product solution by nickel column affinity chromatography to obtain target protein eluate A; Step 3, purifying the target protein eluate A for a second time using an MBP column to obtain the target protein eluate B; Step 4, using TEV enzyme to perform enzymatic digestion to remove the MBP tag from the target protein to obtain a mixture of the MBP tag and the target protein; Step 5, separating the mixed solution using a StrepⅡ column to remove the MBP tag and obtain a flow-through containing the target protein.

8. The preparation method according to claim 7, Features: In step 2, elution is performed using eluent A, eluent B, eluent C and eluent D in sequence, and the target protein eluent A is obtained after elution with the eluent D; in, The eluent A is prepared by mixing buffer-A and buffer-B in a volume ratio of 49:1, and 10 mM imidazole is added to the eluent A; The eluent B is prepared by mixing buffer-A and buffer-B in a volume ratio of 24:1, and the eluent A is added with 20 mM imidazole; The eluent C is prepared by mixing buffer-A and buffer-B in a volume ratio of 47:3, and the eluent A is added with 30 mM imidazole; The eluent D is prepared by mixing buffer-A and buffer-B in a volume ratio of 1:1, and the eluent A is added with 250 mM imidazole; The buffer-A is a buffer solution comprising the following components: 20 mM Tris, 250 mM NaCl, 10% v / v glycerol, and the pH of the buffer-A is 8.0; The buffer-B is a buffer solution comprising the following components: 20 mM Tris, 250 mM NaCl, 500 mM imidazole, and 10% v / v glycerol. The pH of the buffer-B is 8.

0.

9. The preparation method according to claim 7, Features: Step 3 includes: Step 3.1, adding the target protein eluate A to the MBP column; Step 3.2, use buffer-A to elute the impurities; Step 3.3, eluting with MBP-Elution buffer to obtain target protein eluate B; in, The buffer-A is a buffer solution comprising the following components: 20 mM Tris, 250 mM NaCl, 10% v / v glycerol, and the pH of the buffer-A is 8.0; The MBP-Elution buffer is a buffer solution comprising the following components: 20 mM Tris, 250 mM NaCl, 10 mM maltose, 1 mM EDTA, and 1 mM DTT, and the pH of the MBP-Elution buffer is 8.

0.

10. The preparation method according to claim 7, Features: Step 5 includes: Step 5.1, incubate the mixture with StrepⅡ column filler at 4°C for 1-3h; In step 5.2, the flow-through containing the target protein is collected through the gravity chromatography column.

Images